KASP molecular markers for identifying resistance to phytophthora sojae and application thereof

By developing KASP molecular markers for resistance to soybean Phytophthora root rot and utilizing fluorescent tag PCR amplification technology, the problems of time-consuming and environmentally dependent traditional phenotypic identification have been solved. This has enabled efficient and accurate identification and breeding guidance of soybean Phytophthora root rot resistance, significantly improving breeding efficiency.

CN116814824BActive Publication Date: 2026-06-26NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING AGRICULTURAL UNIVERSITY
Filing Date
2022-03-28
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Traditional methods for identifying resistance phenotypes to soybean Phytophthora root rot are time-consuming, susceptible to environmental influences, and difficult to conduct directly inoculated identification in the field, resulting in low efficiency in resistance breeding.

Method used

We developed KASP molecular markers closely related to resistance to soybean Phytophthora root rot, and used competitive allele-specific PCR amplification technology with fluorescent tags to achieve efficient and accurate identification and genotyping of resistance to soybean Phytophthora root rot.

Benefits of technology

It enables efficient, accurate, and low-cost identification of soybean resistance to Phytophthora root rot, allowing for the screening of resistant plants at the seedling stage, significantly accelerating the breeding process. It boasts a high success rate and high accuracy, making it suitable for soybean seedling resistance identification and breeding guidance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GDA0005765078040000051
    Figure GDA0005765078040000051
  • Figure GDA0005765078040000061
    Figure GDA0005765078040000061
  • Figure GDA0005765078040000071
    Figure GDA0005765078040000071
Patent Text Reader

Abstract

The application relates to the field of agricultural biotechnology, and particularly discloses a KASP molecular marker for identifying the resistance of soybeans to phytophthora root rot and application. The KASP molecular marker primer sequence is shown in the upstream primer SEQ ID No. 1 (connected with a FAM fluorescent tag), the upstream primer SEQ ID No. 2 (connected with a VIC fluorescent tag) and the universal downstream primer SEQ ID No. 3. The KASP molecular marker can realize efficient, accurate and low-cost identification and genotyping of the resistance of soybeans to phytophthora root rot, and the effective identification and detection reaches 98.55%, and the accuracy reaches 84.80%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural biology technology, and specifically relates to the KASP molecular marker for identifying resistance to soybean Phytophthora root rot and its application. Background Technology

[0002] Soybeans originated in China and are also known as yellow soybeans. They are often called "meat of the field" and "green milk," and are a major feed and oilseed crop. Processed soybean products are very popular. Soybean blight, also known as soybean root rot, is a devastating soil-borne disease caused by *Phytophthora sojae* Kaufmann & Gerdemann, which seriously damages soybean production. Soybean blight occurs in the Huang-Huai-Hai Plain and the Yangtze River basin in my country, causing root and stem rot, seedling death, gaps in rows, poor pod development, and a high number of empty and shriveled pods. The seed coat, embryo, and cotyledons can all carry the pathogen.

[0003] Currently, the main methods for controlling soybean Phytophthora root rot include: utilizing resistant soybean varieties, spraying fungicides, improving soil drainage, changing cultivation methods, and using calcium-containing compounds. Among these, breeding and planting resistant soybean varieties is the most effective and environmentally friendly control measure. Therefore, it is essential to screen resistant resources, discover new disease-resistant genes, and elucidate the genetic and molecular mechanisms of resistance to soybean Phytophthora root rot.

[0004] Traditional phenotypic identification methods have certain limitations: they are time-consuming, easily affected by environmental factors, and cannot be directly inoculated in the field due to the soil-borne nature of this fungus. Given the current shortcomings in identifying soybean resistance to Phytophthora sojae, developing novel molecular markers for high-throughput screening of soybean resistant germplasm based on Phytophthora root rot resistance is of great significance in guiding soybean resistance breeding. Summary of the Invention

[0005] The purpose of this invention is to provide a KASP molecular marker and its application for identifying resistance to soybean Phytophthora root rot, thereby enabling efficient, accurate, and low-cost identification and genotyping of soybean Phytophthora root rot resistance. This allows for the screening of soybean seedlings with resistance to soybean Phytophthora root rot, thus accelerating the breeding process.

[0006] To achieve the above objectives, the present invention provides a KASP molecular marker primer pair closely related to resistance to soybean Phytophthora root rot. The designed KASP molecular marker primer pair includes an upstream primer SEQ ID No.1 connected to a first fluorescent tag, an upstream primer SEQ ID No.2 connected to a second fluorescent tag, and a universal downstream primer SEQ ID No.3.

[0007] The first fluorescent tag and the second fluorescent tag described in this invention can be selected from fluorescent tags commonly used in the field of fluorescent PCR, as long as they are different. For example, in some embodiments, the first fluorescent tag is a FAM fluorescent tag and the second fluorescent tag is a VIC fluorescent tag; or in other embodiments, the first fluorescent tag is a VIC fluorescent tag and the second fluorescent tag is a FAM fluorescent tag.

[0008] This invention also provides the application of the KASP molecular marker primer pair in identifying soybean germplasm resistant or susceptible to Phytophthora root rot; germplasm resistant to Phytophthora root rot is identified only if the first fluorescent tag signal connected to SEQ ID No. 1 is detected, and germplasm susceptible to Phytophthora root rot is identified only if the second fluorescent tag signal connected to SEQ ID No. 2 is detected.

[0009] This invention also provides the application of the KASP molecular marker primer pair in molecular breeding for early identification and screening of resistance or susceptibility to Phytophthora root rot in soybeans; varieties resistant to Phytophthora root rot are those that are detected only by the first fluorescent tag signal linked to SEQ ID No. 1; varieties susceptible to Phytophthora root rot are those that are detected only by the second fluorescent tag signal linked to SEQ ID No. 2.

[0010] On the other hand, the present invention also provides a method for identifying resistance to Phytophthora root rot in soybeans. This method involves extracting soybean genomic DNA and performing competitive allele-specific PCR amplification on the extracted genomic DNA using KASP-labeled primers (SEQ ID No. 1 linked to a first fluorescent tag, and SEQ ID No. 2 and SEQ ID No. 3 linked to a second fluorescent tag). Soybean varieties resistant to Phytophthora root rot are identified by fluorescence PCR that only detect the signal of the first fluorescent tag linked to SEQ ID No. 1; varieties susceptible to Phytophthora root rot are identified by fluorescence PCR that only detect the signal of the second fluorescent tag linked to SEQ ID No. 2. The first and second fluorescent tags are as described above.

[0011] The PCR amplification method used in this invention can follow conventional methods in the art. In some embodiments, the PCR amplification method of this invention is as follows:

[0012] PCR reaction system: DNA 2.5 μL (concentration around 10 ng / μL), SEQ 2X PCR mix 0.5 μL, SEQ FLu-Arms 2X PCR Mix 5 μL, ddH2O 2 μL.

[0013] PCR reaction program: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, gradient PCR at 61-55℃, 60 s per cycle, decreasing by 0.6℃ each time, for a total of 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing and amplification for 60 s, for a total of 35 cycles.

[0014] The KASP 2X PCR mix includes upstream primer SEQ ID No. 1 (linked with a FAM fluorescent tag), upstream primer SEQ ID No. 2 (linked with a VIC fluorescent tag), and universal downstream primer SEQ ID No. 3.

[0015] Further, the KASP 2X PCR mix was prepared as follows: the designed upstream primer SEQ ID No.1, upstream primer SEQ ID No.2, and universal downstream primer SEQ ID No.3 were dissolved in TE (pH 8.0) to 50 μM, and then mixed in a ratio of SEQ ID No.1:SEQ ID No.2:SEQ ID No.3 = 1:1:3 before being added to the instrument. 0.5 μL of KASP 2X PCR mix was added to every 10 μL of reaction system.

[0016] On the other hand, the application of the aforementioned KASP molecular marker for identifying soybean Phytophthora resistance in soybean Phytophthora resistance.

[0017] Furthermore, the identification method is as follows:

[0018] (1) Obtain genomic DNA from the sample to be tested

[0019] (2) Using genomic DNA as a template, competitive allele-specific PCR amplification was performed using the KASP molecular marker primers described in claim 1.

[0020] (3) After the PCR reaction is completed, the fluorescence signal generated by each reaction well is collected. The genotype of the molecular marker is determined according to the type of fluorescence signal, and then the resistance of the individual to be tested is identified.

[0021] On the other hand, the aforementioned KASP molecular markers for identifying soybean Phytophthora resistance have been applied in soybean-assisted breeding.

[0022] Compared with existing technologies, the present invention has the following improvements:

[0023] 1. Develop tightly linked KASP molecular markers near resistance genes. Applying these markers to high-throughput technologies enables efficient and rapid identification and genotyping of Phytophthora resistance in soybeans. Phytophthora-resistant soybean plants can be identified as early as the seedling stage.

[0024] 2. KASP genotyping was performed on 224 soybean micro-core germplasm resources from China, which have high genetic variation and high representativeness. 204 individuals were successfully genotyped, and 173 individuals were accurately identified. The effectiveness of the Phytophthora infestans resistance identification test reached 98.55%, and the accuracy reached 84.80%. The high success rate and accuracy of resistance identification are of great significance for the identification of Phytophthora infestans in soybeans. Detailed Implementation

[0025] The following detailed description is provided in conjunction with specific embodiments, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were all purchased from conventional biochemical reagent stores.

[0026] Example 1

[0027] 1. Genetic population construction: F1 seeds of the combination of *Phytophthora infestans* strain Nannong 10-1 (resistant to *Phytophthora infestans* strain W210) and *Williams* strain (susceptible to *Phytophthora infestans* strain W210) were self-pollinated to produce F2 seeds. F2 seeds were then self-pollinated and harvested as single plants to obtain the corresponding F1 populations. 2:3 Family lineage. Select 167 Fs in sequence. 2:3 After inoculation with *Phytophthora sojae* strain W210 (vir. 1a, 1b, 1c, 1d, 1k, 2, 3a, 3b, 3c, 4, 5, 6, 7) with the same virulence formula as JS12, 41 families were identified as resistant, 80 as heterozygous families with segregation between resistant and susceptible strains, and 46 as susceptible families. Chi-square test showed a segregation ratio of 1:2:1, indicating that the resistance of Nanjing Agricultural University 10-1 to *Phytophthora sojae* W210 is controlled by a single dominant gene, consistent with previous results from inoculation with *Phytophthora sojae* strain JS12. Using published polymorphic SSR markers on chromosome 18 and polymorphic KASP markers developed based on inter-parental whole-genome resequencing, 167 F1 lines were identified. 2:3 Genotypes of the family lineage. (Based on 167 F1 generations) 2:3 Linkage analysis of phenotypic and genotypic results in the family revealed that the *Impatiens cytotoxicum* gene was located between markers KASP1 and KASP2, and is the same gene as RpsJS. Using KASP1 and KASP2, genotyping was performed on 1893 F2 individuals from the segregating population, yielding 12 recombinant individuals. Further, markers KASP3, 4, 5, 6, and 7 were developed at equal intervals within the mapping interval, and the recombinants were genotyped. Combined with phenotypic identification results, RpsJS was precisely mapped between KASP5 and KASP6 at a physical distance of 22.8 kb.

[0028] Example 2

[0029] 1. Tightly linked molecular markers were designed within a 22.8 kb physical distance range after fine mapping, and KASP molecular markers that can be successfully used for genotyping were developed. The specific process and primer sequence information are as follows:

[0030] KASP tags: SEQ ID NO.1 (GTAGAAATTGATATGCAATGTAAACCTAC) with the FAM fluorescent tag adapter sequence attached to its 5' end and SEQ ID NO.2 (AAGTAGAAATTGATATGCAATGTAAACCTAT) with the VIC fluorescent tag adapter sequence attached to its 5' end serve as its KASP FAM forward primer (5'-3') and VIC forward primer (5'-3'). The universal downstream primer (5'-3') sequence is SEQ ID NO.3 (TCCATGTAGAGGAGATTGCCATAAACATT).

[0031] 2. For each of the 224 micro-core soybean germplasm samples to be tested, 12 seeds were sown in plastic cups with vermiculite as the substrate and cultured at 25℃ under a 14-hour light / 10-hour dark environment. Once the soybeans had grown to the point where the first pair of true leaves were fully expanded, 1 cm samples were selected. 2 DNA samples were extracted from tender leaves on both sides using a DNA extraction kit, and the samples were numbered and preserved. Simultaneously, seedlings with uniform growth were selected for inoculation. A small incision was made 1 cm below the hypocotyl of the soybean using a sterilized scalpel. Culture medium containing mycelium was excised from the outer edge of a colony of the strain after approximately 7 days of culture and embedded into the incision. The mixture was kept moist for 24 hours after inoculation, then transferred to a greenhouse for normal growth. Disease assessment was conducted approximately 7 days post-inoculation, with Williams as a susceptible control, and the experiment was repeated three times.

[0032] 3. Molecular marker detection: (1) PCR reaction system: DNA 2.5μL (concentration around 10ng / μL), KASP 2X PCR mix 0.5μL, GUDE FLu-Arms 2X PCR Mix (Guangzhou Gude Biotechnology Co., Ltd.) 5μL, ddH2O 2μL. Preparation of the KASP 2X PCR mix: The designed upstream primer SEQ ID No.1, upstream primer SEQ ID No.2 and universal downstream primer SEQ ID No.3 were dissolved in TE (pH 8.0) to 50μM, and then mixed in a ratio of upstream primer SEQ ID No.1: upstream primer SEQ ID No.2: universal downstream primer SEQ ID No.3 = 1:1:3 before being added to the instrument. 0.5μL of KASP 2X PCR mix was added to every 10μL of reaction system. (2) PCR reaction program: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, gradient PCR at 61-55℃, 60 s per cycle, decreasing by 0.6℃ each time, for a total of 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing and amplification for 60 s, for a total of 35 cycles. (3) Molecular marker detection steps: Genomic DNA was extracted from disease-resistant Nannong 10-1 and disease-susceptible Williams, as well as 224 micro-core germplasm resources, using a rapid plant genomic DNA extraction kit. Using the genomic DNA of each material sample as a template, the sample DNA concentration was adjusted to the same concentration (approximately 500 ng / μL). 2.5 μL was aliquoted into the corresponding positions of a 96-well PCR plate and a blank control was set up. The 96-well PCR reaction plate was sealed, shaken, and centrifuged to ensure that the reaction system was mixed evenly. PCR amplification was performed using KASP-labeled primers. After PCR, the PCR data was read (the real-time PCR instrument used was a CFX Connect™ Real-Time System manufactured by BIO-RAD).

[0033] 4. Data analysis was performed using the software Bio Rad CFX Maestro. On the image coordinates, allele data tagged with FAM fluorescent sequences were aggregated near the Y-axis, while allele data tagged with VIC fluorescent sequences were aggregated near the X-axis. The genotype near the X-axis was TT, indicating a susceptible variety of soybean Phytophthora root rot, while the genotype near the Y-axis was CC, indicating a resistant variety of soybean Phytophthora root rot. The results are shown in Table 1. "Undetermined" indicates a failed detection, and "NA" indicates missing data or materials.

[0034] Table 1: Marker typing and results of soybean Phytophthora root rot resistance identification

[0035]

[0036]

[0037]

[0038]

[0039] Table 1 shows that the genotyping method was used to predict resistance to Phytophthora root rot in soybeans. The results of the experiment verified that 204 out of 224 individuals were successfully genotyped, and 173 individuals were accurately identified. The effectiveness of the Phytophthora resistance identification test reached 98.55%, and the accuracy reached 84.80%, indicating a high success rate and high accuracy in resistance identification.

[0040] In summary, the KASP molecular marker for identifying soybean Phytophthora root rot resistance in this invention is efficient, accurate, and low-cost for identifying and genotyping soybean Phytophthora root rot resistance.

[0041] The foregoing description of specific exemplary embodiments of the present invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application. The scope of the invention is intended to be defined by the claims and their equivalents. sequence list <110> Nanjing Agricultural University <120> KASP molecular markers for identifying soybean Phytophthora resistance and their application <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <400> 1 gtagaaattg atatgcaatg taaacctac 29 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <400> 2 aagtagaaat tgatatgcaa tgtaaaccta t 31 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <400> 3 tccatgtaga ggagaattgcc ataaacatt 29

Claims

1. The application of KASP molecular marker primer pairs in identifying resistance or susceptibility to soybean Phytophthora root rot, characterized in that, The KASP molecular marker primer pair includes an upstream primer SEQ ID No. 1 connected to a first fluorescent tag, an upstream primer SEQ ID No. 2 connected to a second fluorescent tag, and a universal downstream primer SEQ ID No. 3; the soybean germplasm resistant to Phytophthora root rot is characterized by only detecting the first fluorescent tag signal connected to SEQ ID No. 1, and the soybean germplasm susceptible to Phytophthora root rot is characterized by only detecting the second fluorescent tag signal connected to SEQ ID No.

2.

2. The application according to claim 1, characterized in that, The first fluorescent tag is the FAM fluorescent tag, and the second fluorescent tag is the VIC fluorescent tag.

3. The application according to claim 1, characterized in that, The first fluorescent tag is a VIC fluorescent tag, and the second fluorescent tag is a FAM fluorescent tag.

4. The application of KASP molecular marker primer pairs in molecular breeding for early identification and screening of resistance or susceptibility to soybean Phytophthora root rot, characterized in that... The KASP molecular marker primer pair includes an upstream primer SEQ ID No. 1 connected to a first fluorescent tag, an upstream primer SEQ ID No. 2 connected to a second fluorescent tag, and a universal downstream primer SEQ ID No. 3; the soybean germplasm resistant to Phytophthora root rot is characterized by only detecting the first fluorescent tag signal connected to SEQ ID No. 1; the soybean germplasm susceptible to Phytophthora root rot is characterized by only detecting the second fluorescent tag signal connected to SEQ ID No.

2.

5. The application according to claim 4, characterized in that, The first fluorescent tag is the FAM fluorescent tag, and the second fluorescent tag is the VIC fluorescent tag.

6. The application according to claim 4, characterized in that, The first fluorescent tag is a VIC fluorescent tag, and the second fluorescent tag is a FAM fluorescent tag.

7. A method for identifying resistance to soybean Phytophthora root rot, characterized in that: Soybean genomic DNA was extracted, and competitive allele-specific PCR amplification was performed on the extracted genomic DNA using KASP molecular marker primers shown in SEQ ID No. 1 (linked to the first fluorescent tag), SEQ ID No. 2 (linked to the second fluorescent tag), and SEQ ID No. 3 (linked to the second fluorescent tag). Soybean germplasm resistant to Phytophthora root rot was identified by fluorescent PCR when only the signal of the first fluorescent tag linked to SEQ ID No. 1 was detected; soybean germplasm susceptible to Phytophthora root rot was identified when only the signal of the second fluorescent tag linked to SEQ ID No. 2 was detected.

8. The method for developing resistance to Phytophthora root rot in soybeans according to claim 7, characterized in that: The first fluorescent tag is the FAM fluorescent tag, and the second fluorescent tag is the VIC fluorescent tag.

9. The method for developing resistance to Phytophthora root rot in soybeans according to claim 7, characterized in that: The first fluorescent tag is a VIC fluorescent tag, and the second fluorescent tag is a FAM fluorescent tag.

10. The method for developing resistance to Phytophthora root rot in soybeans according to claim 7, characterized in that, PCR reaction system: 2.5 μL of DNA at a concentration of 8–12 ng / μL, 0.5 μL of KASP 2X PCR mix, 5 μL of GUDE FLu-Arms 2X PCRMix, and 2 μL of ddH2O; the upstream primer SEQ ID No.1, upstream primer SEQ ID No.2, and universal downstream primer SEQ ID No.3 are mixed in a ratio of 1:1:3, and 0.5 μL of KASP 2X PCR mix is ​​added to every 10 μL of reaction system.

11. The method for developing resistance to Phytophthora root rot in soybeans according to claim 7, characterized in that, PCR reaction program: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, gradient PCR at 61-55℃, 60 s per cycle, decreasing by 0.6℃ each time, for a total of 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing and amplification for 60 s, for a total of 35 cycles.