InDel molecular marker, primer and application thereof for identifying plum blossom single and double petal traits

By developing InDel molecular markers InDel9 and InDel90, and utilizing PCR amplification and electrophoresis detection, the problem of early identification of single and double petal traits in plum blossoms was solved, enabling rapid, accurate, and low-cost auxiliary identification for plum blossom breeding and improving breeding efficiency.

CN116254360BActive Publication Date: 2026-06-23HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2022-07-19
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing technologies are insufficient for reliably identifying single and double petal traits in plum blossoms at an early stage. Traditional breeding methods are inefficient, and the application scope of molecular markers is limited, making large-scale verification impossible.

Method used

InDel molecular markers InDel9 and InDel90 were developed, located at specific positions on chromosome 1 of the plum blossom. The single and double petal traits of plum blossoms were identified by PCR amplification and polyacrylamide gel electrophoresis using primers InDel9 F/R and InDel90 F/R.

Benefits of technology

It enables rapid and accurate identification of single-petal and double-petal traits in plum seedlings, which shortens the time and reduces the cost compared with traditional breeding, and the accuracy rate is 100% in 69 plum varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application discloses an InDel molecular marker for identifying MeiGua single and double petal characters, a primer and application thereof, and comprises two InDel molecular markers, namely InDel 9 located at 5549358~5549382bp of a No.1 chromosome of MeiGua and InDel 90 located at 6309277~6309290bp of the No.1 chromosome of MeiGua. The application also develops a primer for amplifying the two InDel markers. The molecular marker can be used for quickly and efficiently identifying MeiGua single and double petal varieties at a seedling stage of MeiGua, and the accuracy rate reaches 100%. Compared with traditional breeding which needs to wait for about four years for flowering, the marker has the advantages of early time, low cost, accuracy and rapidness when applied to assisted breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and more specifically, to an InDel molecular marker, primer, and their application for identifying single and double petal traits in plum blossoms. Background Technology

[0002] plum bossom( Prunus mume *Prunus spp.* (Sieb. et Zucc.) belongs to the genus *Prunus* of the subfamily Prunoideae in the family Rosaceae. It is a traditional Chinese flower with a cultivation history of over 3000 years. It is beloved for its unique ornamental characteristics, with the number of petals being one of the most important ornamental traits besides flower color, fragrance, petal shape, and tree shape. The original plum blossom variety was single-petaled, but through long-term cultivation and domestication, double-petaled and tiered varieties emerged, possessing high ornamental value and becoming popular. As a woody plant, the plum blossom has a long juvenile stage, and traditional breeding methods based on phenotypic traits greatly limit breeding efficiency.

[0003] Molecular markers are markers at the gene level, directly detecting genetic variations at the DNA molecular level. They are unaffected by factors such as tissue and organ type, developmental stage, and habitat conditions, exhibiting high polymorphism and genetic stability. Insertion-deletion length polymorphism (InDel) markers are length polymorphism variations resulting from the insertion or deletion of a certain number of nucleotides at allele loci. Belonging to the third generation of molecular markers, they are primarily developed based on whole-genome sequencing and possess advantages such as high marker specificity, good stability, simple detection methods, and cost-effectiveness.

[0004] Zhang Jie (Zhang Jie. Construction of a high-density genetic map of plum blossom and QTL analysis of some ornamental traits [D]. Beijing Forestry University, 2016.) used Specific-Locus Amplified Fragment Sequencing (SLAF-seq) technology to develop molecular markers across the entire genome of plum blossom, constructing a genetic linkage map with the highest marker density for plum blossom, and locating the double-petal trait to 116.46 Mb on chromosome 2 of plum blossom, while also obtaining a SLAF molecular marker that may be closely linked to the double-petal trait of plum blossom. Zheng Tangchun et al. (Zheng Tangchun, Zhang Qixiang, Liu Weichao, Cheng Tangren, Wang Jia. A gene controlling single and double petal traits in plum blossom and its molecular marker and application) identified a gene controlling single and double petal traits in plum blossom through BSA analysis. PmAP2-like Genes and InDel markers were used, but only in 20 plum blossom varieties, resulting in a limited application scope.

[0005] Because previous research on double-petaled plum blossoms is limited, there are few reports on molecular markers for this trait, or they have not been validated on a large scale among varieties. Therefore, it is impossible to reliably identify single-petaled and double-petaled traits in plum blossom hybrids at an early stage. Thus, it is necessary to further develop molecular markers linked to single-petaled and double-petaled plum blossoms to assist in the breeding of double-petaled plum blossoms. Summary of the Invention

[0006] The purpose of this invention is to provide an InDel molecular marker, primer, and its application for identifying single and double petal characteristics of plum blossoms.

[0007] To achieve the objectives of this invention, in a first aspect, this invention provides an InDel molecular marker for identifying single and double petal traits in plum blossoms, specifically InDel9, located in the genome version [missing information]. Prunus mume According to Genome v1.0 (http: / / prunusmumegenome.bjfu.edu.cn / ), at positions 5549358~5549382bp on chromosome 1 of plum blossom, when the value of ATTTTCAAACTTGTACTTATCTAT is present, it corresponds to the single-petal trait of plum blossom; when the value of ATTTTCAAACTTGTACTTATCTAT is absent from chromosome 1 of plum blossom, it corresponds to the double-petal trait of plum blossom.

[0008] Secondly, the present invention provides primers for amplifying the molecular marker InDel9, including an upstream primer as shown in SEQ ID NO:1 and a downstream primer as shown in SEQ ID NO:2.

[0009] Thirdly, the present invention provides a reagent or kit for detecting single or double petal characteristics of plum blossoms, which contains primer pairs SEQ ID NO:1-2.

[0010] Fourthly, the present invention provides any of the following applications of the molecular marker InDel9, primers for amplifying InDel9, or detection reagents or kits containing the primers:

[0011] 1) Used for identifying single and double petal characteristics of plum blossoms;

[0012] 2) Used for early prediction of single and double-petaled plum blossoms;

[0013] 3) Used for molecular marker-assisted breeding of plum blossoms.

[0014] Fifthly, the present invention provides a method for identifying single and double petal characteristics of plum blossoms, comprising the following steps:

[0015] 1) Extract genomic DNA from the plum blossom to be tested;

[0016] 2) Using the DNA extracted in step 1) as a template, PCR amplification was performed using the primers shown in SEQ ID NO:1-2;

[0017] 3) Analyze the amplification product: If the amplification product size is 204bp, then the plum blossom to be tested is a double-petaled trait.

[0018] Sixthly, this invention provides an InDel molecular marker for identifying single and double petal traits in plum blossoms, specifically InDel90, located in the genome version [missing information]. Prunus mume According to Genome v1.0 (http: / / prunusmumegenome.bjfu.edu.cn / ), at positions 6309277~6309290bp on chromosome 1 of the plum blossom flower, when chromosome 6309277~6309290bp is TTGTATGATTGCA, it corresponds to the single-petal trait of plum blossom; when chromosome 6309277~6309290bp does not contain TTGTATGATTGCA, it corresponds to the double-petal trait of plum blossom.

[0019] In a seventh aspect, the present invention provides primers for amplifying the molecular marker InDel9, including an upstream primer as shown in SEQ ID NO:3 and a downstream primer as shown in SEQ ID NO:4.

[0020] Eighthly, the present invention provides a reagent or kit for detecting single or double petal characteristics of plum blossoms, which contains primer pairs SEQ ID NO:3-4.

[0021] In a ninth aspect, the present invention provides any of the following applications of the molecular marker InDel9, primers for amplifying InDel9, or detection reagents or kits containing the primers:

[0022] 1) Used for identifying single and double petal characteristics of plum blossoms;

[0023] 2) Used for early prediction of single and double-petaled plum blossoms;

[0024] 3) Used for molecular marker-assisted breeding of plum blossoms.

[0025] In a tenth aspect, the present invention provides a method for identifying single and double petal characteristics of plum blossoms, comprising the following steps:

[0026] (1) Extract genomic DNA from the plum blossom to be tested;

[0027] (2) Using the DNA extracted in step (1) as a template, PCR amplification was performed using the primers shown in SEQ ID NO:3-4;

[0028] (3) Analyze the amplification product: If the amplification product size is 234bp, then the plum blossom to be tested is a double-petaled trait.

[0029] Furthermore, the PCR amplification system used in this invention includes: 1 μL of 50 ng / μL DNA template, 10 μL of 2×TaqPCR mix, 1 μL each of 10 μM upstream and downstream primers, and ddH2O to bring the total to 20 μL.

[0030] The PCR reaction program is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 51℃ annealing for 30 s, 72℃ extension for 40-60 s (preferably 72℃ extension for 60 s), 30 cycles; 72℃ final extension for 5 min, and storage at 4℃.

[0031] In this invention, the plum blossom varieties / materials to be tested include, but are not limited to, 'Xuemei', 'Fenpigongfen', and their hybrid offspring.

[0032] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0033] (i) This invention provides an InDel molecular marker that can identify single and double petal traits of plum blossoms at an early stage. Using the marker primers InDel9 F / R or InDel90 F / R, single and double petal varieties of plum blossoms can be identified quickly and efficiently during the seedling stage. In contrast, traditional breeding requires about four years to wait for flowering. This marker has the advantages of early time, low cost, accuracy and speed when applied to assisted breeding.

[0034] (ii) The InDel molecular marker method for early identification of single and double petal traits of plum blossoms provided by this invention can be used with ordinary PCR and polyacrylamide gel electrophoresis, compared with other marker types such as SNP, without the need for sequencing. It is simple, fast and low cost.

[0035] (iii) The molecular marker of the present invention was verified in 69 plum blossom varieties with an accuracy rate of 100%. Therefore, the use of this molecular marker to identify single-petal and double-petal plum blossom varieties in the early stage is reliable. Attached Figure Description

[0036] Figure 1 The frequency distribution of the number of each floral organ in the 'Xuemei' × 'Fenpigongfen' F1 population in a preferred embodiment of the present invention.

[0037] Figure 2 This is a diagram showing the distribution of variation sites Δ(All-index) in a mixed pool of single-petal and double-petal plum blossom materials in a preferred embodiment of the present invention.

[0038] Figure 3 This is a density distribution map of variant sites with Δ (All-index) between 0.4 and 0.6 in a preferred embodiment of the present invention.

[0039] Figure 4The phenotypic diagrams of single-petal and double-petal plum blossom varieties in a preferred embodiment of the present invention are shown (left is the single-petal variety and right is the double-petal variety).

[0040] Figure 5 This is a diagram showing the amplification results of InDel9 in 69 plum blossom varieties in a preferred embodiment of the present invention.

[0041] Figure 6 This is a diagram showing the amplification results of InDel90 in 69 plum blossom varieties in a preferred embodiment of the present invention. Detailed Implementation

[0042] This invention provides two InDel molecular markers for early identification of single and double petal traits in plum blossoms. InDel 9 is located at 5549358~5549382bp on chromosome 1 of plum blossom in Prunus mume Genome v1.0 (http: / / prunusmumegenome.bjfu.edu.cn / ). When chromosome 1 of plum blossom 5549358~5549382bp is ATTTTCAAACTTGTACTTATCTAT, it corresponds to the single-petal trait of plum blossom; when chromosome 1 of plum blossom 5549358~5549382bp does not contain ATTTTCAAACTTGTACTTATCTAT, it corresponds to the double-petal trait of plum blossom. InDel 90 is located at chromosome 1 of plum blossom 6309277~6309290bp. When chromosome 1 of plum blossom 6309277~6309290bp is TTGTATGATTGCA, it corresponds to the single-petal trait of plum blossom; when chromosome 1 of plum blossom 6309277~6309290bp does not contain TTGTATGATTGCA, it corresponds to the double-petal trait of plum blossom.

[0043] The accuracy rate was 100% when 69 plum blossom varieties were used for verification.

[0044] The present invention also provides two pairs of primers for amplifying the molecular markers, as follows:

[0045] Forward primer InDel9 F: 5'-GCAAGGTCTGTCGTGGA-3' (SEQ ID NO:1)

[0046] Reverse primer InDel9 R: 5'-GCAAAACTAATATGGTTGTAGC-3' (SEQ ID NO:2)

[0047] Forward primer InDel90 F: 5'-TATTGTGTTAGGTTTTCCCA-3' (SEQ ID NO:3)

[0048] Reverse primer InDel90 R: 5'-CCAGTTTTGACTATTTCGG-3' (SEQ ID NO:4)

[0049] Furthermore, the present invention provides a method for early identification of single-petal and double-petal characteristics of plum blossoms, comprising the following steps:

[0050] Step 1: Extract genomic DNA from the variety or material to be identified;

[0051] Step 2: Using the DNA extracted in Step 1 as a template, perform PCR amplification on it using the molecular marker or the molecular marker primer pair;

[0052] Step 3: Separate the PCR amplification products from Step 2 by electrophoresis to obtain the band patterns of each sample. If a 204bp fragment is obtained by amplification using the InDel9 F / R primer pair, it indicates that the variety or material to be identified is a double-flowered plum blossom. If a 234bp fragment is obtained by amplification using the InDel90 F / R primer pair, it indicates that the variety or material to be identified is a double-flowered plum blossom.

[0053] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2001), or as recommended in the manufacturer's instructions.

[0054] Example 1: Development of InDel molecular markers related to single and double petal traits in plum blossoms

[0055] 1. Experimental Materials

[0056] The test materials were 'Xuemei', 'Fenpi Gongfen', and the F1 segregating population obtained from 'Xuemei' × 'Fenpi Gongfen'. The parents showed significant differences in the number of petals; the maternal parent was a single-petaled variety with 5 petals, while the paternal parent was a double-petaled variety with an average of 23.5 petals. All materials were planted in the Plum Garden of the Student Activity Center, Huazhong Agricultural University, Wuhan, Hubei Province.

[0057] 2. Mixed population segregation (BSA) whole-genome resequencing

[0058] Ten single-petaled and ten double-petaled progeny plants were selected from the 'Xuemei' × 'Fenpi Gongfen' F1 population. DNA was extracted and mixed in equal amounts to construct single-petaled and double-petaled gene pools, respectively. The qualified DNA samples were randomly fragmented into 350 bp fragments. The DNA fragments underwent end repair, polyA tailing, sequencing adapter addition, purification, and PCR amplification to complete the library preparation. The constructed libraries were sequenced using an Illumina HiSeq™ PE150.

[0059] 3. BSA analysis

[0060] like Figure 1 As shown, the frequency distribution of the number of each floral organ in the 'Xuemei' × 'Fenpigongfen' F1 population indicates that neither the number of petals nor the number of petal layers conforms to a normal distribution, and the segregation ratio of single-petaled to double-petaled offspring is approximately 1:1. Based on the genetic patterns of double petals in peach and rose, it is inferred that double petals are a qualitative trait in plum blossoms. When analyzing based on the premise that double petals are a dominant trait, the Manhattan plot of Δ(All-index) between single-petaled and double-petaled offspring shows a significant peak on chromosome 1. Figure 2 Following the method of Dougherty et al. (2018), variant sites with an Δ (All-index) of 0.4-0.6 were screened and density maps were plotted. The results showed that the variant density in the Chr 1:3-14Mb region was significantly higher than the average variant density, indicating that it may be related to the double-petal gene of plum blossoms. Therefore, it was designated as a candidate region for double-petal growth. Figure 3 (Dougherty et al 2018). This candidate region contains 17,490 variant sites with an all-index of Δ (0.4–0.6), including 15,599 SNP sites and 1,891 InDel sites.

[0061] 4. Development of InDel markers within the positioning interval

[0062] A total of 196 InDel sites with a length greater than 10 bp were randomly selected for initial screening. Based on the plum blossom reference genome information, the selected sites were mapped onto the genome. 200 bp sequences upstream and downstream of each InDel site were taken, and primers were designed using Primer Premier 5.0 software. The product size ranged from 100 to 450 bp, and 172 primer pairs were successfully designed. The materials used for the initial screening of InDel primers were 'Fenpigongfen', 'Xuemei', 'Xuemei' × 'Fenpigongfen' F1 generation double-petal mixed pools, and F1 generation single-petal mixed pools. DNA was extracted from these samples for PCR amplification. The PCR amplification system included 1 μL of 50 ng / μL DNA template, 10 μL of 2×Taq PCR mix, 1 μL each of 10 μM upstream and downstream primers, and ddH2O to a final volume of 20 μL. The PCR reaction program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 51℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles; 72℃ final extension for 5 min, and storage at 4℃. The amplified products were detected by 1% agarose gel electrophoresis, and all 172 primer pairs were successfully amplified. Then, 8% polyacrylamide gel electrophoresis was used to detect polymorphic bands between single-petal and double-petal varieties of the primers. Using 10 F1 generation single-petal individuals and 10 F1 generation double-petal individuals from a mixed pool, the 52 InDel primers obtained from the initial screening were validated. Two InDel molecular markers linked to the single-petal and double-petal traits of plum blossoms were identified.

[0063] Example 2: Validation of InDel molecular markers related to single and double petal traits in plum blossoms

[0064] 1. Experimental Materials

[0065] This experiment used 69 plum blossom varieties, including 47 double-petaled varieties and 22 single-petaled varieties (Table 1). Figure 4 All materials are preserved at the China Plum Blossom Research Center (Wuhan).

[0066] Table 1 Information on 69 plum blossom varieties

[0067]

[0068]

[0069]

[0070] 2. Experimental Methods

[0071] Genomic DNA was extracted from plum blossom varieties using the Magen HiPure SF Plant DNA Mini Kit. Using the genomic DNA as a template, PCR amplification was performed using InDel9 F / R or InDel90 F / R primers. The PCR amplification system consisted of 1 μL of 50 ng / μL DNA template, 10 μL of 2×Taq PCR mix, 1 μL each of 10 μM forward and reverse primers, and ddH2O added to a final volume of 20 μL. The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 51℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles; final extension at 72℃ for 5 min. The detection was performed using 8% polyacrylamide gel electrophoresis. If a 204bp fragment was obtained by amplification using the InDel9 F / R primer pair, it indicates that the variety or material to be identified is a double-flowered plum blossom. If a 234bp fragment was obtained by amplification using the InDel90 F / R primer pair, it indicates that the variety or material to be identified is a double-flowered plum blossom.

[0072] 3. Experimental Results

[0073] When using InDel9 F / R primers to detect plum blossoms, all 47 double-petaled plum blossom varieties amplified a band at the 204bp position, while none of the 22 single-petaled plum blossom varieties amplified a band at the 204bp position. Figure 5 When using InDel90 F / R primers to detect plum blossoms, all 47 double-petaled plum blossom varieties amplified a band at the 234bp position, while none of the 22 single-petaled plum blossom varieties amplified a band at the 234bp position. Figure 6 In conclusion, InDel9 F / R and InDel90 F / R achieved 100% accuracy in identifying single and double petal traits among 69 plum blossom varieties, demonstrating a high level of accuracy.

[0074] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for identifying single and double petal characteristics of plum blossoms, characterized in that, Includes the following steps: (1) Extract genomic DNA from the plum blossom to be tested; (2) Using the DNA extracted in step (1) as a template, PCR amplification was performed using the primers shown in SEQ ID NO:3-4; (3) Analysis of amplification products: If the amplification product shows a band of 234bp, the plum blossom to be tested is double-petaled; if the amplification product does not show a band at the 234bp position, the plum blossom to be tested is single-petaled.

2. The method according to claim 1, characterized in that, The PCR amplification system used in step (2) includes: 1 μL of 50 ng / μL DNA template, 10 μL of 2×Taq PCR mix, 1 μL each of 10 μM upstream and downstream primers, and ddH2O to bring the total to 20 μL.

3. The method according to claim 1 or 2, characterized in that, The PCR reaction program used in step (2) is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 51℃ annealing for 30 s, 72℃ extension for 40~60 s, 30 cycles; 72℃ final extension for 5 min, and storage at 4℃.