A fusion adeno-associated virus and its application

Abstract

The present invention relates to the field of biomedicine, and discloses a fusion-type adeno-associated virus and its application in ear diseases and ophthalmic diseases. The fusion-type adeno-associated virus comprises a fusion peptide segment or a variant thereof formed by fusing peptide segments of serotypes AAV1, 2, 6 and 7, which can efficiently transduce hair cells and / or supporting cells in the cochlea, promote the regeneration of inner hair cells, and help restore hearing. The adeno-associated virus can also efficiently infect the RPE layer and is used for the treatment of ophthalmic diseases. As a safe vector, the fusion-type adeno-associated virus has broad application prospects in the treatment of ear diseases or ophthalmic diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and relates to a fusion-type adeno-associated virus and an application thereof, and in particular to an application thereof in the prevention and / or treatment of ear diseases and / or eye diseases. Background Art

[0002] There are more than 7,000 human diseases known so far, of which about 80% are caused by genetic problems. More than 300 million people in the world suffer from genetic diseases. Current chemotherapy and protein therapy can only treat less than 500 human diseases, and are usually ineffective against diseases caused by genetic problems, so new drugs and treatment plans need to be developed.

[0003] Gene therapy is an emerging treatment method that can deliver functional genes into patients to counteract or replace dysfunctional genes, thereby curing diseases without the intervention of chemotherapy, radiotherapy or surgery. Gene therapy introduces genetic material into target cells through viral or non-viral vectors to treat or prevent diseases by correcting or supplementing defective genes. The therapeutic effect can be long-lasting and does not require repeated intervention. Gene therapy can be achieved through ex vivo or in vivo strategies. Ex vivo gene therapy is to collect target cells from patients, genetically modify them and return them to the patient's body; in vivo gene therapy is to deliver genetic material directly to the patient's target organ or tissue. Various types of gene delivery strategies have been used to treat a variety of diseases such as cancer, blindness, immune and neuronal diseases.

[0004] Viral vectors are the most commonly used gene therapy delivery vectors because of their high efficiency in entering cells and introducing genetic material. Commonly used vectors include adenovirus, retrovirus, lentivirus, and adeno-associated virus (AAV). Today, AAV vectors have achieved good results in clinical trials of in vivo gene therapy, and retrovirus and lentivirus vectors are the preferred vectors in in vitro gene therapy clinical trials. The main factors for AAV's success as a therapeutic gene delivery vector are its low immunogenicity and lack of pathogenicity. Multiple marketed drug approvals and ongoing clinical trials have proven that AAV vectors have become one of the main gene delivery tools for gene therapy. In 2012, Glybera was the first AAV therapy approved in Europe for the treatment of lipoprotein lipase deficiency. The launch of these drugs clearly demonstrated the safety and efficacy of AAV-based treatments. Since then, Luxturna for the treatment of Leber congenital amaurosis and Zolgensma for the treatment of spinal muscular atrophy (SMA) have been approved by the US Food and Drug Administration (FDA) in 2017 and 2019, respectively. Current clinical research focuses on the treatment of monogenic diseases by gene replacement, gene silencing, or gene editing. In addition to being used to treat a variety of diseases such as cancer, blindness, immune and neuronal diseases, AAV is also expected to be used in vaccine development.

[0005] Although AAV has the characteristics of low immunogenicity and low pathogenicity, and AAV-based gene therapy has also achieved amazing success, up to 50% of patients are currently excluded from this treatment method due to the pre-existing neutralizing antibodies of natural AAV capsid proteins in the human immune system. To circumvent this immune barrier, engineered AAV capsids can be used to evade pre-existing neutralizing antibodies or to temporarily remove neutralizing antibodies before treatment. Engineered AAV capsids can not only evade neutralizing antibodies, but also enable AAV to target the expected tissue cell types to achieve the purpose of precision treatment. Directed evolution is a powerful tool for modifying AAV capsids. In principle, directed evolution uses high-throughput technology to introduce mutations into genes and their encoded proteins, and simulates natural evolution to greatly accelerate protein diversification and selection processes. The method includes three basic steps: establishing a sequence diversity library of the target gene, screening from the protein library encoded by the mutant gene library, and amplifying the gene sequence encoding the desired trait. These three steps constitute a round of directed evolution, and multiple rounds of evolutionary screening can be iterated until a specific gene / protein with improved properties is obtained.

[0006] However, the current use of adeno-associated viruses as vectors for gene therapy of the hearing system still has disadvantages such as poor tissue specificity and low infection efficiency. For example, it is known that adeno-associated virus vectors infect supporting cells while infecting hair cells; and supporting cells and hair cells express different pathogenic genes respectively. This non-specificity of vector infection has an adverse effect on the treatment of the disease. Therefore, to achieve precision gene therapy, a new type of recombinant adeno-associated virus vector with high efficiency and specificity is needed. Summary of the invention

[0007] The purpose of the present invention is to overcome the defects of the prior art and propose to transform a new adeno-associated virus vector that can efficiently and specifically deliver genes in tissues such as the cochlea and the retina of the eye for gene therapy. The present invention infects the mouse cochlea with the modified new adeno-associated virus vector in vivo, which can mediate the expression of the target gene specifically in the cochlear supporting cells, thereby specifically marking or manipulating the supporting cells. The new adeno-associated virus has broad application value and market prospects in the structural and functional analysis of cochlear supporting cells, the establishment of disease models and gene therapy. At the same time, the virus was injected into the mouse eyeball through the vitreous body and it was found that the virus vector had better infection characteristics than the currently available vectors, and also had broad application value and market prospects in the structural and functional analysis of ophthalmic cells, the establishment of disease models and gene therapy.

[0008] One of the objects of the present invention is to provide a fusion adeno-associated virus AAV-WM01 capsid protein, wherein the capsid protein comprises a fusion peptide segment of peptide segments of serotypes AAV1, 2, 6 and 7 or a variant thereof.

[0009] Another object of the present invention is to provide a nucleic acid encoding the fusion adeno-associated virus AAV-WM01 capsid protein as described above.

[0010] Another object of the present invention is to provide a construct comprising the nucleic acid as described above.

[0011] Another object of the present invention is to provide a host cell, wherein the host cell comprises the construct as described above or the exogenous nucleic acid as described above is integrated into the genome, or the host cell comprises the fusion-type adeno-associated virus AAV-WM01 as described above.

[0012] Another object of the present invention is to provide a fusion-type adeno-associated virus AAV-WM01, the capsid structure of which contains the fusion-type adeno-associated virus AAV-WM01 capsid protein as described in any one of the above items.

[0013] Host cells transformed with the fusion-type adeno-associated virus as described above are used.

[0014] Another object of the present invention is to provide a fusion adeno-associated virus vector system, comprising a packaging plasmid, wherein the packaging plasmid comprises the nucleic acid or nucleic acid fragment as described above.

[0015] Another object of the present invention is to provide a fusion adeno-associated virus obtained by viral packaging of the fusion adeno-associated virus vector system as described above.

[0016] Another object of the present invention is to provide a pharmaceutical composition, comprising the fusion-type adeno-associated virus as described in any one of the above items and a pharmaceutically acceptable excipient.

[0017] Another object of the present invention is to provide the use of the above-mentioned fusion adeno-associated virus AAV-WM01 capsid protein, nucleic acid, construct, fusion adeno-associated virus, host cell, fusion adeno-associated virus vector system, pharmaceutical composition or conjugate in the preparation of drugs for treating diseases; preferably, use in the preparation of drugs for gene therapy diseases.

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects: (1) It provides a new supporting cell-specific adeno-associated virus vector AAV-WM01, which can mediate the expression of the target gene specifically in the supporting cells of the cochlea of ​​newborn mice; (2) It provides a new adeno-associated virus vector AAV-WM01, which can mediate the expression of the target gene specifically in the inner hair cells of the cochlea of ​​adult mice; (3) It provides a new adeno-associated virus vector AAV-WM01, which can mediate the expression of the target gene specifically in the RPE layer of the retina of adult mice; (4) The expression of the target gene mediated by the new adeno-associated virus vector AAV-WM01 is more flexible, safer, more convenient to use and less expensive than traditional transgenic methods; (5) The new specific adeno-associated virus vector AAV-WM01 makes it possible to develop gene therapies for the precise treatment of ear and eye-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 .In vivo screening process of DNA family shuffling libraries.

[0020] Figure 2 .Computer simulated structure diagram of AAV-WM01.

[0021] Figure 3 a. AAV-ie and AAV-WM01 were injected into the cochlea of ​​newborn mice. 14 days later, the cochlear tissue was removed and dissected for immunostaining of green fluorescent protein EGFP and hair cell-specific marker protein Myo7a. The picture was taken at the hair cell level.

[0022] Figure 3b. AAV-ie and AAV-WM01 were injected into the cochlea of ​​newborn mice. 14 days later, the cochlear tissue was removed and dissected for immunostaining of green fluorescent protein EGFP and hair cell-specific marker protein Myo7a. The picture was taken at the supporting cell level.

[0023] Figure 3 c. Shows the Figure 3 a, Data statistics of hair cells and Dieters cells in 3b.

[0024] Figure 4 a. Shows immunostaining photos of the hair cell-specific marker protein Myo7a after AAV-WM01 was injected into the cochlea of ​​newborn mice, the cochlear tissue was removed 14 days later, and the cochlea of ​​normal mice was dissected.

[0025] Figure 4 b. Shows the Figure 4 a Statistical results of outer hair cells and inner hair cells.

[0026] Figure 5 a. Shows the immunostaining photos of green fluorescent protein EGFP and hair cell-specific marker protein Myo7a after AAV-ie and AAV-WM01 were injected into the cochlea of ​​adult mice and the cochlear tissues were removed and dissected 14 days later.

[0027] Figure 5 b. Shows the Figure 5 a Statistical results of outer hair cells.

[0028] Figure 5 c. Shows the Figure 5 Data statistics of inner hair cells in a.

[0029] Figure 6 a. Shows immunostaining photos of the hair cell-specific marker protein Myo7a after AAV-WM01 was injected into the cochlea of ​​adult mice and the cochlear tissue was removed 14 days later, as well as the cochlear tissue of normal mice dissected.

[0030] Figure 6 b. Shows the Figure 6 a Statistical results of outer hair cells and inner hair cells.

[0031] Figure 7 .AAV-WM01-CMV-EGFP infection of the RPE layer of the eyeball. DETAILED DESCRIPTION

[0032] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0033] The present invention provides a fusion adeno-associated virus AAV-WM01 capsid protein, wherein the capsid protein comprises a peptide segment (fusion peptide segment or chimeric peptide segment) formed by fusion of peptide segments of serotypes AAV1, 2, 6 and 7 or a variant thereof.

[0034] In some preferred embodiments, in the fusion adeno-associated virus AAV-WM01 capsid protein, the fusion peptide segment comprises a first peptide segment, a second peptide segment, a third peptide segment, a fourth peptide segment and a fifth peptide segment connected in sequence; the first peptide segment comprises a peptide segment from AAV1, the second peptide segment comprises a peptide segment from AAV7, the third peptide segment comprises a peptide segment from AAV2, the fourth peptide segment comes from a peptide segment containing AAV1, and the fifth peptide segment comes from a peptide segment containing AAV6. Preferably, the first peptide segment comprises an amino acid fragment from position 1 to position 262 of SEQ ID No.2 (SEQ ID NO.3), the second peptide segment comprises an amino acid fragment from position 263 to position 325 of SEQ ID No.2 (SEQ ID NO.4), the third peptide segment comprises an amino acid fragment from position 326 to position 417 of SEQ ID No.2 (SEQ ID NO.5), the fourth peptide segment comprises an amino acid fragment from position 418 to position 583 of SEQ ID No.2 (SEQ ID NO.6), the fifth peptide segment comprises an amino acid fragment from position 584 to position 736 of SEQ ID No.2 (SEQ ID NO.7), and the fusion adeno-associated virus AAV-WM01 capsid protein comprises an S430I mutation.

[0035] SEQ ID No.3

[0036] Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser GluGly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro Lys Ala Asn GlnGln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro Gly Tyr Lys Tyr Leu Gly ProPhe Asn Gly Leu Asp Lys Gly Glu Pro Val Asn Ala Ala Asp Ala Ala Ala Leu GluHis Asp Lys Ala Tyr Asp Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg TyrAsn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly GlyAsn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Leu Gly LeuVal Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg Pro Val Glu Gln Ser ProGln Glu Pro Asp Ser Ser Ser Gly Ile Gly Lys Thr Gly Gln Gln Pro Ala Lys LysArg Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro LeuGly Glu Pro Pro Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Ser Gly GlyGly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser GlyAsn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr ArgThr Trp Ala Leu Pro Thr Tyr AsnAsn His Leu Tyr Lys Gln Ile Ser Ser

[0037] SEQ ID No.4

[0038] Glu Thr Ala Gly Ser Thr Asn Asp Asn Thr Tyr Phe Gly Tyr Ser Thr ProTrp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser Pro Arg Asp Trp GlnArg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro Lys Lys Leu Arg Phe Lys Leu PheAsn Ile Gln Val Lys Glu Val Thr

[0039] SEQ ID No.5

[0040] Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val GlnVal Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser Ala His Gln GlyCys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Val Pro Gln Tyr Gly Tyr Leu ThrLeu Asn Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr PhePro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe Glu

[0041] SEQ ID No.6

[0042] Glu Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ile Leu Asp Arg LeuMet Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg Thr Gln Asn Gln SerGly Ser Ala Gln Asn Lys Asp Leu Leu Phe Ser Arg Gly Ser Pro Ala Gly Met SerVal Gln Pro Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser LysThr Lys Thr Asp Asn Asn Asn Ser Asn Phe Thr Trp Thr Gly Ala Ser Lys Tyr AsnLeu Asn Gly Arg Glu Ser Ile Ile Asn Pro Gly Thr Ala Met Ala Ser His Lys AspAsp Glu Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly Lys Glu Ser AlaGly Ala Ser Asn Thr Ala Leu Asp Asn Val Met Ile Thr Asp Glu Glu Glu Ile LysAla Thr Asn Pro Val Ala Thr Glu Arg Phe Gly Thr Val Ala Val Asn

[0043] SEQ ID No.7

[0044] Leu Gln Ser Ser Ser Thr Asp Pro Ala Thr Gly Asp Val His Val Met GlyAla Leu Pro Gly Met Val Trp Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile TrpAla Lys Ile Pro His Thr Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly PheGly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Pro Val Pro Ala AsnPro Pro Ala Glu Phe Ser Ala Thr Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser ThrGly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg TrpAsn Pro Glu Val Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Ala Asn Val Asp Phe ThrVal Asp Asn Asn Gly Leu Tyr Thr Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu ThrArg Pro Leu*

[0045] In the fusion-type adeno-associated virus AAV-WM01 capsid protein of the present invention, the peptide segments are directly fused to each other.

[0046] In the fusion adeno-associated virus capsid protein of the present invention, the peptide segments of the serotypes AAV1 and AAV6 are assembled into the protrusions of the three-fold symmetry axis of the capsid protein; the peptide segments of the serotypes AAV2, 6, and 7 are assembled into the channels of the five-fold symmetry axis of the capsid protein; the peptide segments of the serotype AAV6 form a depression at the two-fold symmetry axis of the capsid protein, and the computer simulated structural schematic diagram thereof is shown in FIG. Figure 2 shown.

[0047] Under an electron microscope, the nucleocapsid of adeno-associated virus is generally nearly circular. This nearly circular capsid is actually a closed icosahedral symmetrical hollow capsid composed of multiple protein capsomers, in which the genomic nucleic acid is wrapped. An icosahedral symmetric structure contains three types of rotational symmetry: 3-fold, 2-fold, and 5-fold symmetry (3-, 2-, 5-fold symmetry). That is, this symmetrical three-dimensional structure has a 3-fold symmetry axis passing through the center points of the two opposite faces of the virus particle, and the capsomers rotate 120° around the 3-fold symmetry axis three times to reset, forming a triangular face; there is a 2-fold symmetry axis (edge), and the capsomers rotate 180° around the 2-fold symmetry axis and reset twice, forming two intersecting triangular faces; there is also a 5-fold symmetry axis passing through two opposite vertices, and the capsomers rotate 72° around the 5-fold symmetry axis five times to reset, forming a pentamer. Therefore, the icosahedral symmetrical capsid is composed of 20 equilateral triangular faces, where every 2 triangular faces intersect to form edges, for a total of 30 edges; every 5 triangular faces are connected to form 12 vertices.

[0048] In some preferred embodiments, the capsid protein comprises:

[0049] a) the amino acid sequence shown in SEQ ID No.2;

[0050] b) a polypeptide fragment having a sequence identity of more than 90% with SEQ ID No. 2 and having the function of the amino acid sequence defined in a).

[0051] Specifically, the polypeptide fragment in b) specifically refers to: a polypeptide fragment obtained by replacing, deleting or adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5, 1-3, 1, 2, or 3) amino acids to the amino acid sequence as shown in SEQ ID No. 2, or adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5, 1-3, 1, 2, or 3) amino acids to the N-terminus and / or C-terminus, and having the function of the polypeptide fragment as shown in SEQ ID No. 2, and the amino acid sequence in b) may have a sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more with SEQ ID No. 2.

[0052] In some preferred embodiments, the nucleic acid sequence of the gene encoding the capsid protein is shown as SEQ ID No.1.

[0053] The present invention also provides a nucleic acid, which encodes the fusion adeno-associated virus AAV-WM01 capsid protein as described above.

[0054] The present invention also provides a construct, which contains the above-mentioned nucleic acid. The construct can usually be obtained by inserting the above-mentioned nucleic acid into a suitable expression vector, and those skilled in the art can select a suitable expression vector.

[0055] The present invention also provides a host cell, wherein the host cell comprises the above-mentioned construct or the above-mentioned nucleic acid is integrated into the genome, or the host cell comprises the fusion-type adeno-associated virus AAV-WM01 as described in any one of the above items.

[0056] As representative examples of suitable host cells, mammalian cells (such as CHO or COS), plant cells, human cells (human embryonic kidney cells such as HEK293FT), bacterial cells (such as Escherichia coli, Streptomyces, Salmonella typhimurium), fungal cells (such as yeast), insect cells (such as Sf9), etc. can be cited. Those skilled in the art can select a suitable host according to the teachings of this article. Preferably, the host cell is an animal cell, and more preferably a human cell. The host cell can be a cultured cell or a primary cell, that is, directly isolated from an organism (such as a human). The host cell can be an adherent cell or a suspended cell, that is, a cell grown in the form of a suspension.

[0057] The present invention also provides a fusion-type adeno-associated virus AAV-WM01, wherein the fusion-type adeno-associated virus contains the fusion-type adeno-associated virus AAV-WM01 capsid protein as described in any one of the above items.

[0058] Furthermore, the fusion adeno-associated virus AAV-WM01 also includes a heterologous nucleotide sequence encoding a target product, and the heterologous nucleotide sequence encoding the target product can be wrapped and carried by various capsid proteins. The above-mentioned heterologous nucleotide sequence encoding the target product can usually be a construct, and the construct can usually contain a nucleic acid encoding the target product. The construct can usually be obtained by inserting the nucleic acid encoding the target product into a suitable expression vector. Those skilled in the art can select a suitable expression vector. For example, the above-mentioned expression vector can include but is not limited to pAAV-CAG, pAAV-TRE, pAAV-EF1a, pAAV-GFAP promoter, pAAV-Lgr5promoter, pAAV-Sox2 promoter expression vectors, etc. In the present invention, when the fusion adeno-associated virus AAV-WM01 encodes a heterologous nucleotide sequence of a target product, the fusion adeno-associated virus AAV-WM01 contains a capsid, and the viral vector carries a transgene encoding a gene product, and the transgene is regulated by a regulatory sequence that directs its expression in a host cell; in some preferred embodiments, the amino acid sequence of the capsid protein is as shown in SEQ ID NO:2.

[0059] Furthermore, the target product may be a nucleic acid or a protein, wherein the nucleic acid includes but is not limited to small guide RNA (sgRNA), interfering RNA (RNAi), etc., and the protein encoding gene includes but is not limited to Prestin and Atoh1.

[0060] The fusion adeno-associated virus AAV-WM01 can be used as a vector material to introduce exogenous genes into the cells of the subject. Compared with adeno-associated viruses such as AAV-ie, the fusion adeno-associated virus AAV-WM01 can specifically infect supporting cells of young individuals and specifically infect inner hair cells of adult individuals.

[0061] The present invention also provides an engineered host cell transformed with the fusion-type adeno-associated virus as described above. The engineered host cell comprises the fusion-type adeno-associated virus as described above. The host cell may be a eukaryotic cell and / or a prokaryotic cell.

[0062] As representative examples of suitable host cells, mammalian cells (such as CHO or COS), plant cells, human cells (human embryonic kidney cells such as HEK293FT), bacterial cells (such as Escherichia coli, Streptomyces, Salmonella typhimurium), fungal cells (such as yeast), insect cells (such as Sf9), etc. can be cited. Those skilled in the art can select a suitable host according to the teachings of this article. Preferably, the host cell is an animal cell, and more preferably a human cell. The host cell can be a cultured cell or a primary cell, that is, directly isolated from an organism (such as a human). The host cell can be an adherent cell or a suspended cell, that is, a cell grown in the form of a suspension.

[0063] The present invention also provides a fusion-type adeno-associated virus vector system, wherein the vector system comprises a packaging plasmid, and the packaging plasmid comprises the nucleic acid or nucleic acid fragment as described above.

[0064] Furthermore, the packaging plasmid also contains a rep gene fragment of an adeno-associated virus, wherein the rep gene fragment contains an intron, and the intron contains a transcription termination sequence.

[0065] Furthermore, the adeno-associated virus vector system further comprises an expression plasmid, wherein the expression plasmid comprises a heterologous nucleotide responsible for encoding a target product. Furthermore, the target product may be a nucleic acid or a protein, wherein the nucleic acid includes but is not limited to a small guide RNA (sgRNA), an interfering RNA (RNAi), etc., and the protein encoding gene includes but is not limited to Prestin and Atoh1.

[0066] Furthermore, the adeno-associated virus vector system also includes a helper virus plasmid or a helper virus.

[0067] Furthermore, the adeno-associated virus vector system also includes a host cell.

[0068] The present invention transfers the packaging plasmid, expression plasmid, and helper virus plasmid into a host cell, and all the nucleic acid sequences therein are integrated into the host cell to produce the fusion-type adeno-associated virus. In some embodiments, all of the nucleic acid sequences are integrated together at a single locus in the host cell genome. In some embodiments, the nucleic acid sequences encoding various genes are present as separate expression cassettes, which prevent any risk of recombination to form a virus capable of replication; the nucleic acid sequences encoding the rep and cap genes are present in the same expression cassette.

[0069] The present invention also provides a fusion adeno-associated virus, which is obtained by virus packaging of the fusion adeno-associated virus vector system as described above.

[0070] The present invention also provides a pharmaceutical composition, which comprises the fusion adeno-associated virus as described above and a pharmaceutically acceptable excipient. The fusion adeno-associated virus or pharmaceutical composition provided by the present invention can be adapted to a suitable administration method, which can be injected into the cochlea, eyes, muscles, nervous system or blood circulation system. Those skilled in the art can select a suitable dose according to the administration method.

[0071] The adjuvants may include various excipients and diluents, which are not necessary active ingredients themselves and have no excessive toxicity after administration. Suitable adjuvants should be well known to those skilled in the art. The acceptable carriers include, for example, sterile water or physiological saline, stabilizers, excipients, antioxidants (such as ascorbic acid), buffers (phosphoric acid, citric acid, other organic acids, etc.), preservatives, surfactants (PEG, Tween, etc.), chelating agents (EDTA, etc.), adhesives, etc. Moreover, other low molecular weight polypeptides may also be contained; proteins such as serum albumin, gelatin or immunoglobulins; amino acids such as glycine, glutamine, asparagine, arginine and lysine; sugars or carbohydrates such as polysaccharides and monosaccharides; sugar alcohols such as mannitol or sorbitol. When preparing aqueous solutions for injection, such as physiological saline, isotonic solutions containing glucose or other auxiliary drugs, such as D-sorbitol, D-mannose, D-mannitol, sodium chloride, appropriate solubilizers such as alcohols (ethanol, etc.), polyols (propylene glycol, PEG, etc.), non-ionic surfactants (Tween 80, HCO-50), etc. can be used in combination.

[0072] In the pharmaceutical composition provided by the present invention, the fusion adeno-associated virus AAV-WM01 can be a single active ingredient, or can be combined with one or more other active components useful for the treatment of hearing loss or ophthalmic diseases to form a combined preparation. The other active components can be other various drugs that can be used to treat hearing loss or ophthalmic diseases. The content of the active ingredient in the composition is generally a safe and effective amount, which should be adjustable by those skilled in the art. For example, the dosage of the fusion adeno-associated virus AAV-WM01 and the active ingredient of the pharmaceutical composition generally depends on the patient's weight, the type of application, the condition and severity of the disease. For example, the dosage of the bifunctional compound as an active ingredient generally can be 1-1000 mg / kg / day, 1-3 mg / kg / day, 3-5 mg / kg / day, 5-10 mg / kg / day, 10-20 mg / kg / day, 20-30 mg / kg / day, 30-40 mg / kg / day, 40-60 mg / kg / day, 60-80 mg / kg / day, 80-100 mg / kg / day, 100-200 mg / kg / day, 200-500 mg / kg / day, or greater than 500 mg / kg / day.

[0073] The present invention also provides a conjugate, which includes the fusion adeno-associated virus AAV-WM01 as described above or a connected biologically active polypeptide.

[0074] The present invention also provides the use of the above-mentioned fusion adeno-associated virus AAV-WM01 capsid protein, nucleic acid, construct, fusion adeno-associated virus AAV-WM01, host cell, fusion adeno-associated virus vector system, pharmaceutical composition or conjugate in the preparation of drugs for preventing and / or treating diseases; preferably, use in the preparation of drugs for preventing and / or gene therapy of diseases; the diseases include but are not limited to one or more of hearing impairment diseases, ophthalmic diseases, inflammation, tumors, metabolic diseases, pain, neurodegenerative inflammatory diseases, etc.

[0075] The hearing impairment disease is selected from hearing loss, deafness, and tinnitus.

[0076] The ophthalmic diseases include, but are not limited to, dry AMD, wet AMD, or choroidal neovascularization (CNV); for example, they may be selected from age-related macular degeneration (AMD), choroidal neovascularization (CNV), choroidal neovascular membrane (CNVM), cystoid macular edema (CME), epiretinal membrane (ERM), and macular hole; myopia-related choroidal neovascularization, angioid streaks, retinal detachment, diabetic retinopathy, diabetic macular edema (DME), atrophic lesions of retinal pigment epithelium (RPE), Hypertrophic lesions of retinal pigment epithelial cells (RPE), retinal vein occlusion, chorioretinal vein occlusion, macular edema; corneal angiogenesis due to hypoxia, pterygium conjunctiva, subretinal edema and intraretinal edema; macular edema due to retinal vein occlusion, retinitis pigmentosa, Stargardt's disease, glaucoma, inflammatory diseases, cataract, refractory abnormal phenomena, keratoconus, retinopathy of prematurity, angiogenesis of the anterior part of the eye, corneal angiogenesis after keratitis, one or more in corneal transplantation or corneal shaping. In some preferred embodiments, the ophthalmic disease refers to RPE layer related diseases, that is, by infecting the RPE layer with a virus, gene therapy of ophthalmic diseases can be achieved.

[0077] The inflammation is selected from skin inflammation, vascular inflammation, allergy, autoimmune disease, fibrosis, scleroderma or transplant rejection; the autoimmune disease is selected from one or more of rheumatoid arthritis, systemic sclerosis, systemic lupus erythematosus, Sjögren's syndrome, polymyositis, etc.

[0078] The cancer is selected from lymphoma, hematological tumor or solid tumor; specifically selected from adrenal cortical carcinoma, bladder urothelial carcinoma, breast cancer, cervical squamous cell carcinoma, endocervical adenocarcinoma, bile duct carcinoma, colon adenocarcinoma, lymphoid tumors, diffuse large B-cell lymphoma, esophageal cancer, glioblastoma multiforme, head and neck squamous cell carcinoma, renal chromophobe cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, acute myeloid leukemia, brain low-grade glioma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, mesothelial cell carcinoma, ovariectomy, One or more of ovarian cancer, pancreatic cancer, pheochromocytoma and paraganglioma, prostate cancer, rectal cancer, malignant sarcoma, melanoma, gastric cancer, testicular germ cell tumor, thyroid cancer, thymic cancer, endometrial cancer, uterine sarcoma, uveal melanoma, multiple myeloma, acute lymphoid leukemia, chronic lymphoid leukemia, chronic myeloid leukemia, T-cell lymphoma, B-cell lymphoma tumor cells; preferably, the tumor is one or more of colorectal cancer and / or melanocytoma, etc.

[0079] The metabolic disease is selected from diabetes, including type I and type II diabetes and diseases and conditions related to diabetes; the metabolic disease includes but is not limited to one or more of atherosclerosis, cardiovascular disease, nephropathy, neuropathy, retinopathy, β-cell dysfunction, dyslipidemia, hyperglycemia, insulin resistance, chronic obstructive pulmonary disease, etc.

[0080] In some more preferred embodiments, the gene therapy refers to the treatment of hearing impairment diseases. The fusion adeno-associated virus or pharmaceutical composition can achieve the treatment of hearing impairment diseases by delivering the target product to the hair cells and / or supporting cells of an individual.

[0081] In the use of the fusion adeno-associated virus AAV-WM01, host cell, vector system, pharmaceutical composition or conjugate of the present invention for delivering a target product to hair cells and / or supporting cells of an individual, the target product delivery may be for non-diagnostic and therapeutic purposes, for example, it may be in vitro, and the target product is delivered to isolated hair cells and / or supporting cells. The hair cells generally include outer hair cells and / or inner hair cells; preferably, the hair cells are inner hair cells of an adult individual.

[0082] Furthermore, the target product is a nucleic acid or a protein, and the nucleic acid can be a small guide RNA (sgRNA), interfering RNA (RNAi), etc.

[0083] In the present invention, the hearing impairment disease may be caused by cochlear damage caused by environmental factors. Therefore, the present invention also provides the use of the above-mentioned fusion adeno-associated virus in a drug for treating hearing impairment diseases caused by environmental factors in an individual.

[0084] Further, the hearing impairment disease is a hair cell and / or supporting cell related disease. In some preferred embodiments, for young individuals, the hearing impairment disease is preferably a supporting cell related disease. In some preferred embodiments, for adult individuals, the hearing impairment disease is preferably an inner hair cell related disease. In some preferred embodiments, the hearing impairment disease is prevented or treated by inducing inner hair cell regeneration. In another preferred embodiment, the hearing impairment disease is prevented or treated by overexpressing Wnt2b and Atoh1 to induce inner hair cell regeneration.

[0085] Furthermore, the hearing impairment disease is a disease related to gene defects, environmental damage or aging. For example, it may be a disease related to gene mutation, etc., or it may be a disease related to noise or drugs, or it may be a disease related to aging.

[0086] Furthermore, hearing impairment diseases may be diseases related to cell damage, etc., specifically, cochlear hair cell damage, supporting cell damage, etc., more specifically, cochlear hair cell damage caused by gene mutation, supporting cell damage caused by gene mutation, etc., cell damage caused by noise, cell damage caused by drugs, or cell damage caused by aging.

[0087] Furthermore, the fusion adeno-associated virus is used as a vector for delivering the target product.

[0088] The present invention also provides a method for treating hearing impairment, comprising administering an effective amount of the fusion adeno-associated virus of the present invention, the host cell of the present invention, the vector system or the pharmaceutical composition or conjugate to a subject in need thereof. Generally, a physician can determine the actual dosage that is most suitable for a single patient and it will vary according to the age, weight and response of a specific individual.

[0089] In the present invention, the fusion adeno-associated virus or host cell or vector system or pharmaceutical composition of the present invention can be administered to a patient. A person skilled in the art can determine the appropriate administration method and dosage.

[0090] The delivery of one or more therapeutic genes by the fusion adeno-associated virus of the present invention can be used alone or in combination with other treatment methods or therapeutic components.

[0091] The fusion adeno-associated virus of the present invention is used to infect cells, thereby delivering genes and / or linked (e.g., but not limited to, covalently linked) biologically active polypeptides to cells. Therefore, the present invention provides a method for delivering a transgene to a cell, the method infecting a cell by introducing one or more fusion adeno-associated viruses or conjugates of the present invention to the cell, wherein the fusion adeno-associated virus or conjugate comprises one or more transgenes.

[0092] The present invention also provides a method for producing a stable fusion adeno-associated virus vector production cell line, comprising:

[0093] (a) introducing a fusion adeno-associated virus vector as defined herein into a culture of mammalian host cells; and

[0094] (b) selecting within the culture mammalian host cells that have the nucleic acid sequence encoded on the vector integrated into an endogenous chromosome of the mammalian host cell.

[0095] The AAV vector production cell is a mammalian cell. In some embodiments, the mammalian cell is selected from HEK293 cells, CHO cells, Jurkat cells, K562 cells, PerC6 cells, HeLa cells or derivatives thereof. In some embodiments, the mammalian host cell is a HEK293 cell, or is derived from a HEK293 cell. In some embodiments, the HEK293 cell is a HEK293T cell.

[0096] The genomic sequences of various serotypes of AAV, as well as the sequences of native ITRs, Rep proteins, and capsid proteins are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. The disclosures thereof are incorporated herein by reference for AAV nucleic acid and amino acid sequences.

[0097] In the compounds of the present invention and their use, when the fusion adeno-associated virus is used in combination with other therapeutic agents, the active compound is co-administered with the other therapeutic agents. "Co-administered" means that they are administered simultaneously in the same preparation or in two different preparations via the same or different routes, or sequentially via the same or different routes. "Sequential" administration means that there is a time difference of seconds, minutes, hours or days between the administration of two or more different compounds.

[0098] In certain embodiments, the fusion adeno-associated viruses and methods of the present invention can be used to prevent hearing loss and can be administered as a preventive treatment method before hearing loss or after a period of time after exposure to an environment that is susceptible to hearing loss.

[0099] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one skilled in the art.

[0100] The term "vector" refers to a macromolecule or combination of macromolecules that contains or is associated with a polypeptide and can be used to mediate the delivery of the polypeptide to a cell. Illustrative vectors include, for example, plasmids, viral vectors, liposomes or other gene delivery vectors.

[0101] The term "AAV" is an abbreviation for adeno-associated virus and may be used to refer to the virus itself or its derivatives.

[0102] The term "recombinant AAV vector" refers to an AAV vector containing a heterologous polynucleotide sequence, usually a sequence of interest for genetic transformation of cells. Generally, the heterologous polynucleotide is flanked by at least one, usually two, AAV inverted terminal repeats (ITRs).

[0103] The term "AAV virus" or "AAV viral particle" or "AAV vector particle" refers to a viral particle of an AAV vector comprising at least one AAV capsid protein and an encapsidated polynucleotide.

[0104] The term "packaging" refers to the series of intracellular processes that lead to the assembly and encapsulation of AAV particles.

[0105] The terms AAV "rep" and "cap" genes refer to polynucleotide sequences encoding replication and packaging proteins of adeno-associated virus. AAV rep and cap are referred to herein as AAV "packaging genes".

[0106] The term "helper virus" of AAV refers to a virus that enables AAV to be replicated and packaged by mammalian cells. Various such AAV helper viruses are known in the art, including adenovirus, herpes virus, and pox virus (eg, vaccinia).

[0107] The term "infectious" virus or viral particle is one that contains a polynucleotide component capable of delivering the virus to cells tropistic for that virus species. The term does not necessarily imply that the virus has any ability to replicate.

[0108] The term "producer cell" refers to a cell line that has the AAV packaging genes (rep and cap genes), required helper viral genes, and the DNA genome of the recombinant AAV vector (e.g., the transgene of interest flanked by two AAV inverted terminal repeats (ITRs)) stably integrated into the host cell genome.

[0109] The terms "include", "including", etc. should be understood as having an inclusive meaning rather than an exclusive or exhaustive meaning; that is, the meaning is "including but not limited to".

[0110] The term "subject" generally includes humans, non-human primates, such as mammals, dogs, cats, horses, sheep, pigs, cows, etc., who can benefit from treatment using the formulation, kit or combination formulation.

[0111] The term "therapeutically effective amount" generally refers to an amount that can achieve the effect of treating the diseases listed above after an appropriate administration period.

[0112] The terms "therapeutic" and "prophylactic" are to be understood in their broadest sense. The term "therapeutic" does not necessarily imply that the mammal is treated until full recovery. Similarly, "prophylactic" does not necessarily mean that the subject will not eventually contract a disease condition. Thus, treatment and prevention include alleviating the symptoms of a particular condition or preventing or reducing the risk of a particular condition developing. The term "prevention" may be understood as reducing the severity of an attack of a particular condition. Treatment may also reduce the severity of an existing condition or the frequency of acute attacks.

[0113] In the present invention, the subject or individual for therapeutic or preventive treatment is preferably a mammal, such as, but not limited to, a human, a primate, livestock (such as sheep, cattle, horses, donkeys, pigs), a pet (such as dogs, cats), a laboratory test animal (such as mice, rabbits, rats, guinea pigs, hamsters), or a captured wild animal (such as foxes, deer). The subject is preferably a primate. The subject is most preferably a human.

[0114] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0115] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0116] Unless otherwise specified, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related conventional techniques in the art. These techniques have been fully described in existing literature.

[0117] Example 1. Acquisition of a novel adeno-associated virus AAV-WM01

[0118] a. Construction of DNA family shuffling library

[0119] The capsid sequences of 13 AAV serotypes (AAV1-13) found in humans and non-human primates were used as parents for DNA family shuffling. The parental capsid sequences were mixed in an equimolar ratio for a total of 4ug for DNA family shuffling, and treated with 0.04U of DNase I at 25℃ for 30s to randomly interrupt the complete parental capsid sequence into fragments of different lengths. The DNA fragments of 100-500bp in size were recovered and purified, and 500ng was used for primer-free PCR to extend them into complete chimeric capsid sequences. After amplifying enough chimeric capsid sequences, the chimeric capsid sequences were recombined into the library vector containing the AAV2Rep gene and terminal repeat sequences. The recombinant products were transformed into competent cells by electroporation, and part of the bacterial solution was plated. The colonies grown on the plate were counted and identified by sequencing to determine their diversity. The remaining bacterial solution was inoculated into 500mL of culture medium and cultured overnight at 37℃. The plasmid extracted the next day was the DNA family shuffling library plasmid. In vivo screening process of DNA family shuffling library Figure 1 shown.

[0120] b. Packaging of DNA family shuffled library viruses

[0121] The obtained DNA family shuffling library plasmid and adenovirus helper plasmid pHelper were co-transfected into HEK-293T cells in appropriate amounts, and the pHelper plasmid (the complete plasmid sequence is the same as that shown in SEQ ID NO.12 of AAV-ie patent document CN110437317A) was used to transfect each 15 cm dish of cells with only 20 ng of DNA family shuffling library plasmid.

[0122] The culture medium was collected 72 hours after transfection, and the cells and culture medium were collected 48 hours later. The cells were lysed with 110 mM citrate buffer (pH 4.2) to release AAV. After centrifugation, the supernatant containing the virus was neutralized with 1 / 5 volume of 2M HEPES, and then polyethylene glycol 8000 and 500 mM sodium chloride were added at a final concentration of 8%, and the virus was precipitated at 4°C overnight. After centrifugation, the precipitate was resuspended in 2 mM Mg 2+ PBS, and benzonase was added at a final concentration of 100 U / mL to digest the nucleic acid at 37°C for at least 1 hour. The virus suspension was purified by ultracentrifugation using iodixanol density gradient solutions (15%, 25%, 40% and 60%), and then the virus titer was determined by qPCR using AAV2 Rep gene-specific primers (WPRE-F: GTCAGGCAACGTGGCGTGGTGTG (SEQ ID NO. 8); WPRE-R: GGCGATGAGTTCCGCCGTGGC (SEQ ID NO. 9)).

[0123] c. In vivo screening

[0124] By in vivo injection into the mouse cochlea, novel adeno-associated viruses that can efficiently infect cochlear cells were screened.

[0125] About 1E+10~11vg library virus is injected into the cochlea of ​​mice born 2-3 days old through the round window. 7-10 days after the injection, the mice are euthanized and the cochlea is collected. At this time, the AAV in the library virus that can infect cochlear cells enters the cells, and the AAV that fails to infect cells is cleared by the immune system and circulatory system. Therefore, the present invention can recover the capsid gene of AAV that infects cells from the total DNA of tissue cells. The total tissue DNA is extracted with Trizol, and the capsid gene of AAV is recovered from the total DNA by PCR method to complete an in vivo screening of the AAV library. The fragment obtained by PCR is cloned into the library vector to obtain the next round of library plasmid, which is packaged into virus again. The in vivo screening process can be repeated. After 3-5 rounds of screening, the capsid gene of the recovered AAV is sequenced for the third generation. In this way, some information on the capsid genes of AAV mutants enriched in cochlear cells is obtained, among which some mutant AAVs with high abundance can theoretically efficiently transduce cochlear cells. Among them, the AAV-WM01 obtained as shown in SEQ ID NO.1 is one of the high-abundance mutants.

[0126] Sequencing results showed that AAV-WM01 is a chimera of AAV1, 2, 6, and 7 and contains an S430I mutation. By aligning the amino acid sequence with its parental serotype, the residues in its VP3 region were used to generate a 3D homology model of the AAV-WM01 capsid. Both the inner surface (B) and the outer surface (C) of the capsid showed the presence of fragments from the four parental AAV capsids, and indicated that the three-fold symmetry axis protrusion of AAV-WM01 is composed of AAV1 and AAV6, AAV2, 6, and 7 assemble into a five-fold symmetry axis channel, and AAV6 forms a depression at the two-fold symmetry axis ( Figure 2 ). The sequence of the coding gene of AAV-WM01 is shown in SEQ ID No.1, and the amino acid sequence is shown in SEQ ID No.2. The computer simulated structure of AAV-WM01 is shown in Figure 2 shown.

[0127] SEQ ID No.1

[0128]

[0129] SEQ ID No.2

[0130] Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser GluGly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro Lys Ala Asn GlnGln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro Gly Tyr Lys Tyr Leu Gly ProPhe Asn Gly Leu Asp Lys Gly Glu Pro Val Asn Ala Ala Asp Ala Ala Ala Leu GluHis Asp Lys Ala Tyr Asp Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg TyrAsn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly GlyAsn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Leu Gly LeuVal Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg Pro Val Glu Gln Ser ProGln Glu Pro Asp Ser Ser Ser Gly Ile Gly Lys Thr Gly Gln Gln Pro Ala Lys LysArg Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro LeuGly Glu Pro Pro Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Ser Gly GlyGly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser GlyAsn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr ArgThr Trp Ala Leu Pro Thr Tyr AsnAsn His Leu Tyr Lys Gln Ile Ser Ser Glu ThrAla Gly Ser Thr Asn Asp Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr PheAsp Phe Asn Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile AsnAsn Asn Trp Gly Phe Arg Pro Lys Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln ValLys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu Thr Ser ThrVal Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser Ala HisGln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Val Pro Gln Tyr Gly TyrLeu Thr Leu Asn Asn Gly Ser Gln AlaVal Gly Arg Ser Ser Phe Tyr Cys Leu GluTyr Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr PheGlu Glu Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ile Leu Asp Arg Leu MetAsn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg Thr Gln Asn Gln Ser GlySer Ala Gln Asn Lys Asp Leu Leu Phe Ser Arg Gly Ser Pro Ala Gly Met Ser ValGln Pro Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Lys ThrLys Thr Asp Asn Asn Asn Ser Asn Phe Thr Trp Thr Gly AlaSer Lys Tyr Asn LeuAsn Gly Arg Glu Ser Ile Ile Asn Pro Gly Thr Ala Met Ala Ser His Lys Asp AspGlu Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly Lys Glu Ser Ala GlyAla Ser Asn Thr Ala Leu Asp Asn Val Met Ile Thr Asp Glu Glu Glu Ile Lys AlaThr Asn Pro Val Ala Thr Glu Arg Phe Gly Thr Val Ala Val Asn Leu Gln Ser SerSer Thr Asp Pro Ala Thr Gly Asp Val His Val Met Gly Ala Leu Pro Gly Met ValTrp Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His ThrAsp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro ProPro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Ala Glu Phe SerAla Thr Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val GluIle Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Val Gln TyrThr Ser Asn Tyr Ala Lys Ser Ala Asn Val Asp Phe Thr Val Asp Asn Asn Gly LeuTyr Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Pro Leu*

[0131] Example 2 In vivo verification of the novel adeno-associated virus AAV-WM01-CMV-EGFP in the hearing system

[0132] 2.1 Construction of adeno-associated virus AAV-WM01-CMV-EGFP

[0133] The sequence of the coding gene of AAV-WM01 obtained in the above sequencing results was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. to obtain the Rep-Cap plasmid of AAV-WM01, namely pAAV-WM01. The obtained Rep-Cap plasmid pAAV-WM01 of AAV-WM01, the genomic plasmid pAAV-CMV-EGFP expressing a green fluorescent protein EGFP, and the pHelper plasmid were co-transfected into HEK-293T cells in appropriate amounts, and the AAV virus was purified by iodide dialkyl gradient ultracentrifugation. The virus titer was measured to be 1E+12-1E+13GC / mL as the appropriate concentration, and placed at -80°C for use.

[0134] 2.2 Infectious characteristics of adeno-associated virus AAV-WM01-CMV-EGFP in newborn mice

[0135] The same titer of AAV-ie and AAV-WM01-CMV-EGFP was injected into the cochlea of ​​C57BL / 6J mice 2-3 days after birth through the round window. After the virus was fully infected and expressed EGFP after 10-14 days, the mice were killed by cervical dislocation, and the cochlea of ​​the injected ear was removed and placed in 4% paraformaldehyde and fixed at room temperature for 2 hours. Wash three times with PBS, 5 minutes each time. Then decalcify with 0.5mM EDTA and soak at room temperature for 2 hours to soften the cochlea. The basement membrane was dissected with an ophthalmic scalpel under a stereomicroscope. The hair cells were labeled with anti-Myo7a antibodies through immunofluorescence staining to make a cochlear sample. It was imaged by laser confocal scanning microscopy, and the virus-infected cells expressed green fluorescent protein in their cell nuclei. The excitation light wavelengths were 488nm and 647nm, respectively. The results of the in vivo detection are as follows. Figure 3 a, as shown in 3b. Figure 3 a is a cochlear spread at the hair cell level after injection of AAV-ie and AAV-WM01-CMV-EGFP viruses; Figure 3 b is a cochlear spread at the supporting cell level after injection of AAV-ie and AAV-WM01-CMV-EGFP viruses; purple shows a marker protein of hair cells, Myo7a, and green shows the fluorescent protein expressed by virus-infected cells. Figure 3c is the statistical data of AAV-ie and AAV-WM01-CMV-EGFP viruses on hair cells and Dieters Cells (a type of supporting cells). The results show that AAV-WM01-CMV-EGFP specifically infects supporting cells in the cochlea of ​​young mice, but has no infectivity for hair cells. Dieters Cells are considered to be the supporting cells with the greatest regenerative potential, so AAV-WM01 has great potential in gene therapy of supporting cells and hair cell regeneration.

[0136] 2.3 Safety of AAV-WM01-CMV-EGFP in neonatal mice

[0137] AAV-WM01-CMV-EGFP was injected into the cochlea of ​​C57BL / 6J mice 2-3 days after birth through the round window. After the virus was fully expressed for 10-14 days, the mice were killed by cervical dislocation, and the cochlea of ​​the injected ear was taken out. At the same time, the cochlea of ​​C57BL / 6J mice of the same age was taken as a control. The cochlea was placed in 4% paraformaldehyde and fixed at room temperature for 2 hours. Wash with PBS three times, 5 minutes each time. Then decalcify with 0.5mM EDTA and soak at room temperature for 2 hours to soften the cochlea. The basement membrane was dissected with an ophthalmic scalpel under a stereomicroscope. The hair cells were labeled with anti-Myo7a antibodies through immunofluorescence staining to make a cochlear sample. It was imaged by laser confocal scanning microscopy. The virus-infected cells expressed green fluorescent protein in their nuclei. The results of the in vivo detection are as follows Figure 4 a, 4b. The statistical results showed that the number and morphology of cochlear cells in mice injected with AAV-WM01 virus were consistent with those of normal mice, indicating that AAV-WM01 virus was not toxic to newborn mice.

[0138] 2.4 Infectious characteristics of adeno-associated virus AAV-WM01-CMV-EGFP in adult mice

[0139] AAV-ie and AAV-WM01-CMV-EGFP were injected into the cochlea of ​​30-day-old C57BL / 6J mice through the posterior semicircular canal. After the virus was fully infected and expressed EGFP for 10-14 days, the mice were killed by cervical dissection, and the cochlea of ​​the injected ear was removed and placed in 4% paraformaldehyde and fixed at room temperature for 2 hours. Wash three times with PBS, 5 minutes each time. Then decalcify with 0.5mM EDTA and soak overnight at room temperature to soften the cochlea. The basement membrane was dissected with an ophthalmic scalpel under a stereomicroscope. Anti-Myo7a antibodies were used to label hair cells through immunofluorescence staining to make cochlear samples. The virus-infected cells expressed green fluorescent protein in their nuclei. The excitation light wavelengths were 488nm and 647nm, respectively. The results of in vivo detection are as follows: Figure 5As shown in a. This figure is a cochlear slide injected with AAV-ie and AAV-WM01-CMV-EGFP viruses. Purple shows a marker protein of hair cells, Myo7a, and green shows the fluorescent protein expressed by virus-infected cells. The results show that AAV-WM01 specifically infects inner hair cells in the cochlea of ​​adult mice, but has no infection characteristics for outer hair cells. Statistical results show that the infection rate of AAV-WM01 on outer hair cells of adult mice is 0.33% ± 0.333, and the infection rate of AAV-ie on outer hair cells of adult mice is 56.33% ± 1.202. Figure 5 As shown in b; the infection rate of AAV-WM01 on the inner hair cells of adult mice is 98.67%±0.667, and the infection rate of AAV-ie on the inner hair cells of adult mice is 100%±0. Figure 5 c. AAV-WM01 has high efficiency and specificity in infecting inner hair cells in the cochlea of ​​adult mice and can be used for gene therapy of inner hair cells.

[0140] 2.5 Safety of AAV-WM01-CMV-EGFP in adult mice

[0141] AAV-WM01-CMV-EGFP was injected into the cochlea of ​​30-day-old C57BL / 6J mice through the round window. After the virus was fully expressed for 10-14 days, the mice were killed by cervical dislocation, and the cochlea of ​​the injected ear was taken out. At the same time, the cochlea of ​​C57BL / 6J mice of the same age was taken as a control. The cochlea was placed in 4% paraformaldehyde and fixed at room temperature for 2 hours. Wash with PBS three times, 5 minutes each time. Then decalcify with 0.5mM EDTA and soak at room temperature for 2 hours to soften the cochlea. The basement membrane was dissected with an ophthalmic scalpel under a stereomicroscope. The hair cells were labeled with anti-Myo7a antibodies through immunofluorescence staining to make a cochlear sample. It was imaged by laser confocal scanning microscopy. The virus-infected cells expressed green fluorescent protein in their nuclei. The results of the in vivo detection are as follows Figure 6 a, 6b. The statistical results showed that the number and morphology of cochlear cells in mice injected with AAV-WM01 virus were consistent with those of normal mice, indicating that AAV-WM01 virus was not toxic to adult mice.

[0142] Example 3 In vivo verification of adeno-associated virus AAV-WM01-CMV-EGFP in the visual system

[0143] Place an anesthetized adult mouse under a microscope, and drop 1-2 drops of tropicamide eye drops on the eyeball to dilate the pupil. Hold the elbow tweezers in the left hand to lift and fix the eyeball from the optic disc, and hold a 1ml syringe or glass needle in the right hand to puncture the cornea to reduce intraocular pressure. Wipe away the periocular fluid with a paper towel. Hold the eyeball with tweezers in the left hand, and hold a glass needle that absorbs 2μl of virus in the right hand. Insert the needle at 50° between the posterior edge of the corneosclera and the iris plane, and slowly inject the adeno-associated virus AAV-WM01-CMV-EGFP constructed in 2.1 of Example 2, with a titer of 1.5E13 gc / ml. After the injection, the glass needle stayed for 30s and then slowly pulled out. After applying erythromycin ointment on the wound, the mouse was placed in a mouse cage in a 41°C water bath for insulation, and the mouse was moved to the mouse room for breeding after waking up. After 10 days, the eye cup was taken. The mouse was killed by spinal dislocation, and the cornea was punctured with a 1ml syringe after removing the eyeball to release the aqueous humor. The eyeball was placed in a small culture dish filled with PBS solution and dissected under a microscope. The cornea was clamped with pointed forceps, and ophthalmic scissors were inserted into the wound of the cornea to cut the cornea circumferentially. The lens was removed with forceps, and the optic nerve was retained about 2 mm. The eye cup was fixed in 4% PFA for 12 hours at 4°C. The fixed eye cup was dehydrated in 30% sucrose for 12 hours at 4°C. After frozen sectioning, sections with better results and intact tissue were selected for staining under a fluorescence microscope. Immunofluorescence results showed that AAV-WM01 can infect the RPE layer. The results of in vivo detection are as follows. Figure 7 This figure shows a retinal section injected with AAV-WM01-CMV-EGFP virus. Green shows the fluorescent protein expressed by virus infection, and blue shows the cell nucleus. The results show that AAV-WM01-CMV-EGFP has a high infection rate on the retinal RPE layer and can be used for ophthalmic gene therapy.

[0144] In summary, the fusion adeno-associated virus AAV-WM01 of the present invention and its application in the prevention and / or treatment of ear diseases or eye diseases effectively overcomes various shortcomings of the prior art and has high industrial utilization value.

[0145] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limitations of the present invention. In addition, the various modifications listed herein and the variations of methods and compositions in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications obvious to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention. Sequence Listing <110> Shanghai Weimei Gene Technology Co., Ltd. <120> A fusion type adeno-associated virus and its application <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2211 <212> DNA <213> Artificial Sequence <400> 1 atggctgccg atggttatct tccagattgg ctcgaggaca acctctctga gggcattcgc 60 gagtggtggg acttgaaacc tggagccccg aagcccaaag ccaaccagca aaagcaggac 120 gacggccggg gtctggtgct tcctggctac aagtacctcg gacccttcaa cggactcgac 180 aagggggagc ccgtcaacgc ggcggacgca gcggccctcg agcacgacaa ggcctacgac 240 cagcagctca aagcgggtga caatccgtac ctgcggtata accacgccga cgccgagttt 300 caggagcgtc tgcaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360 gccaagaagc gggttctcga acctctcggt ctggttgagg aaggcgctaa gacggctcct 420 ggaaagaaac gtccggtaga gcagtcgcca caagagccag actcctcctc gggcatcggc 480 aagacaggcc agcagcccgc taaaaagaga ctcaattttg gtcagactgg cgactcagag 540 tcagtccccg atccacaacc tctcggagaa cctccagcaa cccccgctgc tgtgggacct 600 actacaatgg cttcaggcgg tggcgcacca atggcagaca ataacgaagg cgccgacgga 660 gtgggtaatg cctcaggaaa ttggcattgc gattccacat ggctgggcga cagagtcatc 720 accaccagca cccgcacctg ggccctgccc acctacaaca atcacctcta caagcaaatc 780 tccagtgaaa ctgcaggtag taccaacgac aacacctact tcggctacag caccccctgg 840 gggtattttg actttaacag attccactgc cacttctcac cacgtgactg gcagcgactc 900 atcaacaaca actggggatt ccggcccaag aagctgcggt tcaagctctt caacatccag 960 gtcaaggagg tcacgcagaa tgacggtacg acgacgattg ccaataacct taccagcacg 1020 gttcaggtgt ttactgactc ggagtaccag ctcccgtacg tcctcggctc ggcgcatcaa 1080 ggatgcctcc cgccgttccc agcagacgtc ttcatggtgc cacagtatgg atacctcacc 1140 ctgaacaacg ggagtcaggc agtaggacgc tcttcatttt actgcctgga atatttccca 1200 tcgcagatgc tgagaacggg caataacttt accttcagct acacctttga ggaagtgcct 1260 ttccacagca gctacgcgca cagccagatc ctggaccggc tgatgaatcc tctcatcgac 1320 caatacctgt attacctgaa cagaactcaa aatcagtccg gaagtgccca aaacaaggac 1380 ttgctgttta gccgtgggtc tccagctggc atgtctgttc agcccaaaaa ctggctacct 1440 ggaccctgtt atcggcagca gcgcgtttct aaaacaaaaa cagacaacaa caacagcaat 1500 tttacctgga ctggtgcttc aaaatataac ctcaatgggc gtgaatccat catcaaccct 1560 ggcactgcta tggcctcaca caaagacgac gaagacaagt tctttcccat gagcggtgtc 1620 atgatttttg gaaaagagag cgccggagct tcaaacactg cattggacaa tgtcatgatc 1680 acagacgaag aggaaatcaa agccactaac cccgtggcca ccgaaagatt tgggactgtg 1740 gcagtcaatc tccagagcag cagcacagac cctgcgaccg gagatgtgca tgttatggga 1800 gccttacctg gaatggtgtg gcaagacaga gacgtatacc tgcagggacc catttgggcc 1860 aagattcctc acaccgatgg acactttcat ccttctccac tgatgggagg ttttgggctc 1920 aaacacccgc ctcctcagat cctcatcaaa aacacgcctg ttcctgcgaa tcctccggcg 1980 gagttttcag ctacaaagtt tgcttcattc atcacccaat actccacagg acaagtgagt 2040 gtggaaattg aatgggagct gcagaaagaa aacagcaagc gctggaatcc cgaagtgcag 2100 tacacatcca attatgcaaa atctgccaac gttgatttta ctgtggacaa caatggactt 2160 tatactgagc ctcgccccat tggcacccgt taccttaccc gtcccctgta a 2211 <210> 2 <211> 736 <212> PRT <213> Artificial Sequence <400> 2 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly 145 150 155 160 Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180 185 190 Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Ser Gly Gly Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Ser Glu Thr Ala Gly Ser Thr Asn Asp Asn Thr 260 265 270 Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe 275 280 285 His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn 290 295 300 Trp Gly Phe Arg Pro Lys Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln 305 310 315 320 Val Lys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn 325 330 335 Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro 340 345 350 Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala 355 360 365 Asp Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly 370 375 380 Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro 385 390 395 400 Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe 405 410 415 Glu Glu Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ile Leu Asp 420 425 430 Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg 435 440 445 Thr Gln Asn Gln Ser Gly Ser Ala Gln Asn Lys Asp Leu Leu Phe Ser 450 455 460 Arg Gly Ser Pro Ala Gly Met Ser Val Gln Pro Lys Asn Trp Leu Pro 465 470 475 480 Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Lys Thr Lys Thr Asp Asn 485 490 495 Asn Asn Ser Asn Phe Thr Trp Thr Gly Ala Ser Lys Tyr Asn Leu Asn 500 505 510 Gly Arg Glu Ser Ile Ile Asn Pro Gly Thr Ala Met Ala Ser His Lys 515 520 525 Asp Asp Glu Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly 530 535 540 Lys Glu Ser Ala Gly Ala Ser Asn Thr Ala Leu Asp Asn Val Met Ile 545 550 555 560 Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu Arg 565 570 575 Phe Gly Thr Val Ala Val Asn Leu Gln Ser Ser Ser Thr Asp Pro Ala 580 585 590 Thr Gly Asp Val His Val Met Gly Ala Leu Pro Gly Met Val Trp Gln 595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615 620 Thr Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu 625 630 635 640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655 Asn Pro Pro Ala Glu Phe Ser Ala Thr Lys Phe Ala Ser Phe Ile Thr 660 665 670 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Val Gln Tyr Thr Ser Asn 690 695 700 Tyr Ala Lys Ser Ala Asn Val Asp Phe Thr Val Asp Asn Asn Gly Leu 705 710 715 720 Tyr Thr Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Pro Leu 725 730 735 <210> 3 <211> 262 <212> PRT <213> Artificial Sequence <400> 3 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly 145 150 155 160 Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180 185 190 Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Ser Gly Gly Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Ser 260 <210> 4 <211> 63 <212> PRT <213> Artificial Sequence <400> 4 Glu Thr Ala Gly Ser Thr Asn Asp Asn Thr Tyr Phe Gly Tyr Ser Thr 1 5 10 15 Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser Pro 20 25 30 Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro Lys 35 40 45 Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val Thr 50 55 60 <210> 5 <211> 92 <212> PRT <213> Artificial Sequence <400> 5 Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val 1 5 10 15 Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser 20 25 30 Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Val 35 40 45 Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ala Val Gly 50 55 60 Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg 65 70 75 80 Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe Glu 85 90 <210> 6 <211> 166 <212> PRT <213> Artificial Sequence <400> 6 Glu Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ile Leu Asp Arg 1 5 10 15 Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg Thr 20 25 30 Gln Asn Gln Ser Gly Ser Ala Gln Asn Lys Asp Leu Leu Phe Ser Arg 35 40 45 Gly Ser Pro Ala Gly Met Ser Val Gln Pro Lys Asn Trp Leu Pro Gly 50 55 60 Pro Cys Tyr Arg Gln Gln Arg Val Ser Lys Thr Lys Thr Asp Asn Asn 65 70 75 80 Asn Ser Asn Phe Thr Trp Thr Gly Ala Ser Lys Tyr Asn Leu Asn Gly 85 90 95 Arg Glu Ser Ile Ile Asn Pro Gly Thr Ala Met Ala Ser His Lys Asp 100 105 110 Asp Glu Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly Lys 115 120 125 Glu Ser Ala Gly Ala Ser Asn Thr Ala Leu Asp Asn Val Met Ile Thr 130 135 140 Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu Arg Phe 145 150 155 160 Gly Thr Val Ala Val Asn 165 <210> 7 <211> 153 <212> PRT <213> Artificial Sequence <400> 7 Leu Gln Ser Ser Ser Thr Asp Pro Ala Thr Gly Asp Val His Val Met 1 5 10 15 Gly Ala Leu Pro Gly Met Val Trp Gln Asp Arg Asp Val Tyr Leu Gln 20 25 30 Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly His Phe His Pro 35 40 45 Ser Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile 50 55 60 Leu Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Ala Glu Phe Ser 65 70 75 80 Ala Thr Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val 85 90 95 Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp 100 105 110 Asn Pro Glu Val Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Ala Asn Val 115 120 125 Asp Phe Thr Val Asp Asn Asn Gly Leu Tyr Thr Glu Pro Arg Pro Ile 130 135 140 Gly Thr Arg Tyr Leu Thr Arg Pro Leu 145 150 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <400> 8 gtcaggcaac gtggcgtggt gtg 23 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <400> 9 ggcgatgagt tccgccgtgg c 21

Claims

1. A fusion adeno-associated virus capsid protein, characterized in that: The capsid protein is the amino acid sequence shown in SEQ ID No.

2.

2. The fusion adeno-associated virus capsid protein according to claim 1, characterized in that: The capsid protein is composed of a first peptide segment, a second peptide segment, a third peptide segment, a fourth peptide segment and a fifth peptide segment connected in sequence; the first peptide segment is an amino acid fragment shown in SEQ ID No. 3, the second peptide segment is an amino acid fragment shown in SEQ ID No. 4, the third peptide segment is an amino acid fragment shown in SEQ ID No. 5, the fourth peptide segment is an amino acid fragment shown in SEQ ID No. 6, and the fifth peptide segment is an amino acid fragment shown in SEQ ID No. 7, wherein the first peptide segment is a peptide segment from serotype AAV1; wherein the second peptide segment is a peptide segment from serotype AAV7; wherein the third peptide segment is a peptide segment from serotype AAV2; wherein the fourth peptide segment is a peptide segment from serotype AAV1; and wherein the fifth peptide segment is a peptide segment from serotype AAV6.

3. The fusion adeno-associated virus capsid protein according to claim 2, characterized in that: 1) The peptide segments of the serotypes AAV1 and AAV6 are assembled into the three-fold symmetric axis protrusions of the capsid protein; 2) The peptide segments of serotypes AAV2, 6, and 7 are assembled into a channel of the five-fold symmetry axis of the capsid protein; and 3) The peptide segment of the serotype AAV6 forms a depression at the two-fold symmetry axis of the capsid protein.

4. A nucleic acid, characterized in that The nucleic acid encodes the fusion-type adeno-associated virus capsid protein according to any one of claims 1 to 3.

5. A construct comprising the nucleic acid according to claim 4.

6. A fusion adeno-associated virus, characterized in that: The capsid structure of the fusion-type adeno-associated virus contains the fusion-type adeno-associated virus capsid protein according to any one of claims 1 to 3.

7. The fusion adeno-associated virus according to claim 6, characterized in that The fusion adeno-associated virus also includes a heterologous nucleotide sequence encoding a target product.

8. The fusion adeno-associated virus according to claim 7, wherein the target product is a nucleic acid or a protein.

9. The fusion adeno-associated virus according to claim 8, wherein the nucleic acid is a small guide RNA or an interfering RNA.

10. A host cell, characterized in that The host cell comprises the fusion-type adeno-associated virus capsid protein according to any one of claims 1 to 3, the nucleic acid according to claim 4, the construct according to claim 5, or the fusion-type adeno-associated virus according to any one of claims 6 to 9.

11. A fusion adeno-associated virus vector system, characterized in that: The method comprises a packaging plasmid, wherein the packaging plasmid comprises the nucleic acid according to claim 4.

12. The fusion adeno-associated virus vector system according to claim 11, characterized in that: The packaging plasmid also contains the rep gene segment of adeno-associated virus.

13. The fusion adeno-associated virus vector system according to claim 11, characterized in that: The fusion adeno-associated virus vector system further comprises an expression plasmid, which contains a heterologous nucleotide encoding a target product. The fusion adeno-associated virus vector system according to claim 13 , wherein the target product is a nucleic acid or a protein. The fusion adeno-associated virus vector system according to claim 14 , wherein the nucleic acid is a small guide RNA or an interfering RNA.

16. The fusion adeno-associated virus vector system according to any one of claims 11 to 15, characterized in that: The fusion type adeno-associated virus vector system further comprises a helper virus plasmid or a helper virus, and the fusion type adeno-associated virus vector system further comprises a host cell.

17. A composition for gene delivery, characterized in that The composition comprises the fusion-type adeno-associated virus according to any one of claims 6 to 9 and a pharmaceutically acceptable excipient.

18. Use of the fusion adeno-associated virus capsid protein of any one of claims 1 to 3, or the nucleic acid of claim 4, or the construct of claim 5, the fusion adeno-associated virus of any one of claims 6 to 9, or the host cell of claim 10, the fusion adeno-associated virus vector system of any one of claims 11 to 16, or the composition of claim 17 in the preparation of a gene delivery vector, wherein the gene delivery vector is used to deliver a heterologous nucleotide sequence encoding a target product to cochlear supporting cells, inner hair cells and / or retinal cells.

19. The use according to claim 18, characterized in that The retinal cells are retinal rod and cone layer RCL cells, pigment epithelial layer RPE cells, and vascular endothelial cells in the choroid and / or sclera.

Images