Rhizopus microsporus HR3-26 and its application in the extraction of polysaccharides from Boletus edulis

Abstract

The present invention relates to the field of microbial technology, and discloses Rhizopus microsporus HR3-26 and its application in the extraction of boletus polysaccharide. The present invention provides a new microbial strain, Rhizopus microsporus HR3-26, and allows Rhizopus microsporus HR3-26 to grow moderately in boletus powder added with sucrose to produce various hydrolases. After that, the fermented boletus powder is heated with water, and substances such as cellulose in the cell wall are hydrolyzed, which helps the bound boletus polysaccharide to dissolve during ultrasonic water extraction, thereby significantly improving the extraction yield of polysaccharide. The present invention applies Rhizopus microsporus HR3-26 to the extraction of boletus polysaccharide. Compared with the conventional method of water extraction and alcohol precipitation, the extraction yield of polysaccharide can be increased by 41.3%.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and particularly to Rhizopus microsporus HR3-26 and its application in the extraction of polysaccharides from Boletus edulis. Background Art

[0002] Boletus edulis is a general term for fungi in the family Boletaceae. There are 35 genera and more than 787 species in this family. Among them, except for a few species whose fruiting bodies are poisonous or bitter and inedible, the fruiting bodies of most species are fleshy and thick, and the caps are thick. The color is very similar to that of a beef liver. After being cooked thoroughly, it has the taste and texture of a beef liver, so it is named "Boletus edulis". Common edible Boletus edulis varieties in China include Boletus edulis (also known as white Boletus edulis), Boletus citrifragrans, Boletus auripes, Boletus nigricans, and Boletus erythropus, etc.

[0003] Boletus edulis is delicious and nutritious, and belongs to one of the "Four King Fungus". People all over the world have the habit of eating Boletus edulis. Boletus edulis is rich in polysaccharides, proteins, polyphenols, amino acids, boletine, triterpenes, vitamins, minerals and other substances. Eating Boletus edulis has the effects of clearing heat and relieving annoyance, tonifying deficiency and refreshing the mind on the human body. It can treat symptoms such as pain in the waist and legs, numbness of hands and feet, and also has the function of anti-influenza virus and preventing colds. In traditional Chinese medicine, it has the effects of promoting digestion and regulating the middle energizer, dispelling wind-cold, and relaxing tendons and collaterals, and is mainly used to treat symptoms such as less food and abdominal distension, pain in the waist and legs, numbness of hands and feet, etc. Wild Boletus edulis is scarce and belongs to precious food. In recent years, due to the gradual maturity of artificial cultivation technology, the supply of Boletus edulis in the market has increased, and it has become an ordinary dish on people's tables.

[0004] Among the active ingredients contained in Boletus edulis, the most concerned one is soluble polysaccharide. Its potential immunomodulatory and antitumor effects make Boletus edulis considered as one of the most promising edible mushroom resources with health care functions for food and medicine at present.

[0005] At present, there are many research reports on the extraction methods of polysaccharides from Boletus edulis. The basic method is the hot water extraction and ethanol precipitation method (abbreviated as "water extraction and alcohol precipitation method"). The conventional hot water extraction method has the advantages of simple operation and low cost, but has the disadvantages of long extraction time, multiple extraction times and low extraction efficiency.

[0006] In recent years, enzymatic hydrolysis technology has been widely used in the extraction of natural active substances. It has the advantages of mild conditions, little damage to the structure of active ingredients, and can significantly improve the extraction yield of products. In the enzymatic hydrolysis-assisted extraction method, the most commonly used enzyme is cellulase, followed by pectinase and protease, or multiple enzymes are used simultaneously. The cell walls of plants or edible fungi are composed of substances such as cellulose, hemicellulose, lignin, and pectin. Therefore, using a single enzyme alone has very limited effect on improving the extraction yield of products. Many studies use multiple enzymes (complex enzymes) simultaneously. If the amount of enzyme used is large, it will undoubtedly increase the extraction cost.

[0007] Natural substances in nature are decomposed and decayed by microorganisms. These microorganisms can produce various enzymes that decompose plant or edible (medicinal) fungal tissues during their growth, including cellulase, hemicellulase, ligninase, and pectinase. However, relying on the action of microorganisms to improve the extraction yield of polysaccharide substances from Boletus has not been effectively applied. Summary of the Invention

[0008] The extraction yield of polysaccharide substances from Boletus by the existing method is low. To solve this technical problem, the present invention provides a Rhizopus microsporus HR3-26 and its application in the extraction of Boletus polysaccharide.

[0009] One of the purposes of the present invention is to provide a new microbial strain, Rhizopus microsporus HR3-26. By inoculating this strain into Boletus for microbial fermentation, the extraction yield of polysaccharide in Boletus can be greatly improved.

[0010] Another purpose of the present invention is to provide a method for the application of Rhizopus microsporus HR3-26 in the extraction of Boletus polysaccharide, that is, controlling the growth degree of Rhizopus microsporus HR3-26 to achieve enzyme production and hydrolysis of the cell wall of Boletus, but without decomposing soluble polysaccharides, thereby promoting the dissolution of Boletus polysaccharide and ultimately improving the extraction yield.

[0011] The specific technical solution of the present invention is as follows:

[0012] On the one hand, the present invention provides a Rhizopus microsporus HR3-26, and its preservation number is GDMCC No: 63394.

[0013] The strain HR3 was isolated from the microbial enrichment of boletus powder in the present invention. After ultraviolet mutagenesis, the strain HR3-26, namely Rhizopus microsporus HR3-26, was screened and obtained. This strain was deposited in the Guangdong Microbial Culture Collection Center, with the deposit number GDMCC No: 63394, the deposit date being April 24, 2023, and the address being the 5th floor, Building 59, No. 100 compound, Xianlie Middle Road, Guangzhou, Guangdong Province; the postal code is 510070. By providing a new microbial strain, Rhizopus microsporus HR3-26, inoculating this strain in boletus for microbial fermentation in the present invention, the extraction rate of polysaccharides in boletus is greatly improved.

[0014] Among them, the nucleotide sequence of the internal transcribed spacer of ribosomal DNA of the Rhizopus microsporus HR3-26 is as shown in SEQ ID NO.1.

[0015] On the other hand, the present invention provides the application of the above-mentioned Rhizopus microsporus HR3-26 in the extraction of boletus polysaccharides.

[0016] The present invention provides a new microbial strain, Rhizopus microsporus HR3-26, which is purposefully isolated and screened for its ability to hydrolyze the cell wall of boletus and obtained through mutagenesis. Microorganisms can produce various enzymes that decompose plant or edible (medicinal) mushroom tissues during growth, including cellulase, hemicellulase, ligninase, pectinase, etc. Therefore, on the premise of screening for a dominant strain applied in the extraction of boletus polysaccharides, if microorganisms are used to directly ferment and pretreat boletus, as long as the growth degree is controlled to achieve the production of enzymes to hydrolyze the cell wall of boletus but not decompose the soluble polysaccharides, thereby promoting the dissolution of boletus polysaccharides, the extraction rate can be increased.

[0017] Specifically, the present invention also provides the method of the above application, including the following steps:

[0018] (1) Add the spore solution of Rhizopus microsporus HR3-26 to the boletus powder, stir evenly, and ferment at 28 - 32 °C for 60 - 72 h to obtain the fermented boletus;

[0019] (2) Add deionized water to the fermented boletus, stir evenly, keep warm at 30 - 35 °C for 3 - 4 h, then perform ultrasonic treatment, and after filtration and concentration, obtain the concentrated aqueous extract of boletus;

[0020] (3) Add ethanol to the concentrated aqueous extract of boletus to obtain a precipitate, take the precipitate for washing and drying to obtain boletus polysaccharides.

[0021] After the above steps (1) to (3), the extraction rate of polysaccharides during the ultrasonic aqueous extraction of Boletus can be significantly improved. In step (1), Rhizopus microsporus HR3-26 grows moderately in the Boletus powder added with sucrose, producing various hydrolases; then, in step (2), the fermented Boletus powder is added with water and incubated, and substances such as cellulose in the cell wall are hydrolyzed, which helps the bound Boletus polysaccharides to dissolve during ultrasonic aqueous extraction, thereby significantly increasing the extraction rate of polysaccharides. Specifically:

[0022] In step (1), after inoculating the spore solution of Rhizopus microsporus HR3-26 into the Boletus powder, fermenting at 28-32 °C for 60-72 h can make the growth of Rhizopus microsporus HR3-26 just reach the appropriate level for enzyme production.

[0023] In step (2), adding deionized water to the Boletus fermented product and incubating at 30-35 °C for 3-4 h can make the fermentation reach the level of just hydrolyzing substances such as cellulose in the Boletus cell wall but not decomposing soluble polysaccharides.

[0024] As a preference for the above technical solution of the present invention, in step (1), the concentration of the spore solution of Rhizopus microsporus HR3-26 is 1×10 7 ~2×10 7 CFU / mL.

[0025] As a preference for the above technical solution of the present invention, based on the mass of the Boletus powder, in step (1), the volume addition amount of the spore solution of Rhizopus microsporus HR3-26 is 4-5 mL / g.

[0026] As a preference for the above technical solution of the present invention, the preparation method of the spore solution of Rhizopus microsporus HR3-26 is: inoculating the spores of Rhizopus microsporus HR3-26 on a potato dextrose agar plate medium, culturing at a constant temperature of 25-30 °C for 56-72 h to obtain a culture, and then adding a sterile sucrose aqueous solution to the culture and stirring to suspend the spores to obtain a spore solution.

[0027] As a preference for the above technical solution of the present invention, in step (2), the temperature of the ultrasonic treatment is 80-90 °C, the power is 150-200 W, and the time is 80-100 min.

[0028] As a preference for the above technical solution of the present invention, in step (2), the concentration conditions are: concentrating under reduced pressure to 1 / 25-1 / 20 of the original volume.

[0029] As a preference of the above technical solution of the present invention, step (3) is: adding 4 to 5 times the volume of absolute ethanol to the aqueous extract concentrate of Boletus edulis, so that the ethanol volume fraction of the system is 80% - 83.3%, then standing at 0 - 5°C for 12 - 16 h to obtain a precipitate, then taking the precipitate and washing it with absolute ethanol, and finally drying it to constant weight under vacuum to obtain Boletus edulis polysaccharide.

[0030] Compared with the prior art, the present invention has the following technical effects:

[0031] The present invention provides a new microbial strain Rhizopus microsporus HR3 - 26, which is purposefully isolated and screened for being able to hydrolyze the cell wall of Boletus edulis and obtained through mutagenesis, and is applied to improve the extraction yield of Boletus edulis polysaccharide, with remarkable effects.

[0032] The present invention also provides an application method of Rhizopus microsporus HR3 - 26 in the extraction of Boletus edulis polysaccharide. By Rhizopus microsporus HR3 - 26 in Boletus edulis powder added with sucrose, optimizing the fermentation conditions to make it grow moderately and produce a variety of hydrolases, so as to produce enzymes to hydrolyze the cell wall of Boletus edulis, but without decomposing the soluble polysaccharide, and finally improving the polysaccharide extraction yield. Using this method, compared with the conventional ultrasonic extraction method without fermentation pretreatment with Rhizopus microsporus HR3 - 26, the polysaccharide extraction yield in Boletus edulis can be increased by 41.3%. Description of the Drawings

[0033] Figure 1 It is the standard curve for determining polysaccharide by the phenol - sulfuric acid method with glucose as the standard;

[0034] Figure 2 It is the standard curve for determining glucose by the DNS method in Example 2 of the present invention;

[0035] Figure 3 It is the colony morphology photo of Rhizopus microsporus HR3 - 26 cultured on PDA at 28°C for 3 d in Example 3 of the present invention. Detailed Embodiments

[0036] The present invention will be further described below in conjunction with the embodiments and the drawings.

[0037] The Boletus edulis used in the embodiments and comparative examples of the present invention is the fruiting body of Boletus edulis in the family Boletaceae, also known as white Boletus; the Boletus edulis powder is the fine powder obtained by drying Boletus edulis at 85°C, cutting it into thin slices, and pulverizing it through a 40 - mesh sieve.

[0038] In the examples and comparative examples of the present invention, the content of polysaccharides in Boletus edulis was determined by the phenol-sulfuric acid method. The specific method was as follows: The test sample solution was appropriately diluted with deionized water (estimating that the concentration of polysaccharides in the sample was within the range of the standard curve determination); the solid polysaccharide extract of Boletus edulis was prepared into a sample solution with a concentration of 0.1 mg / mL with deionized water as the test sample. Absorb 1 mL of the sample solution into a 10 mL stoppered tube, add 1 mL of an aqueous phenol solution with a volume concentration of 5%, shake well, and then quickly add 5 mL of concentrated sulfuric acid (mass concentration 98%), shake well, place in a boiling water bath and heat for 15 min, and cool to room temperature. Using the same treatment with 1 mL of deionized water as the blank control as the reference, measure the absorbance (A 490 ) at a wavelength of 490 nm. Measure the A 490 of glucose samples with different concentrations in the same way, and plot the glucose concentration - A 490 standard curve. As shown in Figure 1 , obtain the regression equation, and calculate the polysaccharide content in the Boletus edulis polysaccharide sample from the regression equation.

[0039] The extraction yield of polysaccharides from Boletus edulis was calculated as follows:

[0040]

[0041] Example 1 Isolation and Screening of Microbial Strains of Fermented Boletus edulis

[0042] The microbial strains of fermented Boletus edulis were obtained by isolation and screening according to the following steps:

[0043] (1) Add 5 g of Boletus edulis powder to a 150 mL Erlenmeyer flask, then add 25 mL of sterile normal saline to moisten it, and incubate at 28 °C for 72 h. Dilute the enriched culture filled with mold with sterile normal saline by 1×10 -5 , 1×10 -6 , 1×10 -7 , 1×10 -8 times respectively, then absorb 0.1 mL of the diluted solution and spread it on a potato dextrose agar plate medium (PDA). After incubating at 28 °C for 48 h, pick the mold colonies with different colors and morphologies and transfer them to a fresh PDA plate medium, and incubate at 30 °C for 72 h to obtain 7 pure culture strains. The numbers of each strain are shown in Table 1.

[0044] Among them, the PDA plate medium is a ready-made potato dextrose agar medium (Qingdao Haibo Biotechnology Co., Ltd.), which is prepared with tap water at a concentration of 46 g / L, with the pH natural. In an Erlenmeyer flask, tie the mouth with 8 layers of gauze, sterilize at 121 °C under high-pressure steam for 20 min, and pour it into a sterile petri dish with a diameter of 9 cm before solidification, 15 - 20 mL per dish.

[0045] (2) Add 10 mL of sterile sucrose aqueous solution to each of the seven strains of fresh plate culture, stir with an inoculating loop to suspend the spores, transfer the spore solution to a sterile test tube, and adjust the spore concentration with sterile sucrose aqueous solution so that the spore solution of different strains is between 1×10 7 ~2×10 7 The concentration of the sterile sucrose aqueous solution was 20 g / L and the spore solution was sterilized by high pressure steam at 115°C for 20 min.

[0046] (3) Take 7 100-mL Erlenmeyer flasks sterilized by dry heat at 160° C. for 2 h, add 2 g of boletus powder to each of them, and then add 10 mL of each mold spore liquid prepared in step (2) (the volume dosage is 5 mL / g based on the mass of boletus powder) to each of them. After stirring evenly, the flasks are sealed with 8 layers of gauze and cultured at 30° C. for 72 h to obtain boletus fermentation products.

[0047] (4) Take all the porcini powder fermented by each strain in step (3), add 40 mL of deionized water (solid-liquid ratio is 1 g:20:mL), stir evenly, keep warm in a 30°C water bath for 4 h, then transfer to an ultrasonic cleaner at 80°C, and perform ultrasonic extraction at 150W for 100 min. After the ultrasonic water extraction is completed, filter with a hot Buchner funnel, take 1 mL of the filtrate into a 10 mL centrifuge tube, add 5 mL of anhydrous ethanol (the ethanol volume fraction of the solution is 83.3%), shake thoroughly, let stand for 12 h at 4°C, centrifuge at 8000 r / min for 5 min, discard the supernatant, add 5 mL of deionized water to dissolve, and determine the soluble polysaccharide content in the aqueous solution by the phenol-sulfuric acid method.

[0048] According to the above steps (3) and (4), 10 mL of sterile sucrose solution (concentration 20 g / L) was added to 2 g of boletus powder to serve as a blank fermentation control without inoculation of mold; according to the above step (4), 2 g of boletus was added to 40 mL of deionized water to directly extract polysaccharides to serve as a non-fermentation extraction control. The polysaccharide extraction rates of boletus fermented with different strains and the control are shown in Table 1.

[0049] Table 1 Extraction rate of polysaccharides from boletus fermented by different strains and control

[0050] Serial number Strain number and control Yield rate of polysaccharide extraction (%) Improvement rate (%) 1 HR1 7.35 2.37 2 HR2 7.08 -1.39 3 HR3 8.57 19.4 4 HR4 6.94 -3.34 5 HR5 8.12 13.1 6 HR6 7.56 5.29 7 HR7 7.81 8.77 8 Blank fermentation control 7.15 -0.42 9 Unfermented control 7.18 /

[0051] As can be seen from the data in Table 1: For the blank fermentation control with sterile sucrose aqueous solution added but without inoculating molds, since there was almost no mold growth, the extraction yield of polysaccharides had no significant difference from that of the non-fermented control; after most strains fermented Boletus edulis, the extraction yield of polysaccharides did not increase significantly, and even after fermentation with some strains, the polysaccharide yield decreased slightly, such as strain HR4; after Boletus edulis was fermented with strain HR3, the extraction yield of polysaccharides was 8.57%, which was 19.4% higher than 7.18% of the non-fermented control. Therefore, the present invention selects strain HR3 as the microbial strain for fermenting Boletus edulis to conduct subsequent mutagenesis breeding to further improve the extraction yield of polysaccharides.

[0052] Example 2 Mutagenesis Breeding of Microbial Strains for Fermenting Boletus edulis

[0053] Perform mutagenesis breeding on strain HR3 to screen for strains with better fermentation performance. The specific method is as follows:

[0054] (1) Preparation of spore suspension: Strain HR3 was activated and cultured on a PDA plate medium at 30 °C for 48 h, 5 mL of sterile normal saline was added, and the spores were suspended by stirring with an inoculation loop. Transfer 1 mL of the spore suspension to a triangular flask containing 50 mL of sterile normal saline (with 20 - 30 glass beads added), and shake at room temperature for 15 min. The spore suspension was filtered to remove hyphae (a small tuft of fluffy absorbent cotton was plugged at the bottom of the triangular funnel), the spores in the spore suspension were counted with a hemocytometer under a microscope, and appropriately diluted with sterile normal saline to adjust the spore concentration to 1.53×10 7 cells / mL.

[0055] (2) Mutagenesis: Under red light illumination, take 1.5 mL of the above spore suspension and a sterile paper clip in 6 petri dishes with a diameter of 6 cm respectively. The petri dishes were placed on a magnetic stirrer, and irradiated with a 15 W ultraviolet lamp preheated for 30 min at a distance of 30 cm for 1, 2, 3, 4, 5, and 6 min respectively. Take 0.5 mL of the spore suspension after the above irradiation treatment, make appropriate dilutions, and then transfer 0.1 mL respectively to coat on the PDA plate medium. Perform the same operation with the spore suspension without ultraviolet irradiation diluted and coated on the plate as a control to calculate the lethality rate. The inoculated PDA plates were wrapped with black cloth and inverted and cultured at 28 °C for 48 h, and the colonies on the plates were counted to calculate the lethality rate.

[0056] (3) Screening: Colonies on PDA plates with a lethality rate of over 90% were picked and transferred to fresh PDA plate media, and cultured at 30 °C for 72 h to obtain 40 strains. In the fresh plate cultures of each strain, 10 mL of sterile normal saline was added respectively, and a inoculation loop was used to stir to suspend the spores, obtaining the spore suspensions of each strain. 2.5 mL of the spore suspension of each strain was inoculated into 50 mL of enzyme-producing medium, and cultured with shaking at 30 °C and 200 r / min for 72 h. The fermentation broth was filtered by Buchner funnel, and the filtrate (i.e., crude enzyme solution) was collected, and the cellulase activity of the crude enzyme solution of each strain was determined. 13 strains with an enzyme production activity 15% higher than that of the original strain HR3 were selected. Then, according to the method of Example 1, the spore suspensions of these strains were used to inoculate and ferment boletus powder, and polysaccharides were extracted by water extraction and alcohol precipitation. The polysaccharide extraction yields of the boletus fermented by the mutant strains and the control are shown in Table 2.

[0057] Among them, the composition of the enzyme-producing medium is: wheat bran 50 g / L, (NH4)2SO4 6 g / L, peptone 4 g / L, KH2PO4 2 g / L, MgSO4·7H2O 1 g / L, CaCl2 0.5 g / L, the solvent is tap water, and the pH is 6.0. 50 mL of the enzyme-producing medium was filled in a 250 mL Erlenmeyer flask, sealed with 8 layers of gauze, and sterilized at 121 °C under high pressure steam for 20 min.

[0058] Table 2 Polysaccharide extraction yields of the boletus fermented by the mutant strains and the control

[0059]

[0060] It can be seen from the data in Table 2 that among the 13 screened strains, the strain numbered HR3-26 has a cellulase activity of 41.8 U / mL in fermentation, which is 52.6% higher than that of the wild strain HR3 (27.4 U / mL). After fermenting boletus with this strain, the polysaccharide extraction yield is 9.83%, which is 14.7% higher than that of the wild strain HR3 (8.57%), and 36.9% higher than that of the unfermented control (7.18%). Therefore, the present invention selects the HR3-26 strain as the microbial strain for fermenting boletus, and optimizes the extraction conditions to improve the polysaccharide extraction yield.

[0061] Among them, the method for determining cellulase activity is: 1.5 mL of 10 g / L sodium carboxymethyl cellulose solution (pH 6.0, prepared with 0.2 mol / L phosphate buffer) and 0.5 mL of crude enzyme solution were added to a 10 mL graduated test tube respectively, incubated in a water bath at 50 °C for 30 min, then 3 mL of DNS reagent was added, boiled for 5 min, cooled with running water, and made up to 10 mL with deionized water, and stirred evenly; the crude enzyme solution inactivated by boiling at 100 °C for 10 min was treated in the same way as the reference, and the absorbance (A 540 ) was measured at a wavelength of 540 nm with a spectrophotometer. From the glucose standard curve (such asFigure 2 Calculate the glucose concentration in the sample as shown, and then calculate the cellulase activity (U / mL). Definition of cellulase activity: Under the conditions of pH 6.0 and 50 °C, the amount of enzyme required to hydrolyze sodium carboxymethyl cellulose to produce 1 μmol of glucose per minute is 1 enzyme activity unit (U).

[0062] The formula for calculating cellulase activity is: U = (CV1) / (TV2). Where, C is the glucose concentration (μmol / mL) calculated from the standard curve; V1 is the volume of the enzyme reaction system, which is 2 mL; T is the reaction time, which is 30 min; V2 is the volume of the crude enzyme solution, which is 0.5 mL.

[0063] Among them, the drawing of the glucose standard curve: In 7 10-mL graduated test tubes, add 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mL of a standard glucose aqueous solution with a concentration of 5 μmol / mL respectively, and then add 2.0, 1.8, 1.6, 1.4, 1.2, 1.0, and 0.8 mL of a pH 6.0, 0.2 mol / L phosphate buffer solution to each, and then add 3.0 mL of DNS solution to each. The mixed solution is boiled in a boiling water bath for 5 min, cooled with running water, and then made up to 10 mL with deionized water, stirred evenly, and the color-developing solution in the test tube without glucose is used as a reference, and A is measured with a spectrophotometer. 540 Taking the glucose concentration as the abscissa and A 540 as the ordinate, draw a standard curve as shown in Figure 2 .

[0064] Among them, the preparation method of DNS reagent is: Add 6.3 g of 3,5-dinitrosalicylic acid and 262 mL of a 2 mol / L NaOH aqueous solution to 500 mL of a hot aqueous solution containing 182 g of sodium tartrate, then add 5 g of redistilled phenol and 5 g of sodium sulfite, stir and dissolve, cool and make up to 1 L with deionized water, store in a brown bottle, and use after 7 days.

[0065] Example 3 Classification and Identification of Strain HR3-26

[0066] Strain HR3-26 was streaked and inoculated on a PDA plate medium and cultured at 28 °C. During the culture process, it was found that the colony was initially grayish-white and fluffy, turned gray after 2 days, the mycelial layer was 5-8 mm thick, dense, with many stolons and rhizoids, and rich surface sporangia. The back of the colony was grayish-brown, and there was no pigment diffusion in the medium. The sporangiophores of strain HR3-26 were upright, the sporangia were spherical or nearly spherical, gray or grayish-brown, and the sporangiospores were lemon-shaped, with stripes on the surface, and the size was 3-4 μm × 5-7 μm. Among them, the colony morphology photo of Rhizopus microsporus HR3-26 cultured on PDA at 28 °C for 3 days is shown in Figure 3 . Among them, the composition and preparation method of the PDA plate medium are the same as in Example 1.

[0067] The rDNA-ITS nucleotide sequence of strain HR3-26 was measured as shown in SEQ ID NO.1. This sequence was BLAST-aligned on NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov) and had a homology greater than 98% with the rDNA-ITS sequences of 5 known strains of Rhizopus microsporus. According to the colony morphological characteristics of strain HR3-26 and the results of rDNA-ITS nucleotide sequence alignment, the biological taxonomic position of strain HR3-26 can be determined (referring to Mycobank, http: / / www.mycobank.org): Fungi, Mucoromycota, Mucoromycetes, Mucorales, Mucoraceae, Rhizopus, Rhizopus microsporus.

[0068] The rDNA-ITS nucleotide sequence of the said strain HR3-26 is:

[0069] TTTACTTCTCAGTATTGTTTGCTTCTATACTGTGAACCTCTGGCGATGAAGGTCGTAACTG

[0070] ACCTTCGGGAGAGACTCAGGACATATAGGCTATAATGGGTAGGCCTGTTCTGGGGTTTGA

[0071] TCGATGCCAATCAGGATTACCTTTCTTCCTTTGGGAAGGAAGGCGCCTGGTACCCTTTAC

[0072] CATATACCATGAATTCAGAATTGAAAGTATAATATAATAACAACTTTTAACAATGGATCTC

[0073] TTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATT

[0074] CGTGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGATCTTCTATAGAGTACGCT

[0075] TGCTTCAGTATCATAACCAACCCACACATAAAATTTATTTTATGTGGTGATGGACAAATTC

[0076] GGTTAGATTTAATTATTATACCGATTGTCTAAAATACAGCCTCTTTGTAATTTTCATTAAATT

[0077] ACGAACTACCTAGCCATCGTGCTTTTTTGGTCCAACCAAAAAACATTTAATCTAGGGGTT

[0078] CTGCCAGCCAGCAGATATTTTAATGCTCTTTAACTATGATCTGAAGTCAAGTGGGACTACCCGCTGAACTTAA。

[0079] In summary, strain HR3 was isolated from the microbial enrichment of Boletus powder. After ultraviolet mutagenesis, strain HR3-26, namely Rhizopus microsporus HR3-26, was obtained by screening. This strain was deposited in the Guangdong Microbial Culture Collection Center, with the deposit number GDMCC No: 63394, the deposit date of April 24, 2023, and the address: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Guangdong Province; Postcode 510070.

[0080] Example 4 Application of Rhizopus microsporus HR3-26 in the extraction of Boletus polysaccharide

[0081] The application of Rhizopus microsporus HR3-26 in the extraction of polysaccharide from Boletus is carried out according to the following steps:

[0082] (1) The PDA plate spores of Rhizopus microsporus HR3-26 stored by freeze-drying at 4°C were inoculated on a fresh PDA plate medium and incubated at a constant temperature of 28°C for 62 h. Add 10 mL of sterile sucrose aqueous solution to the petri dish, stir with an inoculation loop to suspend the spores, transfer the spore liquid to a sterile test tube, and adjust the spore concentration to 1.35×10 7 cells / mL with sterile sucrose aqueous solution to obtain the spore liquid of Rhizopus microsporus HR3-26.

[0083] The composition and preparation method of the PDA plate medium are the same as those in Example 1; the concentration of the sterile sucrose aqueous solution is 15 g / L, and it is sterilized by high-pressure steam at 115°C for 20 min.

[0084] (2) Transfer 10 g of boletus powder into a 250 mL Erlenmeyer flask that has been sterilized by dry heat at 160 °C for 2 h. Add 45 mL of the spore suspension of Rhizopus microsporus HR3-26 prepared in step (1) (the volume dosage is 4.5 mL / g based on the mass of the boletus powder), and stir evenly. Tie the mouth of the Erlenmeyer flask with 8 layers of gauze and incubate at 30 °C for 66 h to obtain the boletus fermented product.

[0085] (3) Transfer all of the boletus fermented product from step (2) into a 500 mL beaker, add 250 mL of deionized water (the solid-liquid ratio is 1 g:25 mL), stir evenly, and then keep it warm in a water bath at 32.5 °C for 3.5 h. After that, transfer the beaker into an ultrasonic cleaner with a water temperature of 85 °C and extract with ultrasound at 175 W for 90 min. Filter it while it is hot through a Buchner funnel. Concentrate all of the filtrate under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated aqueous extract of boletus.

[0086] (4) Add 40 mL of absolute ethanol (4 times the volume of the concentrated extract, and the volume fraction of ethanol in the system is 80%) to all of the concentrated aqueous extract of boletus obtained in step (3). Let it stand at 4 °C for 14 h, then centrifuge at 4 °C and 8000 r / min for 10 min. Discard the supernatant. Wash the precipitate once with 20 mL of absolute ethanol (the volume dosage is 2 mL / g based on the mass of the boletus powder), centrifuge again, and dry the precipitate in a vacuum at 65 °C and -0.1 MPa until it reaches a constant weight to obtain the polysaccharide extract of boletus.

[0087] Example 5 Application of Rhizopus microsporus HR3-26 in the extraction of boletus polysaccharide

[0088] The application of Rhizopus microsporus HR3-26 in the extraction of polysaccharide from boletus is operated according to the following steps:

[0089] (1) The PDA plate spores of Rhizopus microsporus HR3-26 preserved by freeze-drying at 4 °C are inoculated on a fresh PDA plate medium and incubated at a constant temperature of 28 °C for 68 h. Add 10 mL of sterile sucrose aqueous solution into the petri dish, stir with an inoculation loop to suspend the spores, transfer the spore suspension to a sterile test tube, and adjust the spore concentration to 1.48×10 7 spores / mL with sterile sucrose aqueous solution to obtain the spore suspension of Rhizopus microsporus HR3-26.

[0090] The composition and preparation method of the PDA plate medium are the same as those in Example 1; the concentration of the sterile sucrose aqueous solution is 20 g / L, and it is sterilized by high-pressure steam at 115 °C for 20 min.

[0091] (2) Take 10 g of boletus powder and place it in a 250 mL Erlenmeyer flask that has been dry-heat sterilized at 160 °C for 2 h. Add 50 mL of the spore solution of Rhizopus microsporus HR3-26 prepared in step (1) (the volume dosage is 5 mL / g based on the mass of the boletus powder), and stir evenly. Tie the mouth of the Erlenmeyer flask with 8 layers of gauze and incubate at 28 °C for 72 h to obtain the boletus fermented product.

[0092] (3) Transfer all of the boletus fermented product from step (2) into a 500 mL beaker, add 200 mL of deionized water (the solid-liquid ratio is 1 g:20 mL), stir evenly, and then keep it warm in a water bath at 30 °C for 4 h. After that, transfer the beaker into an ultrasonic cleaner with a water temperature of 80 °C and extract with ultrasound at 150 W for 100 min. Immediately filter it through a Buchner funnel while it is hot, and concentrate all of the filtrate under reduced pressure to 10 mL (1 / 20 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated aqueous extract of boletus.

[0093] (4) Add 40 mL of absolute ethanol (4 times the volume of the concentrated extract, and the ethanol volume fraction in the system is 80%) to all of the concentrated aqueous extract of boletus obtained in step (3). After standing at 4 °C for 12 h, centrifuge at 0 °C and 8000 r / min for 10 min, discard the supernatant, wash the precipitate once with 15 mL of absolute ethanol (the volume dosage is 1.5 mL / g based on the mass of the boletus powder), centrifuge again, and vacuum-dry the precipitate at 65 °C and -0.1 MPa until it reaches a constant weight to obtain the polysaccharide extract of boletus.

[0094] Example 6 Application of Rhizopus microsporus HR3-26 in the extraction of boletus polysaccharide

[0095] The application of Rhizopus microsporus HR3-26 in the extraction of polysaccharide from boletus is operated according to the following steps:

[0096] (1) The PDA plate spores of Rhizopus microsporus HR3-26 stored at 4 °C are inoculated onto a fresh PDA plate medium and incubated at a constant temperature of 28 °C for 56 h. Add 10 mL of sterile sucrose aqueous solution into the petri dish, stir with an inoculation loop to suspend the spores, transfer the spore solution into a sterile test tube, and adjust the spore concentration to 1.13×10 7 spores / mL with sterile sucrose aqueous solution to obtain the spore solution of Rhizopus microsporus HR3-26.

[0097] The composition and preparation method of the PDA plate medium are the same as those in Example 1; the concentration of the sterile sucrose aqueous solution is 10 g / L, and it is sterilized by high-pressure steam at 115 °C for 20 min.

[0098] (2) Transfer 10 g of boletus powder into a 250 mL Erlenmeyer flask that has been sterilized by dry heat at 160 °C for 2 h. Add 40 mL of the spore solution of Rhizopus microsporus HR3-26 prepared in step (1) (the volume dosage is 4 mL / g based on the mass of the boletus powder), and stir evenly. Tie the mouth of the Erlenmeyer flask with 8 layers of gauze and incubate at 32 °C for 60 h to obtain the boletus fermented product.

[0099] (3) Transfer all the boletus fermented product from step (2) into a 500 mL beaker, add 300 mL of deionized water (the solid-liquid ratio is 1 g:30 mL), stir evenly, and then keep it warm in a water bath at 35 °C for 3 h. Then, transfer the beaker into an ultrasonic cleaner with a water temperature of 90 °C and perform ultrasonic extraction at 200 W for 80 min. Immediately filter it through a Buchner funnel while it is hot, and concentrate all the filtrate under reduced pressure to 12 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated aqueous extract of boletus.

[0100] (4) Add 48 mL of absolute ethanol (4 times the volume of the concentrated extract, and the volume fraction of ethanol in the system is 80%) to all the concentrated aqueous extract of boletus obtained in step (3). After standing at 4 °C for 16 h, centrifuge at 5 °C and 8000 r / min for 10 min, discard the supernatant, wash the precipitate with 20 mL of absolute ethanol (the volume dosage is 2 mL / g based on the mass of the boletus powder) once, centrifuge again, and dry the precipitate in a vacuum at 65 °C and -0.1 MPa until constant weight to obtain the polysaccharide extract of boletus.

[0101] Comparative Example 1

[0102] The main difference from Example 4 is that no fermentation pretreatment with Rhizopus microsporus HR3-26 is carried out before water extraction and alcohol precipitation.

[0103] Operate according to the following steps:

[0104] (1) Take 10 g of boletus powder in a 500 mL beaker, add 250 mL of deionized water (the solid-liquid ratio is 1 g:25 mL), stir evenly, and then keep it warm in a water bath at 32.5 °C for 3.5 h. Then, transfer the beaker into an ultrasonic cleaner with a water temperature of 85 °C and perform ultrasonic extraction at 175 W for 90 min. Immediately filter it through a Buchner funnel while it is hot, and concentrate all the filtrate under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated aqueous extract of boletus.

[0105] (2) To all the concentrated aqueous extracts of Boletus edulis obtained in step (2), add 40 mL of absolute ethanol (4 times the volume of the concentrated extract, with the ethanol volume fraction in the system being 80%), let it stand at 4 °C for 14 h, then centrifuge at 4 °C and 8000 r / min for 10 min. Discard the supernatant. Wash the precipitate once with 20 mL of absolute ethanol (2 mL / g based on the mass of the raw Boletus edulis powder), centrifuge again, and dry the precipitate at 65 °C and -0.1 MPa under vacuum until constant weight to obtain the Boletus edulis polysaccharide extract.

[0106] Comparative Example 2

[0107] The main difference from Example 4 is that: the fermentation temperature in step (2) is 25 °C. Other steps are the same as in Example 4.

[0108] Step (2) is operated as follows:

[0109] Put 10 g of Boletus edulis powder into a 250 mL Erlenmeyer flask that has been dry-heat sterilized at 160 °C for 2 h, add 45 mL of the spore solution of Rhizopus microsporus HR3-26 prepared in step (1) (the volume dosage is 4.5 mL / g based on the mass of the Boletus edulis powder), and stir evenly. Tie the mouth of the Erlenmeyer flask with 8 layers of gauze and culture at 25 °C for 66 h to obtain the Boletus edulis fermented product.

[0110] Comparative Example 3

[0111] The main difference from Example 4 is that: the fermentation temperature in step (2) is 35 °C. Other steps are the same as in Example 4.

[0112] Step (2) is operated as follows:

[0113] Put 10 g of Boletus edulis powder into a 250 mL Erlenmeyer flask that has been dry-heat sterilized at 160 °C for 2 h, add 45 mL of the spore solution of Rhizopus microsporus HR3-26 prepared in step (1) (the volume dosage is 4.5 mL / g based on the mass of the Boletus edulis powder), and stir evenly. Tie the mouth of the Erlenmeyer flask with 8 layers of gauze and culture at 35 °C for 66 h to obtain the Boletus edulis fermented product.

[0114] Comparative Example 4

[0115] The main difference from Example 4 is that: the fermentation time in step (2) is 54 h. Other steps are the same as in Example 4.

[0116] Step (2) is operated as follows:

[0117] 10 g of boletus powder was placed in a 250 mL Erlenmeyer flask that had been sterilized by dry heat at 160 °C for 2 h. 45 mL of the spore solution of Rhizopus microsporus HR3-26 prepared in step (1) (the volume dosage was 4.5 mL / g based on the mass of the boletus powder) was added and stirred evenly. The Erlenmeyer flask was sealed with eight layers of gauze and cultured at 30 °C for 54 h to obtain the boletus ferment.

[0118] Comparative Example 5

[0119] The main difference from Example 4 was that: the fermentation time in step (2) was 78 h. Other steps were the same as those in Example 4.

[0120] Step (2) was operated according to the following steps:

[0121] 10 g of boletus powder was placed in a 250 mL Erlenmeyer flask that had been sterilized by dry heat at 160 °C for 2 h. 45 mL of the spore solution of Rhizopus microsporus HR3-26 prepared in step (1) (the volume dosage was 4.5 mL / g based on the mass of the boletus powder) was added and stirred evenly. The Erlenmeyer flask was sealed with eight layers of gauze and cultured at 30 °C for 78 h to obtain the boletus ferment.

[0122] Comparative Example 6

[0123] The main difference from Example 4 was that: the heat preservation temperature in step (3) was 25 °C. Other steps were the same as those in Example 4.

[0124] Step (3) was operated according to the following steps:

[0125] (3) All of the boletus ferment from step (2) was transferred into a 500 mL beaker, 250 mL of deionized water was added (the solid-liquid ratio was 1 g:25 mL), and after stirring evenly, it was kept warm in a 25 °C water bath for 3.5 h. Then, the beaker was transferred into an ultrasonic cleaner with a water temperature of 85 °C, and ultrasonic extraction was carried out at 175 W for 90 min. While it was hot, it was filtered by a Buchner funnel, and all of the filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated aqueous extract of boletus.

[0126] Comparative Example 7

[0127] The main difference from Example 4 was that: the heat preservation temperature in step (3) was 40 °C. Other steps were the same as those in Example 4.

[0128] Step (3) was operated according to the following steps:

[0129] (3) All the fermented boletus edulis in step (2) was transferred into a 500 mL beaker, 250 mL of deionized water was added (the material-liquid ratio was 1 g: 25 mL), after stirring evenly, it was kept warm in a water bath at 40 °C for 3.5 h. Then, the beaker was transferred into an ultrasonic cleaner with a water temperature of 85 °C, and ultrasonic extraction was carried out at 175 W for 90 min. Immediately after that, it was filtered by Buchner funnel while it was hot, and all the filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated aqueous extract of boletus edulis.

[0130] Comparative Example 8

[0131] The main difference from Example 4 was that: the holding time in step (3) was 1 h. Other steps were the same as those in Example 4.

[0132] Step (3) was operated according to the following steps:

[0133] All the fermented boletus edulis in step (2) was transferred into a 500 mL beaker, 250 mL of deionized water was added (the material-liquid ratio was 1 g: 25 mL), after stirring evenly, it was kept warm in a water bath at 32.5 °C for 1 h. Then, the beaker was transferred into an ultrasonic cleaner with a water temperature of 85 °C, and ultrasonic extraction was carried out at 175 W for 90 min. Immediately after that, it was filtered by Buchner funnel while it was hot, and all the filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated aqueous extract of boletus edulis.

[0134] Comparative Example 9

[0135] The main difference from Example 4 was that: the holding time in step (3) was 6 h. Other steps were the same as those in Example 4.

[0136] Step (3) was operated according to the following steps:

[0137] All the fermented boletus edulis in step (2) was transferred into a 500 mL beaker, 250 mL of deionized water was added (the material-liquid ratio was 1 g: 25 mL), after stirring evenly, it was kept warm in a water bath at 32.5 °C for 6 h. Then, the beaker was transferred into an ultrasonic cleaner with a water temperature of 85 °C, and ultrasonic extraction was carried out at 175 W for 90 min. Immediately after that, it was filtered by Buchner funnel while it was hot, and all the filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated aqueous extract of boletus edulis.

[0138] Fermentation result evaluation

[0139] In Examples 4 to 6 and Comparative Examples 1 to 9, the mass of the polysaccharide extract obtained from 10 g of boletus edulis, the mass of boletus edulis polysaccharide, the percentage content of boletus edulis polysaccharide, and the extraction yield of boletus edulis polysaccharide are shown in Table 3. Among them, the percentage content of boletus edulis polysaccharide was the percentage of the mass of boletus edulis polysaccharide in the mass of the obtained polysaccharide extract.

[0140] Table 3 Yields of polysaccharides extracted from Boletus edulis in Examples 4 - 6 and Comparative Examples 1 - 9

[0141]

[0142] As can be seen from the data in Table 3:

[0143] ① As can be seen from the data in Examples 4 - 6, applying Rhizopus microsporus HR3 - 26 to the extraction of polysaccharides from Boletus edulis can effectively improve the extraction yield of polysaccharides from Boletus edulis.

[0144] ② Comparing Comparative Example 1 with Example 4, without the fermentation pretreatment of Rhizopus microsporus HR3 - 26 before conventional water extraction and alcohol precipitation, the extraction yield is greatly reduced, indicating that the fermentation pretreatment of Rhizopus microsporus HR3 - 26 before water extraction and alcohol precipitation can produce a variety of hydrolases to hydrolyze the cell wall of Boletus edulis, ultimately significantly improving the polysaccharide extraction yield. The extraction yield of Example 4 with the fermentation pretreatment of Rhizopus microsporus HR3 - 26 is 10.3%, which is 41.3% higher than that of Comparative Example 1 without treatment.

[0145] ③ Through the comparative analysis of Example 4 and Comparative Examples 2 - 5, when applying Rhizopus microsporus HR3 - 26 to the extraction of polysaccharides from Boletus edulis, after adding the spore solution of Rhizopus microsporus HR3 - 26 to the Boletus edulis powder and fermenting at 28 - 32 °C for 60 - 72 h, the growth of Rhizopus microsporus HR3 - 26 can just reach the appropriate degree for enzyme production, and the polysaccharide extraction effect is better.

[0146] ④ Through the comparative analysis of Example 4 and Comparative Examples 6 - 9, when applying Rhizopus microsporus HR3 - 26 to the extraction of polysaccharides from Boletus edulis, after adding deionized water to the Boletus edulis fermented product and keeping it warm at 30 - 35 °C for 3 - 4 h, the polysaccharide extraction effect is better, which can make the fermentation reach the degree of just hydrolyzing substances such as cellulose in the cell wall of Boletus edulis but not decomposing soluble polysaccharides.

[0147] The raw materials and equipment used in the present invention are all common raw materials and equipment in the art without special instructions; the methods used in the present invention are all conventional methods in the art without special instructions.

[0148] The above are only the preferred embodiments of the present invention, and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent transformations made to the above embodiments according to the technical essence of the present invention still belong to the protection scope of the technical solution of the present invention.

Claims

1. A strain of Rhizopus microsporus ( Rhizopus microsporus ), HR3-26, with a preservation number of GDMCC No: 63394.

2. Use of Rhizopus microsporus HR3-26 as described in claim 1 in the extraction of boletus polysaccharide.

3. The application according to claim 2, characterized in that: The method of the above use comprises the following steps: (1) Add the spore solution of Rhizopus microsporus HR3-26 to the boletus powder, stir evenly, and ferment at 28-32 °C for 60-72 h to obtain a boletus ferment; (2) Add deionized water to the boletus ferment, stir evenly, keep warm at 30-35 °C for 3-4 h, then perform ultrasonic treatment, and after filtration and concentration, obtain a concentrated aqueous extract of boletus; (3) Add ethanol to the concentrated aqueous extract of boletus to obtain a precipitate, take the precipitate for washing and drying to obtain boletus polysaccharide.

4. The application according to claim 3, characterized in that: In step (1), the concentration of the Rhizopus microsporus HR3-26 spore solution is 1×10 7 ~2×10 7 spores / mL.

5. The application according to claim 3 or 4, characterized in that: Based on the mass of the boletus powder, in step (1), the added volume of the spore solution of Rhizopus microsporus HR3-26 is 4-5 mL / g.

6. The application according to claim 3, characterized in that: The preparation method of the spore solution of Rhizopus microsporus HR3-26 is: inoculate the spores of Rhizopus microsporus HR3-26 on a potato dextrose agar plate medium, incubate at 25-30 °C for 56-72 h to obtain a culture, then add a sterile sucrose aqueous solution to the culture, and stir to suspend the spores to obtain a spore solution.

7. The application according to claim 3, wherein: In step (2), the temperature of the ultrasonic treatment is 80-90 °C, the power is 150-200 W, and the time is 80-100 min.

8. The application according to claim 3, wherein: In step (2), the concentration conditions are: concentrate under reduced pressure to 1 / 25-1 / 20 of the original volume.

9. The application according to claim 3, characterized in that: Step (3) is: add 4-5 times the volume of absolute ethanol to the concentrated aqueous extract of boletus to make the ethanol volume fraction in the system 80%-83.3%, then let it stand at 0-5 °C for 12-16 h to obtain a precipitate, then take the precipitate and wash it with absolute ethanol, and finally dry it under vacuum to constant weight to obtain boletus polysaccharide.

Images