Use of a substance that reduces the content or activity of kdm1a in the manufacture of a product for the treatment of non-alcoholic fatty liver disease and related diseases
By using substances that reduce the content or activity of KDM1A, especially inhibitors and the CRISPR-Cas9 gene knockout system, the treatment challenges of non-alcoholic fatty liver disease have been solved, achieving liver protection and effective treatment of related diseases.
Patent Information
- Application Number
- CN202311038961.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-17
- Publication Date
- 2026-04-24
- Estimated Expiration
- 2043-08-17
AI Technical Summary
Existing technologies are not effective in treating non-alcoholic fatty liver disease, and there is a lack of effective interventions. The function of KDM1A in this disease has not been fully utilized.
Drugs for treating non-alcoholic fatty liver disease and related diseases are prepared by using substances that reduce the content or activity of KDM1A, including inhibitors and CRISPR-Cas9 gene knockout systems, to inhibit disease progression by suppressing the expression of KDM1A protein or mRNA.
It significantly inhibits hepatic lipid deposition and fibrosis, protects the liver, effectively inhibits the progression of non-alcoholic fatty liver disease, and treats related diseases such as insulin resistance, metabolic syndrome, obesity, diabetes, hyperlipidemia, and liver cancer.
Smart Images

Figure CN117065028B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of pharmaceutical biotechnology, and in particular relates to the application of substances that reduce the content or activity of KDM1A in the preparation of products for treating non-alcoholic fatty liver disease and related diseases. Background Technology
[0002] With economic development and improved living standards, the incidence of non-alcoholic fatty liver disease (NAFLD) has been increasing year by year, becoming one of the most common liver diseases worldwide. NAFLD is a clinicopathological syndrome characterized by hepatocellular steatosis and lipid accumulation without a history of excessive alcohol consumption. Its incidence in the general population is 25%-30%. According to its pathological progression, it can be divided into simple non-alcoholic fatty liver, non-alcoholic steatohepatitis (NASH), liver fibrosis, and cirrhosis. Statistics show that 10%-20% of NAFLD patients develop NASH. If the condition is not effectively controlled, it will further progress to cirrhosis, liver failure, and even more serious hepatocellular carcinoma. Although many antioxidants, insulin sensitizers, and cell protectants are currently used to treat this disease, the control and treatment effects are still not ideal. NAFLD and its related liver and metabolic diseases impose a huge economic burden on society and have become a major public health problem affecting social development. Finding active and effective interventions to curb the progression of NAFLD is therefore crucial.
[0003] Lysine-specific histone demethylase 1A (KDM1A / LSD1) was the first histone demethylase discovered, breaking the concept of irreversible methylation labeling. KDM1A contains a flavin adenine dinucleotide (FAD)-dependent amine oxidase domain, demethylating histone 3 lysine 4 and histone 3 lysine 9 (H3K4me1 / 2 and H3K9me1 / 2). KDM1A is an important enzyme playing a crucial regulatory role in embryonic development and differentiation. Furthermore, this protein, along with related proteins, regulates many physiological processes involved in the determination of stem cell and progenitor morphology and identity, and plays a role in the differentiation of stem cells and progenitors into hematopoietic, neural, mesenchymal, and spermatogenic cells. KDM1A is also associated with the development of various pathological conditions, such as cancer, neuronal diseases, and viral infections. The functional diversity of KDM1A is supported by its complex structure. KDM1A participates in the maintenance of its microenvironment through complex interactions with various transcription factors, promoters, activators, co-repressors, and non-coding RNAs. KDM1A is a versatile epigenetic modifier that regulates the expression of many genes involved in epithelial-mesenchymal transition (EMT). While numerous studies have described the biological functions of KDM1A, its function and application in non-alcoholic fatty liver disease are rarely reported. Summary of the Invention
[0004] To address the shortcomings in the clinical prevention and treatment of non-alcoholic fatty liver disease, the purpose of this application is to provide a substance that reduces the content or activity of KDM1A for use in the preparation of products for the treatment of non-alcoholic fatty liver disease and related diseases.
[0005] The objective of this application is achieved through the following technical solution:
[0006] This application provides the use of a substance that reduces the content or activity of KDM1A in the preparation of products for treating non-alcoholic fatty liver disease and related diseases. The substance is selected from at least one of the following: inhibitors that reduce the content or activity of KDM1A protein, inhibitors that reduce the content or activity of KDM1A mRNA, and CRISPR-Cas9 gene knockout systems that target the KDM1A gene.
[0007] Furthermore, the non-alcoholic fatty liver disease is selected from at least one of simple fatty liver, non-alcoholic steatohepatitis, liver fibrosis, cirrhosis, and liver cancer.
[0008] Furthermore, the non-alcoholic fatty liver disease is selected from at least one of non-alcoholic simple fatty liver, non-alcoholic steatohepatitis, non-alcoholic hepatic steatosis, non-alcoholic steatohepatitis-associated liver fibrosis, and non-alcoholic steatohepatitis-associated cirrhosis.
[0009] Furthermore, the inhibitor that reduces the content or activity of KDM1A protein is selected from at least one of proteins, proteolytic targeting chimeras, antibodies, peptides, enzymes, polynucleotides, polynucleotide sequences, plasmids, viruses, and small molecule compounds.
[0010] Furthermore, the inhibitor that reduces the content or activity of KDM1A protein is selected from at least one of DDP-38003, ORY-1001, CC-90011, ORY-2001, GSK-2879552, IMG-7289, INCB059872, 4SC-202, Seclidemstat, tak-418, SYHA-1807, BEA-17, HM-97211, HM-97346, JBI-097, JBI-128, ORY-3001, rh-1, SP-2509, T-3775440, T-448, EPI-110, and pharmaceutically acceptable salts or solvents of these compounds.
[0011] Furthermore, the substance is DDP-38003 or a CRISPR-Cas9 gene knockout system targeting the KDM1A gene.
[0012] Furthermore, the relevant diseases are selected from one or more of insulin resistance, metabolic syndrome, obesity, diabetes, hyperglycemia, hyperlipidemia, and liver cancer.
[0013] Furthermore, the substance is a recombinant vector containing the CRISPR-Cas9 gene knockout system targeting the KDM1A gene.
[0014] Furthermore, the method for preparing the recombinant vector includes the following steps:
[0015] (1) Design gRNA target sequences for genes to be knocked out in the CRISPR / Cas9 system;
[0016] (2) Construction of target plasmid: The primers before and after sgRNA were annealed to form double-stranded DNA, and then ligated into the pAAV U6-TBG-cre vector digested with restriction endonucleases XhoI and NheI respectively using T4 DNA ligase. After sequencing, the target plasmid with the correct sequence was selected for subsequent experiments.
[0017] (3) AAV virus packaging: 293T cells were amplified to 60-80 cells in 10cm culture dishes. When the cell density was 70%-90%, transfection was prepared. Before transfection, the culture medium was replaced with DMEM high-glucose medium containing 2% FBS. The transfection system was as follows: the molar ratio of each plasmid (packaging plasmid, helper plasmid pAdDelta, and target plasmid) was 1:1:1. The volume of PEImax (1ug / ul) was three times the mass of the total plasmid. The plasmid and PEImax were dissolved in physiological saline or DMEM medium without serum or antibiotics. After filtering with a 0.22um filter, the mixture was gently mixed and allowed to stand for 15-20 minutes. The transfection system was then added to the culture dish along the side wall, mixed well, and placed in an incubator for incubation.
[0018] Furthermore, the gRNA target sequence described in step (1) is as follows:
[0019] The sgRNA1 sequence is shown in SEQ ID NO.1;
[0020] The sgRNA2 sequence is shown in SEQ ID NO.2;
[0021] The SgRNA3 sequence is shown in SEQ ID NO.3.
[0022] Furthermore, the product is a drug, and the drug is in the form of an oral dosage form or an injectable dosage form.
[0023] Compared with the prior art, this application has the following advantages and effects:
[0024] (1) This application has discovered a new use for the KDM1A gene. Inhibiting the expression of KDM1A protein, inhibiting KDM1A protein or inhibiting the mRNA level of KDM1A in cells or tissues can protect the liver and inhibit non-alcoholic fatty liver disease.
[0025] (2) Based on the role of the KDM1A gene in inhibiting non-alcoholic fatty liver disease, it provides a new target for the development of drugs to prevent, alleviate and / or treat non-alcoholic fatty liver disease.
[0026] (3) Based on the role of KDM1A in inhibiting non-alcoholic fatty liver disease, it can be used to prepare drugs for the prevention, relief and / or treatment of non-alcoholic fatty liver disease. Attached Figure Description
[0027] The accompanying drawings are used to provide an understanding of the technical solutions of this application and constitute a part of the specification. They are used together with the embodiments of this application to explain the technical solutions of this application and do not constitute a limitation on the technical solutions of this application.
[0028] Figure 1This is a Western blot image of the livers of control mice and liver-specific KDM1A knockout mice.
[0029] Figure 2 This is a statistical graph showing the correlation between liver weight, liver weight / body weight ratio, and white fat / body weight ratio in control mice and liver-specific KDM1A knockout mice after 16 weeks of feeding with HFHC diet;
[0030] Figure 3 This is an image showing the HE staining results of liver tissue from control mice and liver-specific KDM1A knockout mice fed NC and HFHC diets for 16 weeks.
[0031] Figure 4 This is a PSR staining result of liver tissue from control mice and liver-specific KDM1A knockout mice (NC and HFHC diets) after 16 weeks of feeding.
[0032] Figure 5 This is an image showing the Oil Red O staining results of liver tissue from control mice and liver-specific KDM1A knockout mice after 16 weeks of feeding with HFHC diet.
[0033] Figure 6 The values are the serum ALP (alkaline phosphatase), TC (total cholesterol), and LDL (low-density lipoprotein) levels after 16 weeks of feeding with HFHC diet in control mice and liver-specific KDM1A knockout mice.
[0034] Figure 7 This is a graph showing changes in body weight and liver function after DDP-38003 administration;
[0035] Figure 8 This is an image showing the HE staining results of mouse liver tissue after DDP-38003 administration;
[0036] Figure 9 This is an image showing the results of Oil Red O staining of mouse liver tissue after administration of DDP-38003;
[0037] Figure 10 This is a diagram showing the PSR staining results of mouse liver tissue after administration of DDP-38003. Detailed Implementation
[0038] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. The described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0039] The high-fat, high-cholesterol diet-induced mouse model of this application showed that the body weight, liver / body weight ratio, and pathological staining results of the liver-specific KDM1A gene knockout group compared with the control group mice all indicated that KDM1A gene knockout can significantly inhibit liver lipid deposition, inhibit collagen fiber production, and inhibit liver fibrosis, thereby inhibiting the occurrence and development of non-alcoholic fatty liver disease.
[0040] Based on this, the present invention provides the use of a substance that reduces the content or activity of KDM1A in the preparation of products for treating non-alcoholic fatty liver disease and related diseases, wherein the substance is selected from at least one of an inhibitor that reduces the content or activity of KDM1A protein, an inhibitor that reduces the content or activity of KDM1A mRNA, and a CRISPR-Cas9 gene knockout system that targets the KDM1A gene.
[0041] In some embodiments provided in this application, the non-alcoholic fatty liver disease is selected from at least one of non-alcoholic simple fatty liver, non-alcoholic hepatic steatosis, non-alcoholic steatohepatitis, non-alcoholic steatohepatitis-associated liver fibrosis, and non-alcoholic steatohepatitis-associated cirrhosis.
[0042] In some embodiments provided in this application, the non-alcoholic fatty liver disease is caused by a high-fat, high-cholesterol diet.
[0043] In some embodiments provided in this application, the substance that reduces KDM1A content or activity can also be used to treat non-alcoholic fatty liver disease-related diseases, including one or more of insulin resistance, metabolic syndrome, obesity, diabetes, hyperglycemia, hyperlipidemia, and liver cancer.
[0044] This application provides some embodiments in which the substance that reduces KDM1A content or activity can be used to inhibit weight gain caused by a high-fat diet.
[0045] In some embodiments provided in this application, the inhibitor that reduces the content or activity of KDM1A protein can enter cells and inhibit KDM1A protein expression or KDM1A protein activity.
[0046] In some embodiments provided in this application, the inhibitors that reduce the content or activity of KDM1A protein include, but are not limited to, at least one of protein, proteolytic targeting chimera, antibody, peptide, enzyme, polynucleotide, polynucleotide sequence, plasmid, virus, and small molecule compound.
[0047] In some embodiments provided in this application, the small molecule compounds include, but are not limited to, DDP-38003, ORY-1001 (or iadaddemstat), CC-90011, ORY-2001 (or vafidemstat), GSK-2879552, IMG-7289 (bomedemstat), INCB059872, 4SC-202 (or domatinostat), Seclidemstat, tak-418, SYHA-1807, BEA-17, HM-97211, HM-97346, JBI-097, JBI-128, ORY-3001, rh-1, SP-2509, T-3775440, T-448, EPI-110, and at least one of these pharmaceutically acceptable salts or solvents.
[0048] In some embodiments provided in this application, the antibodies that inhibit the reduction of KDM1A protein content or activity include, but are not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies, single-chain Fv, single-chain antibodies, Fab fragments, F(ab') fragments, disulfide-linked Fv, and any of the above-mentioned epitope-binding fragments.
[0049] In some embodiments provided in this application, the substance is DDP-38003 or a CRISPR-Cas9 gene knockout system targeting the KDM1A gene.
[0050] In some embodiments provided in this application, the substance is a recombinant vector containing the CRISPR-Cas9 gene knockout system targeting the KDM1A gene.
[0051] In some embodiments provided in this application, the relevant diseases are selected from one or more of insulin resistance, metabolic syndrome, obesity, diabetes, hyperglycemia, hyperlipidemia, and liver cancer.
[0052] In some embodiments provided in this application, the method for preparing the recombinant vector includes the following steps:
[0053] (1) Design gRNA target sequences for the genes to be knocked out in the CRISPR / Cas9 system. The gRNA target sequences are as follows:
[0054] The sgRNA1 sequence is shown in SEQ ID NO.1;
[0055] The sgRNA2 sequence is shown in SEQ ID NO.2;
[0056] The SgRNA3 sequence is shown in SEQ ID NO.3;
[0057] (2) Construction of target plasmid: The primers before and after sgRNA were annealed to form double-stranded DNA, and then ligated into the pAAV U6-TBG-cre vector digested with restriction endonucleases XhoI and NheI respectively using T4 DNA ligase. After sequencing, the target plasmid with the correct sequence was selected for subsequent experiments.
[0058] (3) AAV virus packaging: 293T cells were amplified to 60-80 cells in 10cm culture dishes. When the cell density was 70%-90%, transfection was prepared. Before transfection, the culture medium was replaced with DMEM high-glucose medium containing 2% FBS. The transfection system was as follows: the molar ratio of each plasmid (packaging plasmid, helper plasmid pAdDelta, and target plasmid) was 1:1:1. The volume of PEImax (1ug / ul) was three times the mass of the total plasmid. The plasmid and PEImax were dissolved in physiological saline or DMEM medium without serum or antibiotics. After filtering with a 0.22um filter, the mixture was gently mixed and allowed to stand for 15-20 minutes. The transfection system was then added to the culture dish along the side wall, mixed well, and placed in an incubator for incubation.
[0059] In some embodiments provided in this application, the product allows entry into cells via one or more of the following methods: direct naked DNA injection, liposome-encapsulated DNA direct injection, gold-coated DNA gene gun bombardment, plasmid DNA carried by reproduction-deficient bacteria, target DNA carried by replication-deficient adenovirus, PEG-modified protein drug injection, liposome-encapsulated protein intravenous injection, and subcutaneous injection of protein microsphere formulations.
[0060] In some embodiments provided in this application, the inhibitors that reduce the mRNA content or activity of KDM1A include antisense nucleotide sequences of KDM1A, siRNA, miRNA, shRNA, dsRNA, or other proteins, peptides, enzymes, and compounds that can inhibit the mRNA level of KDM1A.
[0061] In some embodiments provided in this application, the product is a drug, and the dosage form of the drug is an oral dosage form or an injectable dosage form.
[0062] Unless otherwise specified, all methods described herein are conventional methods, and all raw materials described herein are available from publicly available commercial sources.
[0063] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0064] Example 1
[0065] I. Laboratory Animals and Their Care
[0066] Experimental animals: 8-10 week old, weighing 23.5-27.5g, male C57BL / 6 wild-type mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. (Nanjing, China) and KDM1A liver-specific knockout mice were fed normal diet and high-fat diet as experimental subjects.
[0067] Animal feed formulation: normal feed (NC) and TP26304 high-fat, high-cholesterol diet, purchased from Nantong Trofi.
[0068] Animal housing and environmental conditions: All laboratory mice were housed in the SPF-grade animal room of the Animal Experiment Center of Wuhan University. The lighting was alternated every 12 hours, the temperature was 24±2℃, the humidity was 40%-70%, and the mice had free access to water and food.
[0069] II. Western blot operation method
[0070] 1) Protein extraction from tissues
[0071] Lysis buffer was added to the tissue sample. After lysis, the supernatant was collected by centrifugation, and protein samples were quantitatively collected using the BCA Protein Assay Kit.
[0072] 2) Sample loading and electrophoresis
[0073] Prepare the electrophoresis gel and add the electrophoresis buffer to the electrophoresis tank. Load the protein samples into the wells of the SDS-PAGE gel, and begin electrophoresis after loading.
[0074] 3) Transfer membrane
[0075] ① Prepare the transfer solution and pre-cool it at 4℃.
[0076] ② Soak PVDF in methanol for 15 seconds and then place it in the transfer solution for later use.
[0077] ③ Remove the gel from the gel plate, wash the gel with transfer solution, spread the gel evenly on the filter paper of the negative electrode, cover it with the PVDF membrane, and clamp it in place.
[0078] ④ Place the clamp into the transfer tank and fill it with transfer solution to submerge the gel.
[0079] ⑤ Connect the power supply to the transfer tank, set the voltage to 250V and the current to 0.2A. Transfer for 1.5 hours.
[0080] ⑥ After the transfer is complete, remove the PVDF membrane.
[0081] 4) Closed
[0082] Place the protein membrane in the prepared TBST and wash off the transfer buffer. Place the protein membrane in blocking buffer and gently shake on a shaker for 1-4 hours at room temperature.
[0083] 5) Primary antibody incubation
[0084] ① Wash the protein membrane three times with TBST, 5 minutes each time.
[0085] ②The sealing machine seals the film into the hybridization bag and adds the primary antibody, Anti-MOXD1 Antibody (ATLAS, HPA038504).
[0086] ③ Place the hybridization bags in a shaker at 4℃ and leave overnight.
[0087] 6) Secondary antibody incubation
[0088] ① Remove the membrane and wash it three times with TBST for 5 minutes each time to recover the primary antibody.
[0089] ② Place the membrane in the corresponding secondary antibody dilution solution containing the secondary antibody (Beijing Bio-Long Immunotherapy Co., Ltd., BF03008 / BF03008X) and incubate in the dark for 1 hour.
[0090] 7) Protein detection
[0091] After incubation, the sample was washed three times with TBST for 5 minutes each time. The target band was detected using a Bio-Rad ChemiDoc XRS+ gel imaging system.
[0092] III. Construction of liver-specific KDM1A knockout mice
[0093] Liver-specific KDM1A gene knockout mice were constructed using CRISPR-Cas9 technology. First, CRISPR target sites were designed using an online CRISPR design tool (http: / / crispr.mit.edu).
[0094] sgRNA1 (SEQ ID NO.1): CTAAGTAACTGTGAACTCGG
[0095] sgRNA2(SEQ ID NO.2):ACCAAGACCTGTTACAACCA
[0096] SgRNA3 (SEQ ID NO.3): AACCTCCAATGCCTGGCCAA
[0097] (1) Construction of target plasmid: The primers before and after sgRNA were annealed to form double-stranded DNA, which was then ligated into pAAV U6-TBG-cre and pAAV-U6-TBG-EGFP vectors digested with restriction endonucleases XhoI and NheI, respectively, using T4 DNA ligase. After sequencing, the target plasmids with correct sequencing were selected for subsequent experiments.
[0098] (2) AAV virus packaging: 293T cells were amplified to 60-80 plates in 10cm culture dishes. When the cell density reached 70%-90%, transfection was prepared. Before transfection, the culture medium was replaced with DMEM high-glucose medium containing 2% FBS. Transfection system: The molar ratio of packaging plasmid, helper plasmid pAdDelta, and target plasmid was 1:1:1. The volume of PEImax (1ug / ul) was three times the mass of the total plasmid. The plasmid and PEImax were dissolved separately in physiological saline or serum-free and antibiotic-free DMEM medium, filtered through a 0.22µm filter, gently mixed, and allowed to stand for 15-20 min. The transfection system was added to the culture dish along the sidewall, mixed well, and incubated for 3 days. The two packaged viruses were named AAV8-GFP and AAV8-sgKDM1A-cre, respectively.
[0099] (3) AAV virus collection: After 3 days, collect the culture medium supernatant. Centrifuge the virus supernatant at 700g, 4℃ for 10min. Treat the precipitate together with the cell precipitate. This can increase the virus titer to a certain extent and reduce the workload required for filtration. Filter the supernatant through a 0.22μm filter and place the filtered supernatant in a sterilized wide-mouth bottle. Add 25ml of PEG solution (40% PEG8000: 400g PEG8000, 24g NaCl to 1L ddH2O, sterilize at high temperature and humidity for later use) to every 100ml of supernatant. Add a stir bar, stir at 4℃ for 1h, and then let stand at 4℃ for 3h to achieve complete precipitation, or overnight at 4℃. Centrifuge at 2818g, 4℃ for 15min. Remove the supernatant and resuspend the virus (small particles), and freeze-thaw twice in liquid nitrogen at -37℃. Centrifuge at 3220g, 4℃ for 15min, and remove the precipitate. Add 50 U of nuclease (250 U / μl) to each ml of viral supernatant and incubate at 37°C for 45 min. The viral supernatant can be stored at 4°C overnight for subsequent purification.
[0100] (4) AAV virus concentration: Take the required centrifuge tube and gently add the iodixanol density gradient and sample along the side wall from high density to low density. If the sample is less than 10 ml or there is still empty space in the centrifuge tube after adding the sample, the resuspension can be used to make up the difference. Before ultracentrifugation, balance the centrifuge with a high-precision balance. The balance difference should be within 0.001 g. Ultracentrifuge at 141400 g for 9 h. After centrifugation, collect the virus layer. Remove the centrifuge tube from the ultracentrifuge and harvest the virus with a 2 ml syringe. Add 15 ml of 0.1% Pluronic F68 PBS to the filter membrane of the ultrafiltration tube and let it stand at room temperature for 10 min. Remove the 0.1% Pluronic F68 PBS, add 15 ml of 0.01% Pluronic F68 PBS, centrifuge at 3000 rpm for 5 min at 4°C, and discard the filtrate. Add 15 ml of 0.001% Pluronic F68 + 200 mM NaCl PBS, centrifuge at 3000 rpm for 5 min at 4°C, and discard the filtrate. Add the sample (add buffer to 15 ml if the amount is small), centrifuge at 3500 rpm for 8 min at 4°C, and discard the filtrate. Add buffer to 15 ml, gently blow the filter membrane and bottom on the side walls with a pipette tip, and repeat the centrifugation. After multiple centrifugations, you can continue centrifuging without changing the buffer. Concentrate the sample to at least 500 μl, and blow the buffer on the filter membrane and bottom on the side walls with a pipette tip. The concentrated sample was filtered through a 0.22µm filter after being rinsed with PBS. Residual sample in the filter was then rinsed with a small amount of PBS. The virus was aliquoted into 100-200µl tubes, labeled with the task number, date, volume, and concentration. An additional 20µl was reserved for subsequent titer analysis. The virus can be stored at 4°C for 2 weeks or at -80°C for long-term preservation.
[0101] (5) AAV virus titer determination: Take 5 μL of concentrated virus solution, add 1 μL of RNase-free DNAse, 5 μL of 10x DNAse Buffer, and 39 μL of ddH2O. Mix well and incubate at 37°C for 30 min. Transfer to ice. Add 2.5 μL of 50 mM EDTA, mix well, and incubate at 65°C for 10 min. Dilute the sample sequentially according to the following gradient, and thoroughly mix each time by pipetting (do not vortex). The selection of standards should be based on the elements contained in the sample shuttle plasmid. Mix the qPCR pre-primer and post-primer at a 1:1 ratio, add 1 μL to each well, and then add 9 μL of sample / standard. Detect using the instrument and calculate the virus titer value.
[0102] (6) AAV virus injection via tail vein in mice: AB13 mice were injected via tail vein with either AAV8-GFP or AAV8-sgKDM1A-cre, with each mouse receiving 5 × 10⁻⁶ doses. 11 Six mice were injected with the virus in each group. The knockout effect was assessed at week 4. Western blot results are as follows: Figure 1As shown, this proves that the knockout was successful.
[0103] IV. Detection of liver aspartate aminotransferase (AST), alanine aminotransferase (ALT), triglycerides (TG), total cholesterol (TC), serum alkaline phosphatase (ALP), and low-density lipoprotein (LDL) levels
[0104] After anesthetizing mice, blood was collected through the orbital venous plexus. The blood samples were kept at room temperature for 30 minutes to allow serum to separate, and then centrifuged. Serum was then used to detect the levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT), triglycerides (TG), total cholesterol (TC), alkaline phosphatase (ALP), and low-density lipoprotein (LDL) using a blood biochemistry analyzer.
[0105] V. Pathological Examination
[0106] The main procedures for preparing paraffin-embedded specimen sections are as follows: trimming the liver → preparing the embedding frame → rinsing with running water → dehydration → clearing → embedding → sectioning → spreading → air-drying or baking for later use.
[0107] The main steps of hematoxylin-eosin (H&E) staining, Oil Red O (O) staining, and Sirius Red (PSR) staining used in the embodiments of the present invention are described below:
[0108] The main steps of hematoxylin-eosin (H&E) staining are as follows: take paraffin-embedded specimens, dewax them to water, stain cell nuclei with hematoxylin, stain cytoplasm with eosin, dehydrate and mount the slides, and examine them under a microscope, and acquire and analyze the images.
[0109] The main steps of Oil Red O staining are: after drying the sections, wash them slightly with 50% ethanol → Oil Red O ethanol staining solution → differentiation with 50% ethanol, termination of differentiation with tap water → counterstaining the nuclei with hematoxylin, returning to blue with tap water, and mounting with glycerol gelatin.
[0110] The main steps of Sirius Red (PSR) staining are as follows: take paraffin-embedded specimen sections, dewax them to water, drop Sirius Red staining solution on them, rinse slightly with running water to remove the staining solution from the surface of the sections, stain the cell nuclei with Mayer's hematoxylin staining solution, rinse with running water, and dehydrate and mount the sections.
[0111] Example 2: Effects of liver-specific knockout of KDM1A on non-alcoholic fatty liver disease induced by a high-fat, high-cholesterol diet.
[0112] Control mice and liver-specific KDM1A knockout mice were used. Control mice were injected with AAV8-GFP, and CKO mice were injected with AAV8-sgKDM1A-cre (a total of 24 mice). They were divided into 4 groups: sgRNA-GFP-NC group (6 mice), sgRNA-cre-NC group (6 mice), sgRNA-GFP-HFHC group (6 mice), and sgRNA-cre-HFHC group (6 mice). Mice in the sgRNA-GFP-NC group and gRNA-cre-NC group were fed NC diet for 16 weeks, while mice in the sgRNA-GFP-HFHC group and gRNA-cre-HFHC group were fed HFHC diet for 16 weeks.
[0113] After 16 weeks of rearing, mice were euthanized quickly using cervical dislocation. The mice were immobilized in a supine position, and the fur on their chest and abdomen was moistened with distilled water. Using forceps, the skin in the midline of the abdomen was clamped and cut along the midline towards the head to below the xiphoid process, then towards the tail, exposing the subcutaneous fascia and muscles layer by layer. The abdominal cavity was opened to fully expose all organs. The livers of each group of mice were quickly located and removed, and weighed. The liver weight / body weight and white fat / body weight values were calculated. Hematoxylin-eosin (HE), Sirius red (PSR), and Oil Red O staining were performed. Serum ALP (alkaline phosphatase), TC (total cholesterol), TG (triglycerides), and LDL (low-density lipoprotein) levels were measured in the sgRNA-GFP-HFHC and sgRNA-cre-HFHC groups.
[0114] The results showed that the liver weight, liver weight to body weight ratio, and white fat weight to body weight ratio were significantly smaller in the sgRNA-cre-HFHC group compared to the sgRNA-GFP-HFHC group (see [link to results]). Figure 2 HE staining results showed that, unlike the sgRNA-GFP-HFHC group mice which exhibited steatosis and extensive vacuolation in hepatocytes, the sgRNA-cre-HFHC group mice showed significantly milder morphological changes in hepatocytes, indicating that KDM1A knockout can significantly inhibit steatosis (see...). Figure 3 PSR staining results showed that the Sirius red positive area in the liver of mice in the sgRNA-cre-HFHC group was significantly less than that in mice in the sgRNA-GFP-HFHC group, indicating that KDM1A knockout can significantly inhibit the production of hepatic collagen fibers and inhibit liver fibrosis (see...). Figure 4 Oil Red O staining results showed that lipid deposition and lipid droplets in the liver tissue of mice in the sgRNA-cre-HFHC group were significantly reduced compared with those in the sgRNA-GFP-HFHC group (see...). Figure 5This indicates that KDM1A knockout can significantly inhibit lipid accumulation. Blood tests revealed that the levels of total cholesterol (TC), ALP (serum alkaline phosphatase), and LDL (low-density lipoprotein) in the sgRNA-cre-HFHC group were significantly lower than those in the sgRNA-GFP-HFHC group (see...). Figure 6 This further demonstrates that KDM1A gene knockout can inhibit the progression of fatty liver disease and protect the liver.
[0115] These results demonstrate that the progression of non-alcoholic steatohepatitis was significantly suppressed in KDM1A gene knockout mice.
[0116] Example 3: Effects of KDM1A inhibitor DDP-38003 on non-alcoholic fatty liver disease
[0117] Eight-week-old male C57 mice were randomly divided into a Vehicle group (using a DMSO:Solutol:PEG400:water formula of 5:10:20:65 (v:v:v:v) and a DDP-38003 group (using pharmaceutical-grade DDP-38003 trihydrochloride). Both groups were fed a high-fat, high-cholesterol TP26304 diet. The mice were fed a HFHC diet, specifically the HFHC+Vehicle group and the HFHC+DDP-38003 group. Starting at 12 weeks of age, the DDP-38003 group was administered DDP-38003 trihydrochloride 2.8 mg / kg via gavage (once daily), while the Vehicle group was administered the same volume of Vehicle via gavage. Mouse weight was measured at 20 and 24 weeks of age, and liver tissue was collected at the end of week 24. A portion of the liver tissue was then fixed in formaldehyde solution or embedded in OCT frozen section embedding medium for pathological analysis.
[0118] The results showed that at 24 weeks, the body weight and liver weight of the HFHC+DDP-38003 group were significantly lower than those of the Vehicle-HFHC control group, and the calculated liver weight to body weight ratio was also significantly lower in the HFHC+Vehicle- (see...). Figure 7 HE staining results showed that, unlike the fatty degeneration and extensive vacuolation of hepatocytes in the HFHC-Vehicle group mice, the morphological changes in hepatocytes in the HFHC+DDP-38003 group mice were significantly milder (see...). Figure 8 Oil Red O staining results showed that the number of lipid droplets in liver cells of mice in the HFHC+DDP-38003 group was significantly reduced compared with that in the Vehicle-HFHC group (see...). Figure 9PSR staining results showed that liver fibrosis was significantly reduced in the HFHC+DDP-38003 group compared with that in the Vehicle-HFHC group (see...). Figure 10 The above results indicate that DDP-38003 can significantly inhibit hepatic lipid deposition, hepatic steatosis, hepatic collagen fiber production, and inhibit hepatic fibrosis, thus inhibiting the progression of non-alcoholic fatty liver disease.
[0119] This application describes several embodiments, but these descriptions are exemplary and not restrictive, and it will be apparent to those skilled in the art that there are many more embodiments and implementations within the scope of the embodiments described herein.
Claims
1. The application of substances that reduce the content or activity of KDM1A in the preparation of products for treating non-alcoholic fatty liver disease, characterized in that, The non-alcoholic fatty liver disease is selected from at least one of non-alcoholic steatohepatitis and liver fibrosis; When non-alcoholic fatty liver disease is non-alcoholic steatohepatitis, the substance is a CRISPR-Cas9 gene knockout system targeting the KDM1A gene, and the vector used in the CRISPR-Cas9 gene knockout system is a pAAV U6-TBG-cre vector that has been digested with restriction endonucleases XhoI and NheI, respectively. When non-alcoholic fatty liver disease is liver fibrosis, the substance is DDP-38003 or a CRISPR-Cas9 gene knockout system targeting the KDM1A gene. The CRISPR-Cas9 gene knockout system uses a pAAV U6-TBG-cre vector that has been digested with restriction endonucleases XhoI and NheI, respectively. The gRNA target sequences used in the CRISPR-Cas9 gene knockout system are as follows: sgRNA1 sequence as shown in SEQ ID NO. 1; sgRNA2 sequence as shown in SEQ ID NO. 2; and sgRNA3 sequence as shown in SEQ ID NO.
3.
2. The application according to claim 1, characterized in that, The substance is a recombinant vector containing the CRISPR-Cas9 gene knockout system targeting the KDM1A gene.
3. The application according to claim 2, characterized in that, The method for preparing the recombinant vector includes the following steps: (1) Design gRNA target sequences for genes to be knocked out in the CRISPR-Cas9 system; (2) Construction of target plasmid: The primers before and after sgRNA were annealed to form double-stranded DNA, and then ligated into the pAAV U6-TBG-cre vector digested with restriction endonucleases XhoI and NheI respectively using T4 DNA ligase. After sequencing, the target plasmid with the correct sequence was selected for subsequent experiments. (3) AAV virus packaging: 293T cells were amplified to 60-80 cells in 10cm culture dishes. When the cell density was 70%-90%, transfection was prepared. Before transfection, the culture medium was replaced with DMEM high-glucose medium containing 2% FBS. The transfection system was as follows: the molar ratio of each plasmid was 1:1:
1. The volume of PEImax 1ug / ul was three times the mass of the total plasmid. The plasmid and PEImax were dissolved in physiological saline or DMEM medium without serum or antibiotics. After filtering with a 0.22um filter, the mixture was gently mixed and allowed to stand for 15-20min. The transfection system was added to the culture dish along the side wall, mixed well, and then placed in an incubator for incubation. The gRNA target sequence mentioned in step (1) is: The sgRNA1 sequence is shown in SEQ ID NO. 1; The sgRNA2 sequence is shown in SEQ ID NO. 2; The SgRNA3 sequence is shown in SEQ ID NO.
3.
4. The application according to any one of claims 1 to 3, characterized in that: The product is a drug, and the drug is in the form of an oral dosage form or an injectable dosage form.
Citation Information
Patent Citations
DD38003A