An acyltransferase easC molecular marker, primer, kit and application for identifying Colletotrichum fructicola
By comparing the entire genome sequence of the anthrax species and screening out the specific coding sequence of the anthrax species, selecting the acyltransferase easC as a molecular marker, and designing specific primers for PCR detection, solving the problem of identification of the anthrax species in the prior art, achieving high specificity and high sensitivity detection effects.
Patent Information
- Application Number
- CN202211552873.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-06
- Publication Date
- 2025-06-03
- Estimated Expiration
- 2042-12-06
AI Technical Summary
The prior art lacks simple and effective identification, detection and quantitative methods for fruit anthrax bacteria, which leads to difficulties in diagnosis and management of oleifera anthrax.
By comparing the whole genome sequences of the anthrax species isolated on the anthrax spots of the oleifera, the specific coding sequence of the anthrax species of fruit was screened out, and acyltransferase easC was selected as a molecular marker, and specific primers were designed for PCR detection.
It has achieved high specificity and high sensitivity to distinguish between anthrax and other related fungi, provided an accurate identification strategy for anthrax and anthrax of anthrax of athrax of athrax of athrax of athrax of aurichiota and improved detection sensitivity.
Smart Images
Figure CN117265152B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of plant anthracnose detection, and specifically relates to an acyltransferase easC molecular marker, a primer, a kit and an application thereof for identifying fruit anthracnose fungi. Background Art
[0002] Camellia oleifera is an evergreen shrub or tree of the family Theaceae. It is a woody edible oil tree species native to China with a long history of cultivation. It is one of the four major woody oil plants in the world, along with olive, oil palm, and coconut. Camellia oil squeezed from camellia seeds is rich in polyphenols and a variety of unsaturated fatty acids. As an edible oil, it has health benefits such as protecting cardiovascular and cerebrovascular vessels and preventing arteriosclerosis. In addition, recent studies have shown that camellia oil also has the effects of preventing melanin formation and anti-oxidation. It can be widely used as a functional oil in the health, food, and cosmetics manufacturing industries (Chaikul, Sripisut, Chanpirom, Sathirachawan, & Ditthawuthikul, 2017; Xiao et al., 2017). Camellia oleifera has strong adaptability and a wide range of growth. In addition to the main production areas south of the Yangtze River and the Qinling Mountains, it is also distributed in some areas north of the Yangtze River. Camellia oleifera tolerates poor and acidic soils, is easy to plant, and has low maintenance costs. Therefore, the use of sloping forest land where planting is difficult can not only beautify the environment, maintain water and soil, conserve water resources, and regulate the climate, but also has important significance for increasing the output of oil crops in my country and protecting the safety of edible oil ("If you want to turn barren mountains into a treasury, plant camellia oleifera," 2020; Zuo Jing & Zhu Meixuan, 2020). However, the production of camellia oleifera and the quality of camellia oil have long been severely restricted by diseases such as camellia oleifera root rot, white rot, anthracnose, soft rot, tea pod disease, leaf blight, and sooty mold. As the area of camellia oleifera cultivation expands year by year, the problem of camellia oleifera diseases has become increasingly prominent.
[0003] Camellia oleifera anthracnose is a major leaf and fruit disease that seriously threatens the production of camellia oleifera, causing symptoms such as fruit drop, bud drop, and branch dieback. Camellia oleifera production in various regions is reduced by 10%-30% due to the disease throughout the year. In severely affected areas, the reduction in production can exceed 50%, causing serious economic losses (Liu Xiaoyu et al., 2018). Through the isolation and identification of pathogens from the fruits and leaves of camellia oleifera anthracnose plants from different origins, four species of the genus Colletotrichum, including Colletotrichum camelliae, Colletotrichum gloeosporioides, Colletotrichum siamense and Colletotrichum fructicola, and plant disease-related fungi of three genera, including Neopestalotiopsis, Pestalotiopsis and Alternaria, have been isolated. Further pathogenicity tests have identified Colletotrichum fructicola as the main pathogen of camellia oleifera anthracnose (Wang et al., 2020). The four anthracnose fungi related to oil-tea anthracnose isolated are closely related and all belong to the Colletotrichum gloeosporioides species complex. At present, there is a lack of simple and effective methods for the identification, detection and quantification of fruit anthracnose fungi. The only way to identify oil-tea anthracnose fungi is through conventional pathogen isolation, purification, and combined with sequencing and homologous sequence comparison methods. Summary of the invention
[0004] The present invention screened 965 Colletotrichum fructicola-specific coding sequences from 16,731 coding sequences in the genome of Colletotrichum oleifera by comparing the whole genome sequences of four Colletotrichum species, namely Colletotrichum camelliae, Colletotrichum gloeosporioides, Colletotrichum siamense and Colletotrichum fructicola, which were isolated from the anthracnose lesions of oil tea. Figure 1 ). Based on the sequence annotation and function prediction provided by NCBI, 115 gene coding sequences with important functions were screened, of which 22 gene sequences without introns were used as candidate molecular markers. Finally, one of them was selected as the acyltransferase easC molecular marker for identifying fruit anthracnose fungi.
[0005] The primary purpose of the present invention is to provide an acyltransferase easC molecular marker for identifying fruit anthracnose fungi, which is a segment of the acyltransferase easC of the gene number CGGC5_v004178, and the specific sequence is:
[0006] >ANPB02000002.1_cds_KAF4488516.1_4178
[0007] ATGGGGTCTTTGCCAGAGGCTTATACCTTCCAGGGGATTCCGCAACTTACCCCGTTGGAGCAGATCAGTCCTCGGGGATGGGTGC
[0008] GGTACCTGTTTCCATTCCAACTCGTAGAGGACTACGATCCTGAAGCTATCACCGATATCTTTCGCAGGAGCCTCCAGGCTACTAA
[0009] GAGCCGTTTCCCAACATTGGCTTGCGAAGCTCTTCCCGACCCTGACGCGAGACAAGCGAACGCCCTAAAGCTTCAGAGGATCACG
[0010] GACAACGAGATTGAGCCTGTCATTATCAACGATCTGCGCCAGTCGTCAAACTTCACAAGCTCGTTTACCGACCTCAAGTCCAAGC
[0011] ACTTCCCCGTATCGAGCTTCCCAGCCGAAGTCTTCACGCGCTGCCCAATTTGGCCTGCTCCTGGGCAGCGGGTACCTATCACAAT
[0012] TGTGCAAGCTAATTTCATCCGCGGGGGCTTGATCCTAAACTGGAATCTTTTCCATCTGGTCGGTGACGGGCAGGCATTCTACAAC
[0013] TGGATTCGGGTTTGGGCTGAAGAAACTCGCCGAGCTCAAGGCCTTGACATTCCAGATCCGGTTCATTATCCCGAACCCATCTACG
[0014] CGGACCGCCAGATTGCACACAAATCGCCGCAGACCCTTCCAAAAGGCAAGTCTGGGCGTCTTACAGACCATCCCGAGTACACTAC
[0015] TGTCACAGATCCTGCGACGCAGCTTGCCAAGATCACAACGACGGACGGCCACGTGGGACAGATCTTCTACCTATCAAAAGATTCG
[0016] TTGCAACGGCTGAAGCAAGATGCTCAGCCTCAGACAGACGACGGATCTTATGTGTCTACCAATGACGCGCTCTCTGCATTGATTT
[0017] GGCGAAGCATCATGGCAGCTCAGTTCGACATAACTCAGCTAGACGGCAGCGAAAGGTCCGTTTTCAACATTGCCATCGACGGTAG
[0018] AGGACGAAGTCAGCCGCCTATTCATCCGGAGGCCATGGGAAGCTTTCTTGGCTTCATCCAAGTCGAACTTCCCATCAAGAAGATT
[0019] CTTGAGGCCGACAACCTCTCGGACCTGTCCCTATTGATCCGCAAAGCCATTATTGCAATGGACAAGGATTTCTCAGGGTCGTTCA
[0020] TCAATGACGTCGTGCAGCTGGTGAACAACCAGGACGACCTCGGTGCGGTCATAACAACATCGTTCTTGGATGTTCCTGGTCGTAA
[0021] CTGTGCACAAACATCATGGGAGAAGTTCAAAATGTACGATCTTGATTGGGGCCACGCGCTGGGTGGTAACATTGCAGCTATCCGC
[0022] TCACCTAGCTGTGGCATCCTAAATGGTATGCAGATCATGTATCCTCAACACCCTGACGGTGGTCGTGAGATGTTGGTCGGTATCTATGAGAATTGTTTGGAGAAGCTTTGCAACGATCCGGTCTGGACGAGGTATGCGGAGCGTCGATAG, see SEQ NO.1.
[0023] The second object of the present invention is to provide amplification primers designed based on the specific sequences of the molecular markers described above.
[0024] The primers described above preferably have the following primer sequences:
[0025] easC-F: CTTCCCCGTATCGAGCTTCC; see SEQ NO.2;
[0026] easC-R: TTGAGCTCGGCGAGTTTCTT; see SEQ NO.3.
[0027] The third object of the present invention is to provide the application of the primers described above in the identification of Colletotrichum fructicola. The specific application steps are as follows:
[0028] (1) Extract the total DNA of the fungus or the fungus / host plant mixed material as a template;
[0029] (2) Use the primers for PCR amplification:
[0030] (3) Detect the PCR products by agarose gel electrophoresis and read the bands using a gel imaging system;
[0031] (4) According to the products obtained in step (3), if a specific band with a length of 208bp appears, it indicates that Colletotrichum fructicola is present in the test sample; if there is no specific amplification with a length of 208bp, it means that Colletotrichum fructicola does not exist in the sample.
[0032] Furthermore, the PCR reaction system: the total volume is 20 μl, and the specific components are as follows: PCR is carried out in a 20 μL reaction system, which consists of 1 μl of genomic DNA at 20 ng / μl, 10 μl of superTaqPCR-Mix, and 1 μl each of 10 μmol forward and reverse primers.
[0033] Furthermore, the PCR reaction amplification program is: after pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 15 seconds, annealing temperature at 69°C for 10 seconds, extension temperature at 72°C for 10 seconds, for 35 cycles; then final extension at 72°C for 5 minutes; the reaction is terminated.
[0034] The fourth object of the present invention is to provide a kit for identifying Colletotrichum fructicola, including PCR reagents and the primers described above.
[0035] Advantages of the present invention:
[0036] The present invention can distinguish four species of the genus Colletotrichum, namely Colletotrichum camelliae, Colletotrichum gloeosporioides, Colletotrichum siamense, and Colletotrichum fructicola, and plant disease-related fungi of three genera, namely Neopestalotiopsis, Pestalotiopsis, and Alternaria, with high specificity and sensitivity. In particular, the four Colletotrichum species related to camellia anthracnose are very closely related and all belong to the Colletotrichum gloeosporioides species complex of the genus Colletotrichum, making them difficult to distinguish. The present invention provides a new strategy for the accurate identification of Colletotrichum fructicola infecting camellia fruits.
[0037] Meanwhile, the present invention has advantages in detection sensitivity compared with the same type of detection methods or probes, and can be used for the detection and identification of Colletotrichum fructicola with high sensitivity. Brief Description of the Drawings
[0038] Figure 1 : Alignment of the genomic gene coding sequences of Colletotrichum fungi related to camellia anthracnose;
[0039] Figure 2 : The intron-free region of the acyltransferase easC-encoding gene CGGC5_v004178 of Colletotrichum fructicola;
[0040] Figure 3 : The specific primers of the acyltransferase easC-encoding gene of Colletotrichum fructicola have specific amplification in Colletotrichum fructicola. DW is Double Distilled Water, and double distilled water is used as the PCR amplification template as a negative control to prove the specificity of the amplification result.
[0041] Figure 4 : Detection sensitivity of the specific primers of the acyltransferase easC-encoding gene of Colletotrichum fructicola to the spores of Colletotrichum fructicola;
[0042] Figure 5 : Detection sensitivity of the specific primers of the acyltransferase easC-encoding gene of Colletotrichum fructicola to Colletotrichum fructicola in camellia leaf samples.
[0043] mock is a blank control to prove no non-specific amplification; TUB is camellia Bata-tublin, which is a plant genomic internal reference to prove that the four gradient-diluted mixed Colletotrichum fructicola and camellia genomic DNA samples contain equal amounts of camellia genomic DNA. Detailed Description of the Embodiments
[0044] The following embodiments are intended to further illustrate the present invention rather than limit the present invention.
[0045] Embodiment: In order to specifically identify Colletotrichum fructicola, the present invention uses comparative genomics methods to find specific sequences that distinguish Colletotrichum fructicola from other fungi as molecular markers. By comparing the whole-genome sequences of four Colletotrichum species, namely Colletotrichum camelliae, Colletotrichum gloeosporioides, Colletotrichum siamense, and Colletotrichum fructicola, isolated from oil-tea camellia anthracnose lesions, 965 specific coding sequences of Colletotrichum fructicola were screened from 16,731 coding sequences in the Colletotrichum fructicola genome ( Figure 1 ). According to the sequence annotation and function prediction provided by NCBI, 115 gene coding sequences with important functions were screened, and 22 intronless gene sequences (Table 1) were used as candidate molecular markers.
[0046] Table 1 22 specific intronless genes of Colletotrichum fructicola obtained by comparative genomic analysis
[0047]
[0048] The online primer design tool blast primer of NCBI was used to design primers for the above 22 intronless specific gene coding sequences of Colletotrichum fructicola. Using the genomic DNA of Colletotrichum fructicola, Colletotrichum camelliae, Colletotrichum gloeosporioides, and Colletotrichum siamense as templates, the amplification specificity of the designed primers was detected by ordinary PCR. Among them, the specific primer designed for the acyltransferase easC of Colletotrichum fructicola had a specific amplification product only in Colletotrichum fructicola and was used for subsequent experiments.
[0049] Specific primers were designed for the screened candidate molecular markers of Colletotrichum fructicola, and the amplification specificity of the primers in four species of the genus Colletotrichum, namely Colletotrichum fructicola, Colletotrichum camelliae, Colletotrichum gloeosporioides, and Colletotrichum siamense, and three fungal genera related to oil-tea camellia anthracnose, namely Neopestalotiopsis, Pestalotiopsis, and Alternaria, was tested (Figure 3 ) Using the genomic DNA of the above-mentioned fungus as a template, through a specific detection experiment of ordinary PCR amplification, it was found that the primers designed for the acyltransferase easC encoding gene (number CGGC5_v004178, Figure 2 ) had specific amplification bands only in Colletotrichum fructicola, and no bands in other fungi related to anthracnose.
[0050] Using the genomic DNA of Colletotrichum fructicola conidia diluted in gradient as a template, ordinary PCR was carried out with the specific primers of the acyltransferase easC encoding gene of Colletotrichum fructicola of the present invention to test the detection sensitivity of the primers. The results are shown in Figure 4 , and the number of Colletotrichum fructicola conidia in each PCR reaction system was 1 to 10 5 . The results showed that the detection sensitivity of the specific primers of the acyltransferase easC encoding gene of Colletotrichum fructicola in ordinary PCR could reach 10 spores / μL sample or 5 fg genomic DNA sample.
[0051] The genomic DNA of Colletotrichum fructicola conidia diluted in gradient was mixed with the genomic DNA of Camellia oleifera leaves respectively, and using the mixed DNA as a template, ordinary PCR was carried out with the specific primers of the acyltransferase easC encoding gene of Colletotrichum fructicola of the present invention to test the detection sensitivity of the primers in the mixed sample of Colletotrichum fructicola and Camellia oleifera. The results are shown in Figure 5 , and the number of Colletotrichum fructicola conidia in each PCR reaction system was 10 2 to 10 5 . The results showed that the detection sensitivity of the specific primers of the acyltransferase easC encoding gene of Colletotrichum fructicola to the primers in the mixed sample of Colletotrichum fructicola and Camellia oleifera could reach 10 2 spores / μL sample or 50 fg genomic DNA sample.
Claims
1. Use of primers in the identification of Colletotrichum fructicola, characterized in that, for differentiating Colletotrichum camelliae , Colletotrichum gloeosporioides , Colletotrichum siamense Three species of the genus Colletotrichum and Neopestalotiopsis , Pestalotiopsis and Alternaria; The designed primer sequences are as follows: easC-F: CTTCCCCGTATCGAGCTTCC; easC-R: TTGAGCTCGGCGAGTTTCTT.
2. The use according to claim 1, characterized in that, (1) Extract the total DNA of the fungus or the fungus / host plant mixed material as a template; (2) Use the primers for PCR amplification: (3) Detect the PCR products by agarose gel electrophoresis, and read the bands using a gel imaging system; (4) According to the products obtained in step (3), if a specific band with a length of 208 bp appears, it indicates that Colletotrichum fructicola is present in the test sample; if there is no specific amplification with a length of 208 bp, it means that Colletotrichum fructicola is not present in the sample.
3. The use according to claim 2, characterized in that , the PCR reaction system: the total volume is 20 μl, and the specific components are as follows: PCR is carried out in a 20 μL reaction system, which consists of 1 μl of genomic DNA at 20 ng / μl, 10 μl of superTaqPCR-Mix, and 1 μl each of 10 μmol forward and reverse primers.
4. The use according to claim 2, characterized in that , The PCR reaction amplification program is: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 15 seconds, annealing temperature at 69°C for 10 seconds, extension temperature at 72°C for 10 seconds, 35 cycles; then final extension at 72°C for 5 minutes; the reaction is terminated.