Saccharomyces cerevisiae and a production method thereof for brewing refreshing yellow rice wine

Abstract

The present disclosure provides a kind of saccharomyces cerevisiae and its production method for brewing yellow rice wine, it is related to the field of microbial fermentation.The present application provides a kind of saccharomyces cerevisiae ZLCY-39, with physiological characteristics of strong fermentation capacity, high yield of wine, low yield of acid, strong acid and alcohol tolerance.Saccharomyces cerevisiae ZLCY-39 is used for brewing refreshing type yellow rice wine, with the advantages of high yield of phenylethanol, low yield of higher alcohol, high yield of total ester, strong activity, not easy to degrade.The yellow rice wine obtained by fermentation has good taste and flavor, and is not easy to "get high".At the same time, due to the acid and alcohol tolerance characteristics and high activity of saccharomyces cerevisiae ZLCY-39, semi-continuous production method can be realized, the fermentation cycle can be shortened by 25%, the equipment utilization rate is improved, and the production cost is reduced.

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation, specifically to a brewing yeast and its application and production method in brewing rice wine, particularly for brewing a light and refreshing type of rice wine. Background Technology

[0002] Yellow rice wine is one of the world's three most famous fermented wines and a distinctive traditional fermented alcoholic beverage in my country. Light-flavored yellow rice wine is made primarily from rice, millet, corn, sorghum, wheat, and water. The process involves steaming, adding yeast and / or some enzyme preparations, using yeast as the saccharification and fermentation agent, followed by saccharification, fermentation, pressing, filtering, heating (to sterilize), aging, and blending. The brewing process is generally an open-air, batch fermentation method.

[0003] Semi-continuous fermentation, also known as semi-continuous culture, repeated batch culture, or liquid-change culture, refers to a fermentation method in which a portion of the fermentation broth containing the product is periodically released from a batch culture, and then the same volume of fresh culture medium is added back in. During semi-continuous fermentation, the culture conditions of the reaction system with the added nutrients are the same as those of batch culture, and the total volume of the culture medium in the reactor remains essentially constant. Semi-continuous fermentation can shorten the fermentation cycle, reduce production costs, and improve production efficiency; however, the microorganisms are easily affected by metabolic products during fermentation, leading to aging and loss of fermentation activity, which limits the use of semi-continuous processes in brewing production.

[0004] Yeast plays a crucial role in the fermentation of light-flavored rice wine, serving as a key functional microorganism for alcohol production and aroma development, and significantly influencing its quality. Light-flavored rice wine is rich in nutrients, with key physicochemical indicators including alcohol content, total acid, total esters, amino acid nitrogen, and higher alcohols. Appropriately increasing the alcohol content, decreasing the total acid content, increasing the total ester content, and raising the proportion of phenylethanol in higher alcohols can promote the harmony of light-flavored rice wine, improve its taste and flavor, and reduce the adverse effects of "headache" associated with it. Summary of the Invention

[0005] This invention provides a brewing yeast ZLCY-39, which has the physiological characteristics of strong fermentation ability, high alcohol production, low acid production, and strong acid and alcohol resistance.

[0006] The aforementioned *Saccharomyces cerevisiae* ZLCY-39 possesses the 26S rRNA sequence shown in SEQ ID NO. 1. It was deposited on September 4, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO. 28346.

[0007] The aforementioned brewing yeast ZLCY-39 was screened from the low-temperature Daqu (a type of starter culture) of Shanxi aged vinegar. It is a strain with excellent fermentation performance for refreshing Shaoxing wine, and this strain has the following physiological characteristics:

[0008] (1) High alcohol production characteristics: In YPD medium, at a temperature of 28-30℃, shake culture for 48h, the alcohol content was measured. The alcohol content of brewing yeast ZLCY-39 was as high as 13.42%vol, while the alcohol content of commercially available brewing yeast was 9.22%vol.

[0009] (2) High alcohol tolerance: ZLCY-39 strain can still grow when the concentration of anhydrous ethanol in YPD medium is 18%, while the growth of commercially available brewing yeast strains is completely inhibited.

[0010] (3) Low acid production characteristics: In YPD medium, after static culture at 28-30℃ for 48h, the acidity was measured. The acid production of ZLCY-39 strain reached 0.29g / 100mL, while the acid production of commercially available brewer's yeast was 0.47g / 100mL.

[0011] (4) High acid resistance: When the pH of YPD medium is 3.5, the ZLCY-39 strain grows well, while the growth of commercially available yeast is completely inhibited.

[0012] In another aspect, the present invention provides an inoculum comprising Saccharomyces cerevisiae ZLCY-39. The preparation method includes:

[0013] (1) Activated strain: The frozen-preserved Saccharomyces cerevisiae ZLCY-39 strain was activated, purified by plate, and cultured by secondary plate purification.

[0014] (2) Preparation of seed culture: The secondary plate bacteria were inoculated into 10 mL of liquid culture medium and activated to form primary seed culture.

[0015] (3) Secondary seed culture: Inoculate the primary seed culture into 100 mL of culture medium at an inoculation rate of 2% and activate it to form secondary seed culture.

[0016] (4) Scale-up culture: Scale-up culture was carried out using a pre-fermentation tank until the concentration of Saccharomyces cerevisiae ZLCY-39 in the culture solution reached 1×10⁻⁶. 8 Fermentation should be stopped when the number of viable cells (cfu / mL) exceeds a certain level.

[0017] (5) Preparation of bacterial culture medium: Centrifuge the expanded bacterial culture at 5000-10000 rpm for 20 min, remove the supernatant, and add a protective agent (skim milk + trehalose) at a ratio of bacterial cells to protective agent of 1:3 under sterile conditions until the cell concentration is not less than 1×10⁻⁶. 7 At cfu / mL, pre-freeze at -80℃ for 3 hours. After pre-freezing, freeze using a vacuum freeze dryer to obtain solid bacterial agent.

[0018] On another front, the present invention provides an application of brewing yeast ZLCY-39 in the production of rice wine, especially a light-flavored rice wine.

[0019] In another aspect, the present invention provides a method for producing a refreshing type of rice wine, comprising the following steps:

[0020] (1) Preparation of seed culture: Inoculate any of the aforementioned Saccharomyces cerevisiae ZLCY-39 into liquid culture medium to obtain Saccharomyces cerevisiae ZLCY-39 seed culture.

[0021] Further, step (1) can be performed by inoculating any of the aforementioned Saccharomyces cerevisiae ZLCY-39 into a shake culture at 28-30℃, controlling the rotation speed at 120-180 rpm / min, and culturing for 20-24 hours to obtain a Saccharomyces cerevisiae ZLCY-39 seed culture. The viable count of the Saccharomyces cerevisiae ZLCY-39 seed culture is 1 x 10⁻⁶. 5 -1x10 9 cfu / ml.

[0022] (2) Inoculation: Fermentation raw materials are put into the pre-fermentation tank. The fermentation raw materials are obtained by mixing grains and water at a material-to-water ratio of 1:1-4 and heating to 80-100℃. After saccharification, the fermentation raw materials are inoculated with brewer's yeast ZLCY-39 seed liquid to start fermentation.

[0023] Furthermore, the grains in step (2) include broken rice, etc.

[0024] In step (2), 0.1% of the grain mass of brewing yeast ZLCY-39 seed liquid is inoculated into the pre-fermentation tank.

[0025] Step (2) can be as follows: Grains and water are added to the fermentation tank at a ratio of 1:1-4, mixed, heated to 80-100℃, liquefied at 95℃ for 30 minutes, cooled and maintained at 28-30℃ to obtain the fermentation substrate, and then 5% of the grain mass of wheat koji is added for saccharification. At the same time as adding wheat koji, 0.1% of the grain mass of brewing yeast ZLCY-39 seed liquid is inoculated to start fermentation.

[0026] Step (2) can also be as follows: mix grains and water at a material-to-water ratio of 1:1-4, heat to 80-100℃, add amylase, keep warm for 20-40 minutes, add saccharifying enzyme, liquefy at 95℃ for 30 minutes, and cool to 28-30℃ to obtain the fermentation substrate. Specifically, put grains and water into a pre-fermentation tank at a material-to-water ratio of 1:1-4, mix, heat to 80-100℃, add amylase at 0.054% of the grain mass, keep warm for 20-40 minutes, add saccharifying enzyme at 0.107% of the grain mass for saccharification, liquefy at 95℃ for 30 minutes, and cool to 28-30℃ to obtain the fermentation substrate; then inoculate with 0.1% of the grain mass of brewing yeast ZLCY-39 seed liquid to start fermentation.

[0027] (3) Pre-fermentation: The pre-fermentation tank is opened for pre-fermentation at a temperature of 28℃-30℃ for 3 days;

[0028] (4) Discharge and replenishment: After the pre-fermentation is completed, 1 / 3 of the volume of the fermentation liquid in the pre-fermentation tank is separated for the post-fermentation; at the same time, 1 / 3 of the volume of the fermentation raw material prepared in step (2) is replenished to the pre-fermentation tank, and the pre-fermentation process in step (3) continues.

[0029] (5) Post-fermentation: Measure the alcohol content of the 1 / 3 volume of fermentation liquid separated in step (4). When the alcohol content is 14-15.4% vol, it flows into the post-fermentation tank for post-fermentation. Seal the tank for fermentation at 28℃-30℃. After 5 days of fermentation, transfer to 15℃ for 7 days of fermentation.

[0030] (6) Repeat steps (4)-(5) above;

[0031] (7) When the alcohol content of 1 / 3 of the fermentation liquid separated in step (4) is less than 14% vol, the remaining 2 / 3 of the fermentation liquid is flowed into the post-fermentation tank and combined for the last post-fermentation.

[0032] (8) Take the fermentation liquid obtained from the post-fermentation.

[0033] Furthermore, step (6) can be repeated 1-5 times; furthermore, step (6) can be repeated 4-5 times.

[0034] Further, the alcohol content of the 1 / 3 volume of fermentation liquid separated in step (4) is measured. When the alcohol content is lower than 14% vol, the remaining 2 / 3 of the fermentation liquid in the pre-fermentation tank is flowed into the post-fermentation tank and combined for the last post-fermentation.

[0035] Further, the alcohol content of the 1 / 3 volume of fermentation liquid separated in step (4) is measured. If the alcohol content is 14-15.4% vol, it is flowed into the post-fermentation tank for post-fermentation.

[0036] Furthermore, during the 3rd or 4th pre-fermentation (repeated step (6) to the 3rd or 4th time), 1%-2% of wheat koji is added to the fermentation raw material described in step (2).

[0037] Further, the fermented liquid obtained after fermentation in step (5) is pressed, filtered, sterilized, and bottled to obtain the rice wine product.

[0038] In another aspect, the present invention also provides the application of brewing yeast ZLCY-39 in the preparation of vinegar, baijiu and cooking wine.

[0039] The technical solution of this invention has the following advantages:

[0040] (1) The brewing yeast obtained by the present invention has high alcohol production, low acid production, and strong acid and alcohol resistance. When the brewing yeast ZLCY-39 is used in the production of light-flavored rice wine, it increases the total ester content and alcohol content of rice wine, reduces the acidity of rice wine, increases the proportion of phenylethanol in higher alcohols, significantly improves the taste and flavor of rice wine, and does not cause adverse reactions such as headache or nausea.

[0041] (2) The ZLCY-39 strain provided by this invention has high activity, as well as high alcohol tolerance and high pH tolerance, and can still survive under high alcohol content and low acidity. The fermentation process of light-flavored rice wine has little impact on the activity of the strain, and the strain can be reused, up to 4 times, realizing the semi-continuous production of light-flavored rice wine. In the semi-continuous production process of light-flavored rice wine, the alcohol content of the fermentation liquid separated each time can reach 14-15.4% vol. It can carry out 4 consecutive fermentations, which reduces the amount of koji used by 30%-40% and shortens the fermentation cycle by 25% compared with 1 fermentation, improves equipment utilization and reduces production costs. At the same time, in the process of reusing the strain to brew rice wine in semi-continuous production, brewing yeast is still the dominant strain, accounting for 95% of all strains, and plays the main role.

[0042] (3) The yeast strains obtained by screening in this invention can be used to produce products fermented with Saccharomyces cerevisiae strains as fermenting agents or main fermenting agents, including but not limited to rice wine, cooking wine, vinegar, and baijiu, and have broad application prospects. Attached Figure Description

[0043] Figure 1 The graph shows the comparison of β-phenylethanol content in YPD fermentation broth of strains obtained by screening in the embodiments of the present invention. a shows strains 1-25; b shows strains 26-50.

[0044] Figure 2 The diagram shows the alcohol production capacity characteristics of the strains obtained by screening in the embodiments of the present invention. a shows strains 1-25; b shows strains 26-50.

[0045] Figure 3 The colony morphology of the high-phenylethanol-producing yeast strain obtained by screening in the embodiments of the present invention is shown.

[0046] Figure 4 This is a microscopic image of the cell morphology of the high-phenylethanol-producing yeast strain obtained through screening in an embodiment of the present invention.

[0047] Figure 5 This is an electrophoresis result of PCR identification of the Saccharomyces cerevisiae strain described in an embodiment of the present invention.

[0048] Figure 6 This is a phylogenetic tree constructed based on the 26S rRNA sequence and the Neighbor-Joining method for the *Saccharomyces cerevisiae* strain described in the embodiments of the present invention.

[0049] Figure 7 This is a graph showing the alcohol tolerance results of the Saccharomyces cerevisiae ZLCY-39 strain described in this embodiment of the invention. Figure 8 This is a graph showing the wine production characteristics of the ZLCY-39 strain of brewing yeast described in this embodiment of the invention.

[0050] Figure 9 The diagram shows the acid production characteristics of the Saccharomyces cerevisiae ZLCY-39 strain described in this embodiment of the invention.

[0051] Figure 10 This is a graph showing the pH tolerance results of the Saccharomyces cerevisiae ZLCY-39 strain described in this embodiment of the invention.

[0052] Figure 11 The growth curve of the Saccharomyces cerevisiae ZLCY-39 strain described in this embodiment of the invention is shown.

[0053] Figure 12 This is a diagram showing the repeatability results of the Saccharomyces cerevisiae ZLCY-39 strain described in the embodiments of the present invention. Detailed Implementation

[0054] The following embodiments are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the protection scope of the present invention.

[0055] Example 1: Isolation and screening of bacterial strains from Daqu (a type of starter culture) used in the brewing of Shanxi aged vinegar.

[0056] (1) Strains Isolation

[0057] Samples of Daqu (a type of starter culture) used in the brewing of Shanxi aged vinegar were pulverized, and strains were isolated and screened using the dilution plating method and the streak plating method.

[0058] (2) Secondary screening of strains

[0059] The strains obtained from the initial screening and commercially available yeast were inoculated into liquid YPD medium and cultured in a shaker at 30°C and 180 rpm / min for 48 h. The alcohol content was measured, and strains with higher alcohol content were selected.

[0060] The selected strains and commercially available yeasts were inoculated into screening medium 2 and cultured in a shaker at 30℃ and 180 rpm / min for 48 h. The β-phenylethanol content was detected by gas chromatography according to national standards, and strains with higher β-phenylethanol content than commercially available yeasts were selected.

[0061] The selected strains were inoculated onto plates of secondary screening medium 1 and cultured at 30°C for 48 hours. Strains that did not produce a yellow transparent zone were selected.

[0062] After three rounds of screening, a high-yield brewer's yeast strain with high β-phenylethanol production and low acid production was finally obtained.

[0063] The above culture medium formulations are as follows:

[0064] YPD medium (g / L): 1% yeast extract, 2% peptone, 2% glucose (solid medium: 2% agar added).

[0065] Secondary screening medium 1: yeast extract 1%, peptone 2%, glucose 2%, bromocresol green 0.06 g / L, agar 2%.

[0066] Secondary screening medium 2: glucose 2%, magnesium sulfate 0.05%, potassium dihydrogen phosphate 0.5%, yeast extract 0.5%, p-fluorophenylalanine (PFP) 0.1%.

[0067] Example 2: Strain Identification

[0068] Template DNA: Total yeast DNA was extracted according to the instructions of the EZNA Fungal Genomic DNA Extraction Kit.

[0069] The amplification system was (25 uL): 2 uL template DNA, 1 uL each of primers NL1 and NL4 (20 μmol / L), and 21 uL PCR Mix.

[0070] The reaction procedure was as follows: pre-denaturation at 96℃ for 5 min; 35 cycles: denaturation at 96℃ for 20 s, annealing at X℃ for 30 s, extension at 72℃ for 30 s; further extension at 72℃ for 10 min, and storage at 4℃.

[0071] Universal primer: NL1: 5'-GCATATCAATAAGCGGAGGAAAAG-3' (SEQ ID NO.2)

[0072] NL4: 5'-GGTCCGTGTTTTCAAGACGG-3' (SEQ IDNO.3)

[0073] The 26S rRNA sequence of this strain (SEQ ID NO.1) is as follows:

[0074] CCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCA TAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAA GTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGG GCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCC

[0075] After uploading the obtained sequences to NCBI, BLAST was used for retrieval and comparison. rDNA sequences with high similarity to the obtained sequences were selected, and a phylogenetic tree was constructed using MEGAX. Figure 6 As shown, the results indicate that strain ZLCY-39 has the highest homology with brewer's yeast and was identified as *Saccharomyces cerevisiae*. Saccharomy cescerevisiae ), and named it ZLCY-39.

[0076] Example 3: Determination of physiological characteristics of the strain

[0077] The commercially available Angel yeast used in this embodiment is "high-activity dry yeast for rice wine" (hereinafter referred to as "commercially available yeast" or "Angel brewing yeast"); specification: 500g / bag; purchased from Angel Yeast Co., Ltd.

[0078] (1) Experiment on the alcohol production characteristics of the strain

[0079] Single colonies that have grown were inoculated into YPD medium and cultured for 24 hours to prepare a seed culture. This seed culture was then inoculated into YPD liquid medium at a 1% inoculation rate and cultured for 24 hours. A 1×10⁻⁶ colony was then inoculated into the seed culture. 7 CFU / mL yeast was cultured in YPD medium at 28-30℃ in a shaking incubator at 180 rpm / min for 48 h. The alcohol content was then measured, with liquid culture medium as a blank control and commercially available Angel yeast as a control. The results showed that strain ZLCY-39 produced an alcohol content as high as 13.42% vol, while commercially available Angel yeast produced an alcohol content of 9.22% vol. Figure 7 As shown, the ZLCY-39 strain produces an alcohol content higher than that of commercially available Angel yeast.

[0080] (2) Alcohol tolerance test of strains

[0081] The alcohol tolerance culture medium is prepared by adding 8%, 10%, 12%, 14%, and 16% anhydrous ethanol to YPD medium, respectively, and mixing thoroughly with the liquid medium. Inoculate with 1% of the medium to obtain 1×10⁶ viable bacteria. 7 Saccharomyces cerevisiae at a concentration of cfu / mL was inoculated into liquid culture medium and incubated statically at 28-30℃ for 48 hours. The OD value of the strain was then measured at a wavelength of 600 nm. Figure 8 As shown, at an anhydrous ethanol concentration of 14%, the growth of commercially available brewing yeast was inhibited, while the ZLCY-39 strain was completely unaffected; at an anhydrous ethanol concentration of 16%, the growth of both the ZLCY-39 and commercially available Angel yeast strains was inhibited, but the effect on the ZLCY-39 strain was relatively small; at an anhydrous ethanol concentration of 18%, the growth of the commercially available Angel yeast strain was completely inhibited, while the ZLCY-39 strain could still grow. Overall, this indicates that the ZLCY-39 brewing yeast has higher alcohol tolerance than the commercially available Angel yeast.

[0082] (3) Experiment on acid production characteristics of strains

[0083] Single colonies that have grown were inoculated into YPD medium and cultured for 24 hours to prepare a seed culture. This seed culture was then inoculated into YPD liquid medium at a 1% inoculation rate and cultured for 24 hours. A 1×10⁻⁶ colony was then inoculated into the seed culture. 7 CFU / mL yeast was cultured in YPD medium at 28-30℃ in a shaking incubator at 180 rpm / min for 48 h. Acidity was measured, with liquid medium as a blank control and commercially available Angel yeast as a control. Results showed that strain ZLCY-39 produced 0.29 g / 100 mL of acid, while commercially available Angel yeast produced 0.47 g / 100 mL. Figure 9 As shown, the acid production characteristics of ZLCY-39 brewing yeast are lower than those of commercially available Angel yeast.

[0084] (4) pH tolerance test of strains

[0085] The pH-tolerant medium was YPD medium, with the pH adjusted to 3.0, 3.5, 4.0, 4.5, and 5.0 respectively. The inoculum was 1% with a viable count of 1×10⁶ cells / mL. 7 Saccharomyces cerevisiae at a concentration of CFU / mL was inoculated into liquid culture medium and incubated statically at 28-30℃ for 48 hours. The OD value of the strain was measured at 600 nm. The survival rate of the strain was calculated. Figure 10 As shown, at pH 4, the growth of commercially available Angel yeast was inhibited, while the growth of ZLCY-39 strain was not significantly affected; at pH 3.5, ZLCY-39 strain grew well, while the growth of commercially available Angel yeast was completely inhibited. Overall, this indicates that ZLCY-39 brewing yeast has higher pH tolerance than commercially available Angel yeast.

[0086] Example 4: Preparation of ZLCY-39 yeast microbial inoculant

[0087] (1) Activation of strain: The glycerol tube of yeast strain No. 39, which was stored at -80℃, was connected to an EP tube for activation (24h). The EP tube was then used to inoculate 10 plates into three-zone streaks for purification, which were called primary plates (24h). Then, 1 primary plate was connected to 4 plates, which were called secondary plates (24h), and cultured in a constant temperature incubator at 30℃.

[0088] (2) Preparation of seed culture: scrape two loops of bacterial cells evenly from a secondary plate into 10 mL of culture medium and incubate in a constant temperature incubator at 30℃ for 24 h to activate it into primary seed culture.

[0089] (3) Secondary seed liquid (Eragonal flask): Inoculate the primary seed liquid into 100mL of culture medium at an inoculation rate of 2%, and incubate in a constant temperature incubator at 30℃ for 24h to activate it into secondary seed liquid.

[0090] (4) Large-scale cultivation: Large-scale cultivation was carried out using a pre-fermentation tank with rice saccharification mash medium. The culture was carried out until the number of brewing yeasts in the bacterial solution reached 1×10⁻⁶. 8 Fermentation should be stopped when the number of viable cells (cfu / mL) exceeds a certain level.

[0091] (5) Preparation of bacterial culture medium: Centrifuge the expanded bacterial culture at 5000-10000 rpm for 20 min, remove the supernatant, and add a protective agent (skim milk + trehalose) at a ratio of bacterial cells to protective agent of 1:3 under sterile conditions until the cell concentration is not less than 1×10⁻⁶. 7 At cfu / mL, pre-freeze at -80℃ for 3 hours. After pre-freezing, freeze using a vacuum freeze dryer to obtain solid bacterial agent.

[0092] Example 5: Application of ZLCY-39 yeast in the semi-continuous fermentation production of light-flavored Shaoxing wine with added koji.

[0093] A 5L pre-fermentation tank was selected, using broken rice as the grain raw material for fermentation. An appropriate amount of broken rice was added at a material-to-water ratio of 1:2.5. The temperature was raised to 95℃ and maintained at 95℃ for 30 minutes as the fermentation substrate. The temperature was then cooled and maintained at 28-30℃. 5% of the grain weight of wheat koji was added for saccharification, and 0.1% of ZLCY-39 strain seed liquid was inoculated simultaneously. The semi-continuous fermentation conditions were: pre-fermentation, open fermentation, temperature 28℃-30℃, fermentation for 3 days. After pre-fermentation, 1 / 3 of the fermentation liquid from the pre-fermentation tank was separated for the next step of post-fermentation (referred to as discharge). Simultaneously, 1 / 3 of the pre-fermentation substrate was added to the pre-fermentation tank, and fermentation continued under the pre-fermentation conditions (referred to as replenishment). During the fourth fermentation (i.e., the fourth time the fermentation substrate was replenished to the pre-fermentation tank to repeat the pre-fermentation), 1%-2% of wheat koji was added to the fermentation substrate. The alcohol content of the separated 1 / 3 volume of fermentation liquid was measured. When the alcohol content was between 14-15.4% vol, it was transferred to a secondary fermentation tank for secondary fermentation. The tank was sealed and fermented for 5 days at 28-30℃, then at 15℃ for 7 days. After each 3-day primary fermentation, the process of discharging and replenishing the liquid was repeated until the 6th primary fermentation. At this point, the alcohol content of the separated 1 / 3 volume of fermentation liquid was measured at 10.02% vol, below 14% vol. The remaining 2 / 3 of the fermentation liquid was then transferred to the secondary fermentation tank for a final secondary fermentation. After the final fermentation, the resulting liquid underwent pressing, filtration, sterilization, and bottling to obtain the rice wine product. The entire process involved 6 primary fermentations and 6 secondary fermentations, constituting a semi-continuous 6-stage fermentation.

[0094] Example 6: Batch fermentation of light and refreshing Shaoxing rice wine using ZLCY-39 yeast

[0095] A 5L fermentation tank was selected. An appropriate amount of broken rice was added at a material-to-water ratio of 1:2.5. The temperature was raised to 95℃ and liquefied for 30 minutes. The tank was then cooled and maintained at 28-30℃. 5% of the broken rice's mass of wheat koji was added, and 0.1% of the ZLCY-39 strain seed liquid was inoculated. The fermentation conditions were as follows: pre-fermentation (first 8 days, open fermentation at a constant temperature of 28-30℃); post-fermentation (3 days at room temperature, followed by 4 days of sealed fermentation). After the post-fermentation was completed, the reaction was terminated. The fermented liquid was then processed through pressing, filtration, sterilization, and bottling to obtain the rice wine product.

[0096] Comparison of koji addition amount and fermentation cycle: When the fermentation liquid volume is the same, semi-continuous fermentation for 4 times, with a total koji addition amount of 6%-7%, has a fermentation cycle of 24 days. This is equivalent to batch fermentation for 2 times, with a koji addition amount of 10%, and a fermentation cycle of 30 days. Reducing the koji amount by 30%-40% shortens the fermentation cycle by 25%.

[0097] Example 7: Fermentation performance of ZLCY-39 yeast in the semi-continuous fermentation production of light-flavored Shaoxing wine with added koji and comparison with control strains of the same genus and species.

[0098] Using commercially available Angel yeast as a control, we set up a batch fermentation group with ZLCY-39 yeast and koji, a batch fermentation group with commercially available Angel yeast and koji, a semi-continuous fermentation group with ZLCY-39 yeast and koji, and a semi-continuous fermentation group with commercially available Angel yeast and koji to compare their fermentation performance in making rice wine.

[0099] (1) ZLCY-39 yeast fermentation group with koji: The batch fermentation process of rice wine in Example 6 above is used as the ZLCY-39 yeast fermentation group with koji.

[0100] (2) Commercially available Angel yeast batch fermentation group: The seed liquid of the strain inoculated in the batch fermentation process of producing rice wine with added koji in Example 6 above was replaced with an equal amount of commercially available Angel yeast, while the other fermentation steps and process conditions remained unchanged. This was used as the commercially available Angel yeast batch fermentation group.

[0101] (3) ZLCY-39 yeast and koji semi-continuous fermentation group: The semi-continuous production process of rice wine in Example 5 above is used as the ZLCY-39 yeast and koji semi-continuous fermentation group. Among them, the first fermentation and the second fermentation are completed once each, which is a semi-continuous first fermentation. The first fermentation and the second fermentation are completed 2 times, 3 times and 4 times respectively, which are semi-continuous second fermentation, 3 times and 4 times respectively.

[0102] (4) Commercially available Angel yeast semi-continuous fermentation group: The seed liquid of the strain inoculated in the semi-continuous production process of rice wine in Example 5 above was replaced with an equal amount of commercially available Angel yeast, while the other fermentation steps and process conditions remained unchanged. This was used as the commercially available Angel yeast semi-continuous fermentation group.

[0103] Yellow rice wine products obtained from the following groups were collected: ZLCY-39 yeast batch fermentation group, commercially available Angel yeast batch fermentation group, ZLCY-39 yeast semi-continuous fermentation group, and commercially available Angel yeast semi-continuous fermentation group. The physicochemical properties of alcohol content, total acid, amino acid nitrogen, total esters, and β-phenylethanol:higher alcohols were measured. The experimental results are shown in Table 1.

[0104] Table 1: Physicochemical properties after fermentation

[0105] The results showed that the physicochemical properties of the rice wine samples produced by the ZLCY-39 brewing yeast through a semi-continuous four-stage fermentation process were not significantly different from those produced by batch fermentation, and the physicochemical properties remained stable throughout the four stages of semi-continuous fermentation. Furthermore, the physicochemical properties of the ZLCY-39 strain were significantly higher than those produced by commercially available Angel brewing yeast through semi-continuous fermentation. When using commercially available Angel brewing yeast for semi-continuous fermentation of rice wine samples, the physicochemical results were less than ideal compared to batch fermentation, and the properties deteriorated significantly with increasing number of consecutive fermentations. Therefore, the ZLCY-39 strain is suitable for producing light-flavored rice wine using a semi-continuous fermentation method.

[0106] Example 8: Application of ZLCY-39 yeast in the semi-continuous fermentation production of light-flavored Shaoxing wine with only added enzymes and yeast

[0107] A 5L pre-fermentation tank was selected, using broken rice as the grain raw material at a material-to-water ratio of 1:2.5. The temperature was raised to 95℃, amylase was added, and the mixture was kept at this temperature for 30 minutes at a dosage of 0.054%. The temperature was then lowered to 65℃, and saccharifying enzyme was added at a dosage of 0.107%. The mixture was liquefied at 95℃ for 30 minutes and then cooled to 30℃, which was then used as the fermentation substrate. Yeast, specifically ZLCY-39 yeast at a dosage of 0.1%, was added. The semi-continuous fermentation conditions were the same as in Example 5.

[0108] Example 9: Fermentation performance of ZLCY-39 yeast in semi-continuous fermentation production of light-flavored rice wine with only added enzyme preparations and yeast compared with control strains of the same genus and species.

[0109] Four groups of experiments were set up: a batch fermentation group using ZLCY-39 yeast without koji, a batch fermentation group using commercially available Angel yeast without koji, a semi-continuous fermentation group using ZLCY-39 yeast without koji, and a semi-continuous fermentation group using commercially available Angel yeast without koji, to compare their fermentation performance in making rice wine.

[0110] (1) ZLCY-39 yeast batch fermentation group without koji: The fermentation method is the same as in Example 8, except that the fermentation conditions are: 8 days before fermentation of rice wine, constant temperature pre-fermentation at 28℃-30℃, and 7 days after fermentation at room temperature, and sealing on the 4th day of post-fermentation. After the post-fermentation is completed, the reaction is terminated, and rice wine products are obtained through pressing, filtration, sterilization, bottling and other processes.

[0111] (2) Commercially available Angel yeast batch fermentation group without yeast starter: The seed liquid of the strain inoculated in the above batch fermentation process for producing rice wine was replaced with an equal amount of commercially available Angel yeast, while other fermentation steps and process conditions remained unchanged. This was used as the commercially available Angel yeast batch fermentation group.

[0112] (3) ZLCY-39 yeast semi-continuous fermentation group without koji: The semi-continuous production process of rice wine in Example 7 above is used as the ZLCY-39 yeast semi-continuous fermentation group without koji.

[0113] (4) Commercially available Angel yeast semi-continuous fermentation group without koji: The seed liquid of the strain inoculated in the semi-continuous production process of rice wine in Example 7 above was replaced with an equal amount of commercially available Angel yeast, while the other fermentation steps and process conditions remained unchanged. This was used as the commercially available Angel yeast semi-continuous fermentation group.

[0114] The physicochemical properties of alcohol content, total acid, amino acid nitrogen, total esters, and β-phenylethanol:higher alcohols in the rice wine products obtained from the above experiments were tested. The results are shown in Table 2.

[0115] Table 2: Physicochemical properties after fermentation

[0116] Results Analysis: The rice wine sample obtained from four semi-continuous fermentations using ZLCY-39 brewing yeast achieved an alcohol content of 15.73% vol, which is not significantly different from the physicochemical properties obtained from batch fermentation. Furthermore, its physicochemical properties are higher than those obtained from semi-continuous fermentation using commercially available Angel brewing yeast. When using commercially available Angel brewing yeast for semi-continuous fermentation of rice wine samples, the physicochemical results are less ideal compared to batch fermentation, and the more consecutive the fermentation, the worse the physicochemical properties become. This indicates that ZLCY-39 strain can be used as the fermentation strain for the semi-continuous production of a light-flavored rice wine with only the addition of enzymes and yeast.

[0117] Example 10: Growth curve determination and cell viability determination of ZLCY-39 yeast after repeated use

[0118] The strain was inoculated at a rate of 1%, resulting in a viable count of 1×10⁻⁶. 7 Saccharomyces cerevisiae (CFU / mL) was inoculated into liquid culture medium and cultured in a shaking incubator at 28-30℃ and 180 rpm / min for 24 h, with OD600 values ​​measured every 2 h. Uninoculated liquid YPD medium was used as a control, and growth curves were plotted (see [link to relevant documentation]). Figure 11 The results showed that the activity of strain ZLCY-39 was significantly higher than that of commercially available yeast strains.

[0119] In the semi-continuous production process of Shaoxing wine in Example 5, samples were taken from the 1 / 3 of the output sample at the end of each of the six pre-fermentation cycles. These samples were then spread onto YPD solid plates using the dilution plating method and incubated at a constant temperature of 28-30℃ for 48 hours for colony counting. The viable cell count results are shown below. Figure 12 Simultaneous counting revealed that, at the fourth fermentation stage, *Saccharomyces cerevisiae* accounted for 95% of all strains, remaining the dominant strain and playing a major role. The results indicate that the optimal number of reuses for ZLCY-39 yeast is four, demonstrating that ZLCY-39 yeast can maintain high fermentation activity even in the fourth fermentation stage of semi-continuous rice wine production.

[0120] Example 11: Sensory Evaluation

[0121] A sensory evaluation team consisting of 20 people who had received sensory evaluation training for rice wine and 20 ordinary consumers of different ages conducted sensory evaluations on the obtained rice wine products and commercially available rice wine products. The evaluation results are shown in Table 3.

[0122] Table 3: Sensory Evaluation Results of Refreshing Yellow Wine

[0123] Note: No. 1 is commercially available rice wine, No. 2 is commercially available yeast-brewed rice wine with added koji, No. 3 is ZLCY-39 brewed rice wine with added koji, No. 4 is commercially available yeast semi-continuous fermentation rice wine with added koji, and No. 5 is ZLCY-39 semi-continuous fermentation rice wine with added koji.

[0124] No. 6 is a light-flavored rice wine brewed with commercially available yeast and only with added enzymes; No. 7 is a light-flavored rice wine brewed with ZLCY-39 and only with added enzymes; No. 8 is a light-flavored rice wine brewed with commercially available yeast and only with added enzymes in a semi-continuous fermentation process; and No. 9 is a light-flavored rice wine brewed with ZLCY-39 and only with added enzymes in a semi-continuous fermentation process.

[0125] The results showed that the ZLCY-39 strain produced the highest overall score for a light-flavored rice wine with added yeast, followed by the ZLCY-39 strain produced only with added enzymes. The rice wine produced using the ZLCY-39 strain in a semi-continuous production process had a slightly lower taste and flavor than that produced through single-fermentation, but its overall score was still higher than commercially available rice wine. Rice wine samples produced using commercially available yeast in a semi-continuous production process had a poorer taste and flavor. In conclusion, the ZLCY-39 strain can be used for semi-continuous rice wine production.

[0126] Example 12: Yellow wine "headache" test

[0127] Thirty participants who had received sensory evaluation training in rice wine and 30 randomly selected ordinary consumers were selected and grouped by age group, with four participants in each age group and four ordinary consumers. The gender ratio was evenly distributed, and each group of 20 participants consumed the same type of rice wine. The distribution method is shown in Table 4. A fixed amount of rice wine (0.7g / kg) was consumed during a group meal, and questionnaires were distributed the following day. The evaluation focused on various physical characteristics, including head sensations, facial sensations, and sleep patterns, and was scored in five aspects: "no sensation," "mild," "moderate," "slightly severe," and "severe." The experimental results are shown in Table 5.

[0128] Table 4: Personnel Allocation Method

[0129] Table 5: Evaluation and Scoring Table for the "Hyperactive" Effect of Yellow Wine

[0130] Note: 1. Selected participants must not have alcohol allergies, be pregnant or breastfeeding, or use any medications during the drinking period; 2. The scoring criteria for each indicator of the above "headache" evaluation are as follows: no feeling 1 point, mild 2 points, moderate 3 points, slightly severe 4 points, severe 5 points.

[0131] The results showed that the rice wine samples produced by adding ZLCY-39 yeast during fermentation had the advantage of not causing a "headache" compared to commercially available rice wines made with added yeast.

[0132] Example 13: Application of ZLCY-39 yeast in cooking wine production

[0133] The rice wine product obtained in Example 5 was selected, and edible salt and spice extracts were added to process it into cooking wine. Its physicochemical indicators were measured, and the results are shown in Table 6. It meets the national standard for grain-brewed cooking wine.

[0134] Table 6: Physicochemical Indicators of Cooking Wine

[0135] Example 14: Application of ZLCY-39 yeast in the alcoholic fermentation stage of vinegar

[0136] Preparation of mash for the alcoholic fermentation stage of vinegar: The ratio of sorghum to water was 1:4.6. The temperature was raised to 60℃, and fast koji (25% of the amount of fast koji) was added. After keeping warm for 30 minutes, the temperature was lowered to 30℃ and daqu (15% of the amount of daqu and 0.2% of the amount of yeast) were added. The results are shown in Table 7.

[0137] Table 7: Indicators of Vinegar Alcoholic Fermentation

[0138] Example 15: Application of ZLCY-39 yeast in the fermentation and preparation of Baijiu (Chinese liquor)

[0139] The grain-to-water ratio was 1:1-1:3, with water temperature at 80-100℃. The grain was watered and steamed 2-4 times, 30 minutes each time. The temperature was then raised and steamed for 2 hours. The temperature was lowered to 30℃, and 20-30% of Daqu (a type of starter culture) and 0.2% of yeast were added and mixed thoroughly. Fermentation was carried out using a pile fermentation method, controlling the pile temperature during the fermentation process. For the first 24 hours, the temperature was maintained at 28-30℃, then raised to 35-38℃ and maintained for 12 hours, and finally raised to 40-45℃ and maintained for 12 hours. After pile fermentation, anaerobic alcoholic fermentation was carried out at 28℃. After fermentation, the material was steamed. The results are shown in Table 8.

[0140] Table 8: Physicochemical Indicators of Baijiu

Claims

1. A brewing yeast, characterized in that, The brewing yeast is brewing yeast (Saccharomyces cerevisiae). Saccharomyces cerevisiae ZLCY-39, with accession number CGMCC NO.28346.

2. The brewing yeast according to claim 1, characterized in that, The brewer's yeast has a 26S rRNA sequence as shown in SEQ ID NO.

1.

3. An inoculum containing the brewing yeast ZLCY-39 as described in claim 1.

4. The application of the brewing yeast ZLCY-39 as described in claim 1 in the production of rice wine, baijiu, vinegar, and cooking wine.

5. A method for producing a refreshing type of rice wine, characterized in that, Includes the following steps: (1) Preparation of seed culture: The Saccharomyces cerevisiae ZLCY-39 described in claim 1 or 2 is inoculated into a liquid culture medium to obtain the Saccharomyces cerevisiae ZLCY-39 seed culture; (2) Inoculation: The fermentation substrate is put into the pre-fermentation tank. The fermentation substrate is obtained by mixing grains and water at a material-to-water ratio of 1:1-4 and heating to 80-100℃. The grains include broken rice. After saccharification, the fermentation substrate is inoculated with brewer's yeast ZLCY-39 seed liquid and fermentation begins. (3) Pre-fermentation: The pre-fermentation tank is opened for pre-fermentation at a temperature of 28℃-30℃ for 3 days; (4) Discharge and replenishment: After the pre-fermentation is completed, 1 / 3 of the volume of the fermentation liquid in the pre-fermentation tank is separated for the post-fermentation; at the same time, 1 / 3 of the volume of the fermentation substrate prepared in step (2) is replenished to the pre-fermentation tank, and the pre-fermentation process in step (3) is continued. (5) Post-fermentation: Seal the container and ferment at a temperature of 28℃-30℃. After 5 days of fermentation, transfer the container to 15℃ and ferment for 7 days. (6) Repeat steps (4)-(5) above; (7) Take the fermentation liquid obtained from the post-fermentation; (8) Press, filter, sterilize and bottle the fermented liquid obtained after post-fermentation to obtain rice wine products.

6. The method for producing refreshing Shaoxing wine according to claim 5, characterized in that, Step (6) is repeated 1-5 times.

7. The method for producing refreshing Shaoxing wine according to claim 5, characterized in that, Determine the alcohol content of the 1 / 3 volume of fermentation liquid separated in step (4). If the alcohol content is lower than 14% vol, the remaining 2 / 3 of the fermentation liquid in the pre-fermentation tank is transferred into the post-fermentation tank and combined for the last post-fermentation.

8. The method for producing refreshing Shaoxing wine according to claim 5, characterized in that, Step (2) can also be as follows: mix grains and water at a ratio of 1:1-4, heat to 80-100℃, add amylase at 0.054% of the grain mass, keep warm for 20-40 minutes, add saccharifying enzyme at 0.107% of the grain mass, liquefy at 95℃ for 30 minutes, cool down to 28-30℃, and use the resulting saccharified mash as the fermentation substrate; then inoculate with 0.1% of the grain mass of brewing yeast ZLCY-39 seed liquid to start fermentation.

9. The method for producing refreshing Shaoxing wine according to claim 5, characterized in that, It also includes adding 1%-2% of wheat koji to the fermentation substrate described in step (2) when repeating step (6) for the third or fourth time.

Images