Functional gene PbCOB.A.1 and its use
By cloning and expressing the PbCOB.A.1 gene, and using recombinant protein or magnetic transfection technology to promote pollen tube growth in pear trees, the problem of low pollination efficiency caused by self-incompatibility in pear trees was solved, the pollination efficiency of pear trees was improved, and theoretical support was provided for breeding.
Patent Information
- Application Number
- CN202311114921.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-31
- Publication Date
- 2026-04-10
- Estimated Expiration
- 2043-08-31
AI Technical Summary
In existing technologies, the self-incompatibility of pear trees leads to low pollination efficiency, affecting pear yield, and traditional methods are difficult to effectively promote pollen tube growth.
The PbCOB.A.1 gene was cloned and expressed. The PbCOB.A.1 protein was overexpressed in pear pollen through in vitro recombinant protein treatment or magnetic transfection technology to promote pollen tube growth.
It significantly improved the pollination efficiency of pear pollen, broadened the regulatory mechanism of self-incompatibility response in pear trees, reduced labor costs, and provided a theoretical basis for pear tree breeding.
Smart Images

Figure CN117417422B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of plant genetic engineering, and particularly relates to a functional gene PbCOB.A.1 and application thereof. The present application clones the PbCOB.A.1 gene from 'Dangshan pear', and proves that the PbCOB.A.1 has the function of promoting pollen tube growth by using in vitro prokaryotic expression protein treatment of pollen and magnetic transfection technology. BACKGROUND
[0002] Self-incompatibility reaction process (SI) is a process of interaction between pistil and pollen S gene products (Xue Y Betal., 1995). Based on different mechanisms, self-incompatibility (SI) is divided into sporophytic SSI mainly existing in Brassicaceae, and gametophytic SI (GSI) mainly in Rosaceae, Solanaceae and Plantaginaceae, which is widely studied.
[0003] Among them, GSI is controlled by an S locus containing pistil S-RNase and pollen determinant F-box (SLF / SFB) (Meng D et al., 2014). The pistil S-RNase can recognize self pollen, degrade pollen RNA, thereby preventing the growth of self pollen tube, but has no inhibitory effect on non-self pollen tube (Kao T H et al., 2004). When the pistil and pollen S genes function normally, self-incompatibility is shown, and when the pistil or pollen S gene is abnormal, it may cause self-compatible mutation. Meanwhile, the modifier outside the S locus also participates in the self-incompatibility reaction. 'Xinxue' pear is a self-compatible variety, and the reciprocal test shows that the segregation rate of progeny genetic analysis does not conform to the Mendelian theory, indicating that the destruction of self-incompatibility may be caused by the modifier outside the S locus (Su-Li Shi et al., 2018).
[0004] Double fertilization refers to the fusion of male gametes (sperm) and female gametes (egg cells) into a zygote, and the pollen tube transporting sperm cells to the ovary through the style is the key to the success of double fertilization. Pear is one of the fruits deeply loved by the people, and successful pollination and fertilization is the basis to ensure the yield of pear. Therefore, it is of great significance to carry out the research on the gene function of PbCOB.A.1 affecting pollen tube growth, which expands the regulatory mechanism of non-S factors participating in self-incompatibility reaction in pear, and also provides a theoretical basis for pear breeding work. SUMMARY
[0005] The present application aims to provide a functional gene PbCOB.A.1 with the function of promoting pollen tube growth of Rosaceae fruit trees and application thereof.
[0006] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:
[0007] The present application provides an application of the protein PbCOB.A.1 or biological material related to the protein PbCOB.A.1 in promoting pollen tube growth of Rosaceae fruit trees or improving pollen pollination efficiency of Rosaceae fruit trees; the present application clones a PbCOB.A.1 gene from ‘Dangshan pear’, and the protein PbCOB.A.1 encoded by the gene, wherein the amino acid sequence of the protein PbCOB.A.1 is shown as SEQ ID No. 1.
[0008] Further, the biological material related to the protein PbCOB.A.1 is at least one of the following (1)-(8):
[0009] (1) a gene encoding the protein PbCOB.A.1;
[0010] (2) an expression cassette containing the gene of (1);
[0011] (3) a recombinant vector containing the gene of (1);
[0012] (4) a recombinant vector containing the expression cassette of (2);
[0013] (5) a recombinant microorganism containing the gene of (1);
[0014] (6) a recombinant microorganism containing the expression cassette of (2);
[0015] (7) a recombinant microorganism containing the recombinant vector of (3);
[0016] (8) a recombinant microorganism containing the recombinant vector of (4).
[0017] Further, the nucleotide sequence of the gene in (1) is shown as SEQ ID No. 2, and contains an open reading window of 2025 bp.
[0018] The present application clones a PbCOB.A.1 nucleotide sequence primer from pear by using a gene cloning technique, and the base sequence is shown as follows:
[0019] PbCOB.A.1-F: 5'-ATGATGGAAACTAGTAATATGGTCATGA-3' i.e. SEQ ID No. 3
[0020] PbCOB.A.1-R: 5'-GTGGAAGCGATTTGTCATGAAA-3' i.e. SEQ ID No. 4
[0021] The application uses the recombinant protein PbCOB.A.1 expressed in vitro to treat pollen of Rosaceae fruit trees to promote pollen tube growth; or uses the magnetic transfection technology to overexpress the coding gene of the protein PbCOB.A.1 in pollen of Rosaceae fruit trees to promote pollen tube growth.
[0022] In the detailed description of the application, the Rosaceae fruit tree is pear.
[0023] A method for improving pollen pollination efficiency, which is (a) or (b) as follows:
[0024] (a) using the recombinant protein PbCOB.A.1 expressed in vitro to treat pollen to promote pollen tube growth, wherein the amino acid sequence of the protein PbCOB.A.1 is shown in SEQ ID No. 1;
[0025] (b) using the magnetic transfection technology to overexpress the coding gene of the protein PbCOB.A.1 in pollen to promote pollen tube growth, wherein the nucleotide sequence of the coding gene of the protein PbCOB.A.1 is shown in SEQ ID No. 2.
[0026] A pollination reagent for improving pollen pollination efficiency, wherein the pollination reagent comprises the protein PbCOB.A.1, and the amino acid sequence of the protein PbCOB.A.1 is shown in SEQ ID No. 1.
[0027] The room temperature in the application is 25±15℃.
[0028] The application has the following beneficial effects:
[0029] The application uses the recombinant protein to culture pollen to treat pollen tube, and the results prove that the protein PbCOB.A.1 can promote the growth of pollen tube, thereby widening the regulation mechanism of non-S factor participating in self-incompatibility reaction in pear. Meanwhile, the magnetic transfection technology is used to study the mechanism of pear pollen tube elongation, which can greatly reduce the labor cost and provide a theoretical basis for pear breeding work. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1 The technical flowchart of the application.
[0031] Figure 2 It is a PCR amplification electrophoretogram of the PbCOB.A.1 gene.
[0032] Figure 3 It is an SDS-PAGE detection of expression and purification of the PbCOB.A.1 recombinant protein.
[0033] Figure 4 It is the influence of the recombinant PbCOB.A.1 protein on pollen tube growth of Dangshan pear.
[0034] Wherein, a is the pollen tube map of Dangshan pear treated with different concentration gradient of pCold-TF protein; b is the pollen tube map of Dangshan pear treated with different concentration gradient of PbCOB.A.1-pCold-TF protein; c is the pollen tube length statistical chart.
[0035] Figure 5 It is the GFP fluorescence map of PbCOB.A.1-LAT52 pollen after magnetic transfection.
[0036] Figure 6 It is the effect of magnetic transfection of PbCOB.A.1 on the growth of Dangshan pear pollen tube;
[0037] Wherein, a is the pollen tube map of LAT52 empty magnetic transfection; b is the pollen tube map of PbCOB.A.1-LAT52 magnetic transfection; c is the pollen tube length statistical chart; d is the relative expression amount of PbCOB.A.1 relative to LAT52 after magnetic transfection. DETAILED DESCRIPTION
[0038] The following examples facilitate better understanding of the present application, but do not limit the present application. In the following examples, the experimental methods are conventional methods, unless otherwise specified. In the following examples, the test materials used are purchased from conventional biochemical reagent companies, unless otherwise specified.
[0039] Example 1 Cloning of full-length cDNA of pear PbCOB.A.1 gene
[0040] According to the sequence of PbCOB.A.1 gene, primers were designed by Primer premier 5.0, and cDNA of 'Dangshan pear' pollen was used as a template for PCR amplification. The detailed steps are as follows:
[0041] In spring, during the flowering period, the flower buds of 'Dangshan pear' were picked, and the anthers were dried and scattered in the room. Pollen medium (5mM 2-morpholinoethanesulfonic acid (MES), 440mM sucrose, 0.55mM calcium nitrate, 1.60mM magnesium sulfate, 1.60mM boric acid, 1.00mM potassium nitrate, pH=6.2-6.3) was added to a 10mL centrifuge tube for pollen culture. The culture conditions were 25℃, 120rpm for 3h, and then centrifuged at 12000rpm for 8min. The supernatant was discarded and stored at-80℃. The total RNA extraction kit (purchased from Beijing Tiangen Biotech Co., Ltd.) was used for RNA extraction, and the operation was carried out according to the operation manual provided by the kit. After completion, the concentration and quality of RNA were detected by NanoDrop2000 spectrophotometer. Reverse transcription was performed using TransScript One-Step RT-PCR SuperMix kit (purchased from Beijing Zonnuo Biotech Co., Ltd.), and the operation was carried out according to the instruction manual provided by the kit.
[0042] PCR amplification primer pairs for the gene are as follows:
[0043] PbCOB.A.1F: 5'-ATGATGGAAACTAGTAATATGGTCATGA-3' (SEQ ID No. 3)
[0044] PbCOB.A.1R: 5'-GTGGAAGCGATTTGTCATGAAA-3' (SEQ ID No. 4)
[0045] The PCR amplification system: 2 μL cDNA, 2.5 μL of forward and reverse primers, 25 μL 2x PhantaMax Buffer, 1 μL dNTP Mix, 1 ul PhantaMax Super-Fidelity DNA Polymerase (purchased from Nanjing Novozyme Biotech Co., Ltd.), and ddH2O to 50 μL.
[0046] The amplification program is as follows: 94°C, pre-denaturation for 3 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 140 s, 35 cycles of thermal cycling, 72°C extension for 10 min, and 4°C storage.
[0047] After amplification, 1.5% agarose gel electrophoresis detected a single band of PCR product, and the specific band (as shown in Figure 2 ) was recovered according to the gel recovery kit (purchased from Nanjing Novozyme Biotech Co., Ltd.).
[0048] The purified DNA was connected with pEASY-Blunt Zero vector (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) for connection reaction, and the steps were operated according to the instructions. The total volume of the connection reaction system was 5 μL, including 4 μL of purified DNA and 1 μL of pEASY-Blunt Zero vector. It was placed at room temperature for 20 min. Then the connection product was transferred into E. coli DH5a (purchased from Nanjing Novozyme Biotech Co., Ltd.), ice bath for 30 min, heat shock for 45 s, ice bath for 2 min, 37°C 220 rpm shaking bed activation for 60 min. Positive clones were screened on LB solid plates containing 100 mg / L kanamycin, and 5 positive clones were sequenced (completed by Shanghai Sunway Biotech Co., Ltd.). The nucleotide sequence of the gene PbCOB.A.1 is shown in SEQ ID No. 2, containing an open reading window of 2025 bp. The protein PbCOB.A.1 encoded by the gene has an amino acid sequence as shown in SEQ ID No. 1. The functions of the gene and protein were studied, and the technical process is shown in Figure 1 .
[0049] Example 2 Expression and purification of PbCOB.A.1 recombinant protein
[0050] According to the analysis of the restriction sites on the polylinker of pCold-TF vector and the coding region sequence of PbCOB.A.1 gene, BamHI and XbaI were selected as the endonucleases. The primers were designed by Primer Primer 5.0 software, and the vector homology arm sequence (lowercase part) was added to the 5' end of the primers. The sequence of the primer pair is as follows:
[0051] PbCOB.A.1-F1: 5'-ctcggtaccctcgagggatccATGATGGAAACTAGTAATATGGTCATGA-3' (SEQ ID No. 5)
[0052] PbCOB.A.1-R1: 5'-agcagagattacctatctagaGTGGAAGCGATTTGTCATGAAA-3' (SEQ ID No. 6)
[0053] The preferred procedure, system and recovery of the target fragment of PCR are the same as those of Example 1.
[0054] The pCold-TF vector plasmid was subjected to enzyme digestion reaction using BamHI and XbaI endonucleases (purchased from NEB company). The reaction system included 800 ng pCold-TF empty plasmid, 5 μL 10×Cutsmart Buffer, 1 μL BamHI endonuclease, 1 μL XbaI endonuclease, and ddH2O was added to 50 μL, and the reaction was performed at 37°C for 4 h.
[0055] The double-digested vector was ligated with the purified DNA. The ligase Exnase II was purchased from Nanjing Novozyme Biotech Co., Ltd. The reaction system was 20 μL: 150 ng pCold-TF linear vector, 50 ng gene fragment, 4 μL 5×CE II Buffer, 2 μL Exnase II, and the rest was supplemented with ddH2O, and the reaction was performed at 37°C for 30 min. The transformation experiment was the same as that of Example 1. After activation, it was plated on LB solid plate containing 100 μg / ml ampicillin, and 5 positive clones were picked after 14 h for sequencing (completed by Shanghai Generay Biotech Co., Ltd.).
[0056] The recombinant plasmid PbCOB.A.1-pCold-TF successfully sequenced is extracted using a rapid plasmid small extraction kit (purchased from Nanjing Novizen Biotech Co., Ltd.). 500 ng of recombinant plasmid PbCOB.A.1-pCold-TF is used to transform E. coli Rosetta (DE3), which is coated on an ampicillin-containing plate at 100 μg / mL to screen the recombinant gene, and cultured in a 37°C incubator for 14 h. The pCold-TF plasmid is used as a control and is also transformed into Rosetta (DE3) by the same method. Single colonies are selected for identification.
[0057] The E. coli Rosetta (DE3) transformed with the recombinant plasmid described above is inoculated in a liquid screening medium for activation, and cultured at 37°C with 220 rpm shaking overnight, and then transferred to a new liquid screening medium for culture with OD 600 = 0.4-0.6, and the inoculation amount of the activation culture and the expansion culture is preferably 1:50;
[0058] 2 ml of the bacterial solution is taken as a negative control. The expansion culture conical flask is quickly placed on ice for 45 min, and then the IPTG inducer is added, preferably at a final concentration of 0.5 mmol / L, and induced to express at 16°C with 220 rpm for 18-24 h.
[0059] After the expression is completed, the bacteria are collected by centrifugation at 4°C with 12000 rpm. The bacteria are resuspended with 15 mL of PBS buffer (140 mmol / L sodium chloride, 2.7 mmol / L potassium chloride, 10 mmol / L disodium hydrogen phosphate, 1.8 mmol / L potassium dihydrogen phosphate, pH 7.4), and then ultrasonically broken, with a power of 240 W, for 3 s and stopped for 7 s, until the solution is clear. After ultrasonic breaking is completed, the supernatant is collected by centrifugation at 4°C with 12000 rpm for 20 min. The control protein pCold-TF is also expressed by the above method.
[0060] Ni-NTA agarose affinity chromatography filler (purchased from Shanghai Shenguo Biotechnology Co., Ltd.) was used to purify the pear PbCOB.A.1 recombinant protein. The specific operation was as follows: the above filler was equilibrated with 10 times the volume of PBS buffer, and the flow rate was controlled at 1 ml / min; the protein supernatant after crushing was added to the purification column, and the flow rate was controlled at 0.5 ml / min; 20 times the volume of the filler was washed with a cleaning solution containing 20 mmol / L imidazole (500 mmol / L sodium chloride, 50 mmol / L tris(hydroxymethyl) aminomethane, 20 mM imidazole, pH = 7.4), and the flow rate was controlled at 1 ml / min; 8 times the volume of the column was eluted with an elution solution containing 400 mmol / L imidazole (500 mmol / L sodium chloride, 50 mmol / L tris(hydroxymethyl) aminomethane, 400 mM imidazole, pH = 7.9), and the flow rate was controlled at 1 ml / min. The purified protein was collected by collecting the eluate. The protein was concentrated and desalted using a 30 kDa ultrafiltration tube. 10 μL of the purified protein was taken, 2 μL of 5x protein loading buffer (purchased from Shanghai Shenguo Biotechnology Co., Ltd.) was added, and 10 μL was taken for 12% regular SDS-PAGE electrophoresis. After staining with coomassie brilliant blue and decolorizing, the purified recombinant protein was detected. As shown in Figure 3 Figure 1, the band of the purified PbCOB.A.1 recombinant protein.
[0061] Finally, the purified protein was dialyzed at 4°C, 5000 rpm using pollen medium, and then stored at -80°C.
[0062] Example 3 Identification of PbCOB.A.1 recombinant protein on pollen tube growth
[0063] The above dialyzed PbCOB.A.1-pCold-TF recombinant protein was treated with different concentration gradients of ‘Dangshan Quli’ pollen. The concentration gradients of the PbCOB.A.1 recombinant protein were set at 0.1 mg / ml, 0.2 mg / ml,
[0064] 0.3 mg / ml, 0.4 mg / ml, and 0.5 mg / ml. In addition, the pCold-TF empty protein was also added according to the above five concentration gradients, and the specific experimental method was as follows:
[0065] First, 3 ml of pear pollen medium was used to pre-culture ‘Dangshan Quli’ pollen at 25°C, 120 rpm, and 60 min. The formula of the pollen medium is as described in Example 1. Then 200 μL of pollen was dispensed into 2 mL EP tubes, and the protein was added, with three biological replicates. Then the culture was continued at 25°C, 120 rpm on a shaker for 3 hours. The cultured pollen was photographed using a NiKON ECLIPSE E100 microscope Figure 4 ).
[0066] The length of pollen tube was counted by IPWin32 software, about 30 pollen tubes were counted in each concentration gradient, and the average value and standard error were calculated for three times. Figure 4 The results showed that PbCOB.A.1 promoted the growth of Pyrus bretschneideri pollen.
[0067] Example 4 Identification of pollen tube growth by magnetic transfection of PbCOB.A.1
[0068] In the present application, the plasmid vector is p1300-LAT52-GFP vector (Qian et al., 2021, 254(2):22). The resistance tag of the vector is kanamycin, and the double enzyme digestion is preferably XbaI and BamHI. The enzyme digestion system and reaction conditions are the same as those in Example 2.
[0069] The primer pair for PCR amplification of the gene is:
[0070] PbCOB.A.1-F2: 5'-aaaaattccaatttatctagaATGATGGAAACTAGTAATATGGTCATGA-3'(SEQ ID No. 7)
[0071] PbCOB.A.1-R2: 5'-gcccttgctcaccatggatccGTGGAAGCGATTTGTCATGAAA-3'(SEQ ID No. 8)
[0072] The construction steps of PbCOB.A.1-p1300-LAT52-GFP recombinant plasmid are the same as those in Example 2.
[0073] The pollen cells of 'Dangshan Quli' were placed in tissue culture dishes placed on a magnetic marker plate (purchased from Nanjing Dongna Co., Ltd.), and the volume of the medium containing the cells was determined according to the size of the culture dish, preferably 0.5 mL of transfection volume, and incubated for 15 minutes.
[0074] The Transfection reagent (purchased from Nanjing Dongna Co., Ltd.) and PbCOB.A.1-p1300-LAT52-GFP recombinant plasmid were mixed, preferably 0.5-2 μL, DNA amount 0.5-3 μg. p1300-LAT52-GFP empty plasmid as control.
[0075] The prepared Transfection reagent and control reagent were added to the cells, and at this time the cell culture plate was still placed on the magnetic marker plate and incubated for 15 minutes.
[0076] Carefully remove the supernatant pollen medium from the cells, add fresh medium, and the plate is still on the magnetic plate. Be careful not to suck the cells that sink due to magnetic force.
[0077] Remove the plate from the magnetic plate. After 3h standard culture at 25℃, 120rpm, observe whether there is GFP fluorescence in the magnetically transfected pollen by laser confocal microscopy to determine whether the MNP / DNA complex has been transferred into the pollen ( Figure 5 ). Use the Nikon CLIPSE E100 microscope to count the pollen tube length of ‘Dangshan Kuli’ and analyze the data.
[0078] Extract the RNA of ‘Dangshan Kuli’ pollen after magnetic transfection, and obtain the first strand cDNA by reverse transcription for qRT-PCR experiment of PbCOB.A.1 gene. RNA extraction and reverse transcription are carried out according to Example 1. The qRT-PCR primers of PbCOB.A.1 are:
[0079] PbCOB.A.1-F: CCAGATTCAGGCTAAGATTGCGTTC
[0080] PbCOB.A.1-R: ATTTTGGGTCCTTTTTACAGCATACAG
[0081] Take the pear Tubulin gene as the internal reference, and its qRT-PCR primers are:
[0082] PbTUB-F: GGCATCAACCTTCATTGGGAACTC
[0083] PbTUB-R: ACCAGATCGTTCATGTTGCTCTCG
[0084] The qRT-PCR experiment uses the LC480 SYBR Green Mix kit (purchased from Roche Company) and is operated according to the kit instructions. The 20μL qRT-PCR reaction system includes: 10μL 2×SYBR Green Mix, 0.4uM forward primer and reverse primer, 20ng cDNA, and the rest is supplemented with sterile water. Use the 96-well qRT-PCR plate (purchased from Roche Company) and use the qRT-PCR instrument (model: LightCycler 480, Roche Company) to perform PCR. The qRT-PCR reaction program is: 95℃ pre-denaturation for 10 minutes; 95℃ denaturation for 3 seconds, 62℃ annealing for 10 seconds, 72℃ extension for 30 seconds, 45 cycles. Each cDNA is set with three biological repeats and three technical repeats, and the average Ct value of each cDNA sample is calculated, and the 2 -ΔΔCtThe relative expression amount of PbCOB.A.1 gene was obtained.
[0085] As shown in Table 1, the expression amount of PbCOB.A.1 gene by magnetic transfection technology was obviously higher than that of the control. The pollen treated by PbCOB.A.1-p1300-LAT52-GFP was longer than the control, indicating that the magnetic transfection of PbCOB.A.1 promotes the pollen tube growth of ‘Dangshan pear’. Figure 6
[0086] The above only describes the preferred embodiments of the present application, and it should be noted that, for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. Use of a protein PbCOB.A.1 having an amino acid sequence as shown in SEQ ID No. 1 in promoting pollen tube growth or improving pollen pollination efficiency of Pyrus.
2. The use of the overexpression of the coding gene of the protein PbCOB.A.1 as claimed in claim 1 in promoting the growth of pollen tubes or improving the pollination efficiency of pear tree pollen, characterized in that, The nucleotide sequence of the coding gene is shown in SEQ ID No.
2.
3. Use according to claim 2, characterized in that, The biological material for overexpressing the coding gene is at least one of the following (1)~(7): (1) an expression cassette containing the coding gene; (2) a recombinant vector containing the coding gene; (3) a recombinant vector containing the expression cassette in (1); (4) a recombinant microorganism containing the coding gene; (5) a recombinant microorganism containing the expression cassette in (1); (6) a recombinant microorganism containing the recombinant vector in (2); (7) a recombinant microorganism containing the recombinant vector in (3).
4. Use according to claim 1 or 2, characterized in that, The pollen of Pyrus is treated with the recombinant protein PbCOB.A.1 expressed in vitro to promote pollen tube growth; or the coding gene of the protein PbCOB.A.1 is overexpressed in the pollen of Pyrus by magnetic transfection to promote pollen tube growth.
5. A method of increasing the efficiency of pollination of pear trees by pollen, characterized in that, The method is (a) or (b) as follows: (a) the pollen is treated with the recombinant protein PbCOB.A.1 expressed in vitro to promote pollen tube growth, wherein the amino acid sequence of the protein PbCOB.A.1 is shown in SEQ ID No. 1; (b) the coding gene of the protein PbCOB.A.1 is overexpressed in the pollen by magnetic transfection to promote pollen tube growth, wherein the nucleotide sequence of the coding gene of the protein PbCOB.A.1 is shown in SEQ ID No.
2.
6. Use of a protein PbCOB.A.1 having an amino acid sequence as shown in SEQ ID No. 1 in the preparation of a pollination reagent for improving pollen pollination efficiency of Pyrus.
Citation Information
Patent Citations
Antisense expression method for self-compatibility novel germplasm of S-RNase creation pear by utilizing pollen mediators
CN103382484A
Protein PbrTTS1 with pollen tube growth promoting function of Dangshan pears and coding gene and application of protein
CN108822195A