Method for inhibiting porcine reproductive and respiratory syndrome virus infection in vitro by honokiol and application thereof
By inhibiting porcine reproductive and respiratory syndrome virus infection with magnolol, the problem of the lack of safe and effective drugs in the existing technology has been solved, and the effects of significantly inhibiting viral RNA, protein and titer have been achieved, providing a drug for the prevention and treatment of porcine reproductive and respiratory syndrome.
Patent Information
- Application Number
- CN202311784269.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-23
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2043-12-23
AI Technical Summary
There is a lack of safe and effective antiviral drugs for porcine reproductive and respiratory syndrome virus (PRRSV) in the current technology. Inactivated vaccines and attenuated vaccines have limitations and risks, and are difficult to effectively control the spread of PRRS.
In the preparation of drugs that inhibit porcine reproductive and respiratory syndrome virus (PRRSV) infection, honokiol was used to verify its inhibitory effect on PRRSV through in vitro experiments, including the inhibition of viral RNA content, protein abundance, and titer.
Honokiol significantly inhibits PRRSV infection in vitro, reduces viral RNA content, protein abundance and titer, providing a safe and efficient drug solution for the prevention and treatment of PRRSV.
Smart Images

Figure CN117503735B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method and application of using magnolol to inhibit porcine reproductive and respiratory syndrome virus infection in vitro, belonging to the fields of cell biology, virology, and biomedicine. Background Technology
[0002] Porcine reproductive and respiratory syndrome (PRRS), commonly known as "blue ear disease" in pigs, is a highly contagious disease caused by porcine reproductive and respiratory syndrome virus (PRRSV). Its main characteristics are reproductive disorders in sows and mild to severe respiratory symptoms in the herd. Importantly, PRRSV infection can cause immunosuppression, leading to secondary infections with various pathogens and resulting in more severe clinical manifestations and mortality. PRRS severely damages the pig farming industry, causing enormous economic losses globally, especially in my country.
[0003] PRRSV is an enveloped, single-stranded, positive-sense RNA virus belonging to the genus Betaarterivirus within the family Arteriviridae of the order Nidovirales. In pigs, PRRSV primarily infects monocytes / macrophages, such as porcine alveolar macrophages (PAMs), and in vitro, it can infect the African green monkey kidney epithelial cell line MA-104 and its derivative MARC-145 cell line. Currently, there are no specific drugs for PRRS in clinical practice; prevention strategies mainly rely on inactivated and live attenuated vaccines. However, both inactivated and live attenuated PRRS vaccines have certain limitations and risks. Inactivated vaccines have drawbacks such as high dosage, short duration of immunity, and low antibody levels, making them difficult to achieve the desired preventative effect. Live attenuated vaccines offer good protection against homologous strains; however, virulence reversion can occur, increasing the risk of infection. Given that current prevention and control strategies are ineffective in controlling the spread of PRRS, there is an urgent need to develop safe and effective antiviral drugs for PRRSV. Summary of the Invention
[0004] To address the shortcomings of existing technologies, this invention provides a method for inhibiting porcine reproductive and respiratory syndrome virus (PRRSV) infection in vitro with magnolol, and confirms that magnolol can be used in the preparation of drugs for the prevention and treatment of PRRS.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0006] The application of magnolol in the preparation of drugs that inhibit porcine reproductive and respiratory syndrome virus infection.
[0007] The application of magnolol in the preparation of drugs that inhibit the viral RNA content of porcine reproductive and respiratory syndrome virus infection.
[0008] The application of magnolol in the preparation of drugs that inhibit the abundance of viral proteins in porcine reproductive and respiratory syndrome virus infection.
[0009] The application of magnolol in the preparation of drugs that inhibit viral titers of porcine reproductive and respiratory syndrome virus infection.
[0010] In the aforementioned applications, the effective concentration of magnolol is 2.5-10 μmol / L.
[0011] In the aforementioned application, the effective concentration of magnolol is 10 μmol / L.
[0012] A method for inhibiting porcine reproductive and respiratory syndrome virus (PRV) infection in vitro using magnolol, the specific steps of which are as follows:
[0013] (1) MARC-145 cells were inoculated at 2.5 × 10⁻⁶. 5 Seed the cells at a density of cells / mL into a 24-well cell culture plate, add 500 μL of DMEM medium to each well, and incubate at 37°C and 5% CO2 for 12 h. When the cell confluence reaches 70%-80%, discard the upper cell culture medium.
[0014] (2) The PRRSV-2HN07-1 strain with a multiplicity of infection (MOI) of 1 was inoculated into MARC-145 cells and incubated at 37°C for 1 h. The cell supernatant was discarded and the cells were washed three times with PBS buffer to remove free virus particles that had not invaded the cells.
[0015] (3) Add 500 μL of DMEM medium containing 2.5, 5, 10 μmol / L and magnolol to the wells of the cell culture plate and continue to culture at 37℃ for 24 h.
[0016] The DMEM medium contains 10% (v / v) heat-inactivated fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin.
[0017] Beneficial effects of this invention:
[0018] This invention, through screening a natural compound library preserved in our laboratory, discovered that honokiol and magnolol can significantly inhibit PRRSV infection in vitro. First, the cytotoxicity of commercially available honokiol and magnolol was detected using a cell proliferation and cytotoxicity assay (CCK-8), employing quantitative real-time PCR (RT-qPCR), Western blotting (IB), and TCID assay. 50Experiments were conducted to identify the inhibitory effect of non-cytotoxic honokiol on PRRSV in vitro infection, and it was found that it could significantly inhibit viral RNA content, protein abundance and titer during PRRSV in vitro infection.
[0019] The method of this invention can significantly inhibit PRRSV infection in vitro. During PRRSV infection of MARC-145 cells, the addition of 2.5, 5, and 10 μmol / L of magnolol significantly reduced PRRSV RNA content, protein abundance, and titer compared to the untreated group. Experiments demonstrate that magnolol can be used to prepare drugs for the prevention and treatment of porcine reproductive and respiratory syndrome (PRRS). Attached Figure Description
[0020] Figure 1 Bar graph showing the cytotoxicity of magnolol to MARC-145 cells;
[0021] Figure 2 Bar chart showing the relative RNA content of PRRSV virus in MARC-145 cells infected with PRRSV virus;
[0022] Figure 3 Immunoblotting image of PRRSV viral protein abundance in MARC-145 cells infected with PRRSV virus;
[0023] Figure 4 A bar chart showing the PRRSV viral titer in MARC-145 cells. Detailed Implementation
[0024] The specific embodiments of the present invention will be further described in detail below with reference to examples. Unless otherwise specified, the instruments and equipment used in the examples are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents; and the experimental methods involved are all conventional methods.
[0025] The cells, viruses, and main reagents that may be used in this invention are as follows:
[0026] 1. DMEM medium (containing 100 U / mL penicillin and 100 μg / mL streptomycin, Beijing Solarbio Science & Technology Co., Ltd., catalog number 12100); 2. Fetal bovine serum (Moregate, Australia, catalog number FSBF-500); 3. Honokiol (GlpBio, USA, catalog number GN10664); 4. CellTiter 96AQ ueous One Solution reagent (Promega, USA, catalog number G3582); 5. PRRSV-2HN07-1 strain (GenBank accession number KX766378.1); 6. RNAiso Plus extraction reagent (Takara, Dalian, catalog number 9108); 7. PrimeScript TMReverse transcription kit (TaKaRa, Dalian, catalog number RR036A); 8. 2×ChamQ Universal SYBR qPCR Master Mix (Nanjing Novizan Biotechnology Co., Ltd., catalog number Q711-02); 9. RIPA lysis buffer (Beyotime Biotech, Shanghai, catalog number P0013B); 10. Protein loading buffer (Solepro, Beijing, catalog number P1040); 11. Rabbit anti-PRRSV nucleocapsid protein (N) monoclonal antibody (1:1,000; Genetex, USA, catalog number GTX637947); 12. Mouse anti-β-actin monoclonal antibody (1:1,000; Cell Signaling, USA). Technology Company, catalog number 3700); 13. Horseradish peroxidase (HRP)-labeled goat anti-rabbit secondary antibody (1:1,000; Wuhan Yacoin Biotechnology Co., Ltd., catalog number A21020); 14. Horseradish peroxidase (HRP)-labeled goat anti-mouse secondary antibody (1:1,000; Wuhan Yacoin Biotechnology Co., Ltd., A21010).
[0027] Example 1 and identification of magnolol's cytotoxicity against MARC-145 cells
[0028] MARC-145 cells were fed at a rate of 2.5 × 10⁻⁶. 5 Cells were seeded at a density of 100 μL / mL into 96-well cells culture plates. Each well was then incubated with 100 μL of DMEM medium containing 10% (v / v) heat-inactivated fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. The plates were then incubated at 37°C in a 5% CO2 incubator for 12 h. When cell confluence reached 70%-80%, the supernatant was discarded. Four experimental groups were set up: treatment groups with 2.5, 5, and 10 μmol / L magnolol, and a control group without magnolol. The treatment groups were incubated with the corresponding concentrations of magnolol and DMEM medium. All four groups were incubated for 48 h. 20 μL of CellTiter 96AQ was added to each well. ueous The One Solution reagent was reacted in a 37°C, 5% CO2 cell culture incubator for 2 hours, and cytotoxicity was identified according to the instructions. Statistical analysis was performed using an unpaired, two-tailed Student's t-test with GraphPad software; ns was considered as no significant difference.
[0029] The results are as follows Figure 1 As shown, compared with the control group without honokiol (0 μmol / L) and the cell viability (cell viability was 100%), the treatment groups with 2.5, 5, and 10 μmol / L and honokiol (HNK) had no significant effect on cell viability (ns), indicating that the corresponding concentrations of honokiol are non-cytotoxic and can be used in subsequent examples.
[0030] Example 2 and the effect of magnolol on PRRSV RNA content in MARC-145 cells.
[0031] MARC-145 cells were fed at a rate of 2.5 × 10⁻⁶. 5 MARC-145 cells were seeded at a density of 1 cell / mL into 24-well cell culture plates, with 500 μL of LMEM medium added to each well. The plates were then incubated at 37°C with 5% CO2 for 12 h. When cell confluence reached 70%-80%, the supernatant was discarded, and 500 μL of PRRSV-2HN07-1 strain (GenBank accession KX766378.1) with a multiplicity of infection (MOI) of 1 was added to each well and incubated at 37°C for 1 h. The cell supernatant was discarded, and the cells were washed three times with 500 μL of phosphate-buffered saline (PBS) to remove uninvaded free virus particles. Four experimental groups were set up: treatment groups with 2.5, 5, and 10 μmol / L magnolol, and a control group without magnolol. The treatment groups were treated with 500 μL of magnolol at the corresponding concentrations. DMEM medium was used, and all four groups were incubated at 37℃ for 24 hours. Cell supernatant was discarded, and cells were washed three times with PBS buffer. 300 μL of RNA extraction reagent RNAisoPlus (Takara Bio Inc., Dalian, catalog number 9108) was added to each well, and total RNA was extracted from the cells according to the instructions. PrimeScript was used for further analysis. TM Complementary DNA (cDNA) was generated using a reverse transcription kit (TaKaRa, Dalian, catalog number RR036A) as a template; the relative content of PRRSV ORF7 RNA was determined by RT-qPCR to represent the viral RNA content of infected cells; glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an intracellular reference gene, and viral RNA was normalized using GAPDH mRNA, and the results were analyzed by 2... -△△CT The method was used to perform relative quantification of RNA expression levels; primer sequences are shown in Table 1, and PRRSV ORF7 and GAPDH reaction systems are shown in Tables 2 and 3, respectively. The reaction program used was the Fast program built into the ABI real-time PCR instrument (Applied Biosystems, USA).
[0032] The experiment was conducted independently three times, with three replicates each time. Experimental data are expressed as group mean and standard deviation (SD). Statistical analysis was performed using the unpaired, two-tailed Student t-test in GraphPad software. ** indicates p < 0.01, **** indicates p < 0.0001.
[0033] The results are as follows Figure 2As shown, compared with the control group without magnolol (0 μmol / L), the PRRSV RNA content in the treatment groups with 2.5, 5, and 10 μmol / L magnolol was reduced in a dose-dependent manner. In particular, the PRRSV RNA content in the 10 μmol / L magnolol treatment group was reduced by >99%, indicating that magnolol can significantly inhibit the replication of PRRSV RNA infected in MARC-145 cells.
[0034] Table 1 Primers for Real-Time PCR
[0035] Primer name Sequence (5'-3') PRRSV-ORF7 forward primer AAACCAGTCCAGAGGCAAGG(SEQ ID NO.1) PRRSV-ORF7 reverse primer GCAAACTAAACTCCACAGTGTAA(SEQ ID NO.2) GAPDH forward primer CCTTCCGTGTCCCTACTGCCAAC(SEQ ID NO.3) GAPDH reverse primer GACGCCTGCTTCACCACCTTCT(SEQ ID NO.4)
[0036] Table 2 Relative Real-Time PCR Reaction System (1)
[0037] reagents Usage 2×ChamQ Universal SYBR qPCR Master Mix 10μL PRRSV-ORF7 forward primer (10 μmol / L) 1μL PRRSV-ORF7 reverse primer (10 μmol / L) 1μL cDNA (50 ng) 2μL <![CDATA[Make up with ddH2O]]> Up to 20 μL
[0038] Table 3 Relative Real-Time PCR Reaction System (2)
[0039] reagents Usage 2×ChamQ Universal SYBR qPCR Master Mix 10μL GAPDH forward primer (10 μmol / L) 1μL GAPDH reverse primer (10 μmol / L) 1μL cDNA (50 ng) 2μL <![CDATA[Make up with ddH2O]]> Up to 20 μL
[0040] Example 3 and the effect of magnolol on the abundance of PRRSV protein in MARC-145 cells infected with PRRSV
[0041] To further confirm the inhibitory effect of magnolol on the PRRSV infection level in MARC-145 cells, the inhibitory effect of magnolol on the expression of nucleocapsid protein (N), the major structural protein of PRRSV, was detected by Western blotting (IB).
[0042] MARC-145 cells were fed at a rate of 2.5 × 10⁻⁶. 5MARC-145 cells were seeded at a density of 24 cells / mL into 500 μL DMEM medium per well and incubated at 37°C in a 5% CO2 incubator for 12 h. When cell confluence reached 70%-80%, the supernatant was discarded, and MARC-145 cells were inoculated with PRRSV-2HN07-1 strain (MOI 1). The cells were infected at 37°C for 1 h. The cell supernatant was discarded, and the cells were washed three times with PBS buffer to remove uninvaded free virus particles. Four experimental groups were set up: treatment groups with 2.5, 5, and 10 μmol / L magnolol, and a control group without magnolol. Treatment groups were inoculated with 500 μL DMEM medium containing the corresponding concentration of magnolol. All four groups were incubated at 37°C for another 24 h. The cell supernatant was discarded, and the cells were washed three times with PBS buffer. 150 μL of magnolol was added to each well. RIPA lysis buffer was used, followed by immunoblotting (IB): protein lysate samples were placed on ice for 30 min, centrifuged at 12,000 rpm for 10 min at 4°C, and the supernatant was collected; protein loading buffer was added to the supernatant, and the mixture was boiled for 10 min; protein samples were added to a 12% SDS-PAGE gel for electrophoresis, and the protein gel was transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, USA, catalog number 3010040001); the membrane was blocked with 5% skim milk powder phosphate Tween-20 buffer (PBST) at room temperature for 1 h, and washed three times with PBST on a shaker; rabbit anti-PRRSV N protein monoclonal antibody (1:1,000; Genetex, USA, catalog number GTX637947) and mouse anti-β-actin monoclonal antibody (1:1,000; Cell Signaling, USA) were used, respectively. Technology Co., Ltd. (Catalog No. 3700) was incubated at room temperature for 1 hour, and the membrane was washed three times with PBST on a shaker. Horseradish peroxidase (HRP)-labeled goat anti-rabbit and HRP-labeled goat anti-mouse secondary antibodies (1:1,000; Wuhan Yacoin Biotechnology Co., Ltd., Catalog Nos. A21020 and A21010) were incubated at room temperature for 1 hour, and the membrane was washed three times with PBST on a shaker. High-sensitivity chemiluminescence detection kit (Suzhou Xinsaimei Biotechnology Co., Ltd., Catalog No. P2200) was used for color development in a protein luminescence analyzer according to the instructions.
[0043] The results are as follows Figure 3As shown, compared with the control group without magnolol (0 μmol / L), the abundance of PRRSV N protein in the treatment groups with 2.5, 5, and 10 μmol / L magnolol decreased in a dose-dependent manner. In particular, according to the gray values in the protein luminescence analyzer, the abundance of PRRSV N protein in the 10 μmol / L magnolol treatment group was reduced by >99%, indicating that magnolol can significantly inhibit the synthesis of PRRSV protein in MARC-145 cells infected with magnolol.
[0044] Example 4 and the effect of magnolol on PRRSV virus titer in MARC-145 cells.
[0045] To further confirm the inhibitory effect of magnolol on PRRSV infection in MARC-145 cells, the half-maximal cell culture infection dose (TCID) was used. 50 The viral titer was determined to assess the inhibitory effect of magnolol on PRRSV progeny virus production.
[0046] MARC-145 cells were fed at a rate of 2.5 × 10⁻⁶. 5 Cells were seeded at a density of 1 cell / mL into 24-well cell culture plates, with 500 μL of LMEM medium added to each well. The plates were then incubated at 37°C in a 5% CO2 incubator for 12 h. When cell confluence reached 70%-80%, the supernatant was discarded, and MARC-145 cells were inoculated with PRRSV-2HN07-1 strain with a multiplicity of infection (MOI) of 1. The cells were then incubated at 37°C for 1 h. The cell supernatant was discarded, and the cells were washed three times with PBS buffer to remove uninvaded free virus particles. Four experimental groups were set up: treatment groups with 2.5, 5, and 10 μmol / L honokiol, and a control group without honokiol. Treatment groups were supplemented with 500 μL of LMEM medium containing the corresponding concentrations of honokiol. All four groups were incubated at 37°C for another 24 h, and the viral titer (TCID) was measured. 50 Assay: Uninfected MARC-145 cells were cultured at a density of 2.5 × 10⁻⁶. 5MARC-145 cells were seeded at a density of 100 μL / mL into 96-well cell culture plates, with 100 μL of DMEM medium added to each well. The plates were incubated at 37°C with 5% CO2 until cell confluence reached 70%-80%. The supernatant from MARC-145 cells infected for 24 hours was then serially diluted 10-fold. 100 μL of each diluted supernatant was seeded into each well, with eight replicates per dilution. DMEM medium was used as a control instead of the infected cell supernatant. The 96-well plates were incubated at 37°C with 5% CO2 for 1 hour. The supernatant was discarded, and the plates were washed three times with PBS. 100 μL of DMEM medium was added to each well, and the plates were incubated again. The number of wells showing cytopathic effects was observed and recorded daily for 5-7 days until the number of wells showing cytopathic effects stopped increasing. The TCID of the virus was calculated using the Reed-Muench method. 50 Experimental data are expressed as group means and standard deviations (SD). Statistical analysis was performed using the unpaired, two-tailed Student t-test in GraphPad software; where ** indicates p < 0.01, *** indicates p < 0.001, and **** indicates p < 0.0001.
[0047] The results are as follows Figure 4 As shown, compared with the control group without honokiol (0 μmol / L), the PRRSV viral titers in the treatment groups with 2.5, 5, and 10 μmol / L honokiol decreased in a dose-dependent manner. In particular, the PRRSV viral titer in the treatment group with 10 μmol / L honokiol decreased by more than 1000-fold (reduction in viral titer > 3 log). 10 TCID 50 The result ( / 100μL) indicates that honokiol can significantly inhibit the proliferation of PRRSV virus in MARC-145 cells, further confirming that honokiol can reduce the PRRSV infection dose in MARC-145 cells.
Claims
1. The application of magnolol in the preparation of drugs that inhibit porcine reproductive and respiratory syndrome virus infection.
2. The application as described in claim 1, characterized in that, The application of magnolol in the preparation of drugs that inhibit the viral RNA content of porcine reproductive and respiratory syndrome virus infection.
3. The application as described in claim 1, characterized in that, The application of magnolol in the preparation of drugs that inhibit the abundance of viral proteins in porcine reproductive and respiratory syndrome virus infection.
4. The application as described in claim 1, characterized in that, The application of magnolol in the preparation of drugs that inhibit viral titers of porcine reproductive and respiratory syndrome virus infection.
5. The application as described in any one of claims 1-4, characterized in that, The effective concentration of the drug to neutralize magnolol is 2.5-10 μmol / L.
6. The application as described in claim 5, characterized in that, The effective concentration of magnolol is 10 μmol / L.
Citation Information
Patent Citations
Application of honokiol in treating herpes virus infection
CN107397736A
Traditional Chinese medicine composition for preventing and treating porcine reproductive and respiratory syndrome and preparation method thereof
CN109745477A