A mutant recombinant rosa multiflora polyphenol oxidase and its preparation method and application

Abstract

The application discloses a mutant recombinant Rosa chinensis polyphenol oxidase proenzyme and a preparation method and application thereof. The application provides the preparation method of the mutant recombinin Rosa chinensis polyphenol oxidase proenzyme, realizes efficient soluble expression, and the method is simple, efficient, easy to separate and purify, and suitable for industrial production. Compared with a wild-type enzyme, the enzymatic activity of the mutant recombinant Rosa chinensis polyphenol oxidase is increased by 2.67 times, and the half-life thereof is increased by 2.62 and 3.37 times at 40 and 50 DEG C respectively, indicating that the enzymatic activity and stability of the mutant are significantly improved. The application further provides a biological activation method of the mutant recombinant Rosa chinensis polyphenol oxidase proenzyme, and realizes efficient activation. The activity of the activated mutant is 14.63 times that of the unactivated wild-type enzyme. Compared with the wild-type Rosa chinensis polyphenol oxidase, the mutant enzyme can more efficiently catalyze synthesis of TF1 and other theaflavins, and has a better application prospect in large-scale production of the products.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a mutant recombinant rose polyphenol oxidase precursor, its preparation method, and its application. Background Technology

[0002] Black tea is one of the most popular beverages. Theaflavins and other active substances in black tea give it its pleasant color, aroma, and health benefits. Theaflavins are more stable than tea polyphenols and have better antioxidant, lipid-lowering, and anti-cancer effects; they are also essential functional substances for the formation of theaflavins. However, most black teas contain less than 2% theaflavins, therefore, the development of efficient theaflavin preparation technologies has attracted widespread attention.

[0003] A few manufacturers produce theaflavins using methods such as organic solvent extraction, chemical oxidation, or enzymatic conversion; however, the theaflavin content in these products is low (<53%). Among existing preparation methods, direct extraction is costly, and chemical oxidation is environmentally unfriendly. Enzymatic conversion, using polyphenol oxidase to catalyze the conversion of tea polyphenols into theaflavins, represents the future direction for theaflavin production. The applicant team's previous work has shown that recombinant wild-type rose-derived polyphenol oxidase, once activated, can catalyze the synthesis of theaflavins from tea polyphenols; however, its enzymatic properties are still insufficient to meet the requirements for enzyme preparations in the enzymatic conversion of theaflavins.

[0004] Novel enzymes obtained directly from nature often exhibit low activity and stability, limiting the large-scale application of enzymatic conversion for theaflavins. Molecular modification is an effective means to improve the enzymatic properties of polyphenol oxidases. In 2022, Zhou et al. improved the activity of the mutant enzyme by modifying polyphenol oxidases derived from Bacillus megaterium through directed evolution. However, there are no reports on improving the enzymatic properties of polyphenol oxidases through semi-rational modification. Summary of the Invention

[0005] To address these issues, the primary objective of this invention is to provide a mutant recombinant rose polyphenol oxidase progenitor; the enzyme activity and thermal stability of the mutant recombinant rose polyphenol oxidase progenitor are significantly improved.

[0006] The second objective of this invention is to provide a method for preparing a mutant recombinant rose polyphenol oxidase proenzyme, which achieves efficient and soluble expression of the mutant recombinant rose polyphenol oxidase proenzyme.

[0007] A third objective of this invention is to provide a method for activating a mutant recombinant rose polyphenol oxidase proenzyme, wherein the activated product of the mutant recombinant rose polyphenol oxidase proenzyme obtained by the activation method exhibits strong activity and high catalytic efficiency.

[0008] A fourth objective of this invention is to provide the application of the above-mentioned mutant recombinant rose polyphenol oxidase progeny or its activated product.

[0009] To achieve the above-mentioned objectives, the present invention adopts the following technical solution:

[0010] A mutant recombinant rose polyphenol oxidase proenzyme, the amino acid sequence of which is shown in SEQ ID NO:1. Compared with the amino acid sequence of wild-type recombinant rose polyphenol oxidase proenzyme proenzyme (SEQ ID NO:2), the mutant recombinant rose polyphenol oxidase proenzyme proenzyme proenzyme shown in SEQ ID NO:1 has the following amino acid mutations: leucine at position 471 is mutated to phenylalanine; alanine at position 472 is mutated to lysine; and asparagine at position 632 is mutated to isoleucine. Furthermore, the N-terminus and C-terminus of the amino acid sequence are fused with MBP and His tags, which can significantly improve the solubility of the mutant recombinant rose polyphenol oxidase proenzyme proenzyme and facilitate purification.

[0011] The DNA molecule encoding the aforementioned mutant recombinant rose polyphenol oxidase precursor has the nucleotide sequence shown in SEQ ID NO: 3. This nucleotide sequence was optimized using codons based on the *E. coli* expression system, significantly improving the expression efficiency of the heterologous gene in the host bacterium.

[0012] A recombinant expression vector containing a nucleotide sequence encoding the mutant recombinant rose polyphenol oxidase proenzyme.

[0013] Preferably, the recombinant expression vector contains the nucleotide sequence shown in SEQ ID NO: 3.

[0014] The preparation method of the above-mentioned mutant recombinant rose polyphenol oxidase precursor includes the following steps:

[0015] The nucleotide sequence encoding the mutant recombinant rose polyphenol oxidase proenzyme was cloned into an expression vector to construct a recombinant expression vector; the recombinant expression vector was then transformed into a prokaryotic expression system for induced expression, the bacterial cell precipitate was collected by solid-liquid separation, and the mutant recombinant rose polyphenol oxidase proenzyme was obtained after purification.

[0016] The prokaryotic expression system is preferably an Escherichia coli expression system; more preferably, it is the Escherichia coli expression system BL21(DE3).

[0017] The recombinant expression vector is preferably an expression vector that expresses the protein via the Tac promoter; more preferably, it is an expression vector containing MBP and His tags, and most preferably, it is pMAL-c5x or pMAL-c5x-His, which can greatly increase the solubility of the target protein expression.

[0018] The preferred specific steps for inducing expression are as follows: The positive transformant is inoculated into LB medium containing 50–100 μg / mL ampicillin and cultured. When the bacterial culture OD… 600When the concentration reaches 0.6–0.8, IPTG with a final concentration of 0.1–0.2 mM is added, and the mixture is induced at 15–20 °C for 12–28 h. The mutant recombinant rose polyphenol oxidase proenzyme is then purified.

[0019] The preferred step of inoculating positive transformants in LB medium and culturing them is as follows:

[0020] (1) The positive transformant was cultured in LB medium at 25-40°C overnight with shaking to obtain seed culture;

[0021] (2) Inoculate the seed culture into LB culture medium and culture at 25-40℃ and 150-250r / min.

[0022] The inoculation amount in step (2) is preferably inoculated at a volume ratio of 1:50 to 1:150 with LB culture medium.

[0023] The preferred purification step is as follows: after lysing the cells, collect the supernatant, pass the supernatant through an affinity chromatography column, and elute to obtain the purified mutant recombinant rose polyphenol oxidase proenzyme.

[0024] The preferred step of lysing cells is to lyse cells using ultrasonic disruption under ice bath conditions; more preferably, to resuspend the bacterial cells in buffer A; wherein the buffer A is formulated as 20–50 mM Tris-HCl and 50–200 mM NaCl.

[0025] The preferred dosage of buffer A is 10 mL of buffer A per gram of bacterial cells.

[0026] The preferred conditions for the ultrasonic fragmentation method are: power of 50-300W, ultrasonic time of 1-5s, interval of 1-5s, and duration of 2-50min.

[0027] The preferred step for collecting the supernatant is as follows: after the lysed bacterial cells are frozen and centrifuged, the precipitate is discarded, and the supernatant is obtained by passing the supernatant through a membrane.

[0028] The preferred conditions for the refrigerated centrifugation are centrifugation at 12000 r / min for 30 to 40 min at 4°C.

[0029] The preferred method for filtration is using a 0.45μm microporous membrane.

[0030] The affinity chromatography column is preferably a His-labeled affinity chromatography column.

[0031] The preferred elution method is to first equilibrate with buffer A and then elute with buffer B; the formulation of buffer A is 20-50 mM Tris-HCl and 50-200 mM NaCl; the formulation of buffer B is 20-50 mM Tris-HCl, 50-200 mM NaCl, 100-500 mM imidazole, pH 8.0.

[0032] The above-mentioned method for activating the mutant recombinant rose polyphenol oxidase (i.e., a method for preparing mutant recombinant rose polyphenol oxidase) includes the following steps: the above-mentioned mutant recombinant rose polyphenol oxidase is activated by treatment with 0.1-1 mg / mL, preferably 10-100 μg / mL, most preferably 40 μg / mL trypsin, followed by solid-liquid separation to remove the precipitate, thereby obtaining the activated product of mutant recombinant rose polyphenol oxidase.

[0033] The activation conditions are preferably a temperature of 15–45°C, a time of 10–60 min, and a pH of 3.0–8.0; more preferably a temperature of 25°C, a time of 15 min, and a pH of 8.0.

[0034] The activation is preferably carried out in a buffer solution containing the following components: 50±10mM Tris-HCl and 50±10mM NaCl.

[0035] A mutant recombinant rose polyphenol oxidase proactivator product (i.e. a mutant recombinant rose polyphenol oxidase) is obtained by the above-described method for activating mutant recombinant rose polyphenol oxidase proactivator.

[0036] The application of the above-mentioned mutant recombinant rose polyphenol oxidase proactivator in catalyzing the conversion of tea polyphenols into theaflavins (i.e., the application of the above-mentioned mutant recombinant rose polyphenol oxidase proactivator in the preparation of theaflavins).

[0037] The tea polyphenols mentioned include, but are not limited to, catechins and pyrogallols.

[0038] The catechins include EC and ECg, and the pyrogallols include EGC and EGCg.

[0039] The theaflavins mentioned include theaflavins, theaflavins-3-gallate, theaflavins-3'-gallate, and theaflavins-3,3'-bisgallate.

[0040] The application reaction conditions are a temperature of 10–50°C and a pH of 3.0–7.0; more preferably, a temperature of 30°C and a pH of 5.0 or 5.5.

[0041] The application is carried out in a buffer solution containing the following components: 20-50 mM Na2HPO4-citric acid.

[0042] In the aforementioned application, the amount of the mutant recombinant rose polyphenol oxidase proactivator is calculated based on its concentration in the system as 0.1–1 mg / mL, more preferably 0.6 mg / mL.

[0043] In the aforementioned application, the amount of tea polyphenols used is calculated based on a concentration of 0.5–10 mM in the system; more preferably, it is calculated based on 1–3 mM.

[0044] The reaction in the application is terminated by heating in a boiling water bath for 10-15 minutes.

[0045] The present invention has the following advantages and effects compared with the prior art:

[0046] 1. This invention employs prokaryotic expression and an environmentally friendly and efficient trypsin activation method to obtain a soluble and highly activated mutant recombinant rose polyphenol oxidase proenzyme. The target protein content accounts for more than 60% of the total protein, with a high expression level. Furthermore, a solubilizing MBP tag and an easily expressed His tag are fused to the N-terminus and C-terminus of the target protein, respectively. This not only increases the expression level and solubility of the target protein but also simplifies the isolation and purification of the proenzyme proenzyme, facilitating large-scale expression. Compared with natural extraction methods, this method only requires a simple culture medium as a raw material, making it suitable for industrial production.

[0047] 2. This invention employs a semi-rational modification method to obtain mutant recombinant rose polyphenol oxidase, which significantly improves the activity and stability of recombinant rose polyphenol oxidase.

[0048] 3. The mutant recombinant rose polyphenol oxidase showed superior efficiency in catalyzing the synthesis of theaflavins compared to the wild-type recombinant rose polyphenol oxidase. Specifically, the yield of TF1 under the catalysis of the mutant recombinant rose polyphenol oxidase was significantly increased, reaching 70.65%. Attached Figure Description

[0049] Figure 1 This is an SDS-PAGE image of the mutant recombinant rose polyphenol oxidase proenzyme; lane 1 is the purified mutant protein, and lane M is the marker.

[0050] Figure 2 This is a graph showing the relative activities of recombinant rose polyphenol oxidase before and after activation.

[0051] Figure 3 This is a graph showing the relative activities of recombinant rose polyphenol oxidase before and after mutation.

[0052] Figure 4 This is a graph showing the relative activity of the unactivated wild type and the activated mutant.

[0053] Figure 5The images show the thermal inactivation curves of the recombinant rose polyphenol oxidase before and after mutation at 40 and 50 °C, respectively.

[0054] Figure 6 The liquid chromatograms show the conversion of tea polyphenol substrates into four major theaflavins catalyzed by mutant recombinant rose polyphenol oxidase. Detailed Implementation

[0055] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0056] Unless otherwise specified, all reagents and raw materials used in this invention are commercially available products or products that can be prepared by known methods.

[0057] Example 1 describes the construction of a recombinant vector containing a nucleotide sequence encoding a mutant recombinant rose polyphenol oxidase, comprising the following steps:

[0058] (1) Based on the nucleotide sequence of the mutant recombinant rose polyphenol oxidase progenitor, the codons of the Escherichia coli expression system were optimized, and the gene of the mutant recombinant rose polyphenol oxidase progenitor was synthesized to obtain a DNA molecule that can be efficiently expressed in Escherichia coli, as shown in SEQ ID NO: 3.

[0059] (2) Construction of pMAL-c5x-His vector:

[0060] The gene fragment “GTCGACAAGC TTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACGGATCC” was inserted into the pMAL-c5x vector (provided by Guangzhou Yingzan Biotechnology Co., Ltd.) through two restriction sites, NdeI:CATATG and BamHI:GGATCC. The resulting pMAL-c5x-His vector can express the target protein with the His tag.

[0061] (3) The DNA molecule encoding the mutant recombinant rose polyphenol oxidase precursor was homologously recombinated with the expression vector pMAL-c5x-His:

[0062] Based on the mutant recombinant rose polyphenol oxidase progenitor gene sequence, the primer sequences were synthesized as follows: PF1: CACATAT GGCGCCAGTGCCACCGCC; PR1: TTGTCGACGGTAGTCGTTATTAACT. The DNA molecule encoding the mutant recombinant rose polyphenol oxidase progenitor was amplified using PCR technology. Using the artificially synthesized DNA molecule encoding the mutant recombinant rose polyphenol oxidase progenitor as a template, 25 μL of 2×PfuMaxHiFiPCRProMix (manufactured by Guangzhou Yingzan Biotechnology Co., Ltd., EnzyValley, catalog number P217), 1 μL each of forward and reverse primers PF1 and PR1, and an appropriate amount of sterile water were added for PCR amplification. The amplification conditions were: 98℃ for 30 s; 98℃ for 10 s, 55℃ for 30 s, 72℃ for 90 s, for a total of 30 cycles; 72℃ for 5 min. The target gene fragment of approximately 1.5 kb was recovered by agarose gel electrophoresis.

[0063] Based on the pMAL-c5x-His vector sequence, the primer sequences were synthesized as follows: ZF1: CGACTACCGTCGACAAGCTTGCGGC; ZR1: ACTGGCGCCATATGTGAAATCCTTC. Linearized plasmid DNA was generated using vector-specific primers ZF1 and ZR1. The mutant recombinant rose polyphenol oxidase progenitor gene was homologously recombinated with the linearized pMAL-c5x-His plasmid using the HiPro DNA Homologous Recombination Cloning Kit to obtain the recombinant plasmid. The recombinant expression vector was then transformed into *E. coli* DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.).

[0064] (4) Select single colonies for colony PCR identification, and send positive single clones to a sequencing company for sequencing verification to confirm the correctness of the DNA molecule encoding recombinant rose polyphenol oxidase. Culture and verify the correct competent cells, and extract plasmids. The obtained plasmids are recombinant vectors containing DNA molecules encoding mutant recombinant rose polyphenol oxidase.

[0065] Example 2: Expression and identification of mutant recombinant rose polyphenol oxidase proenzyme in recombinant Escherichia coli

[0066] The recombinant vector obtained in Example 1 was transformed into host cells *Escherichia coli* BL21(DE3) (purchased from Shanghai Weidi Biotechnology Co., Ltd.). Positive *E. coli* transformants were selected and inoculated into LB medium containing 100 μg / mL ampicillin. The culture was incubated overnight at 37°C with shaking to obtain the seed culture. The seed culture was then inoculated into LB medium containing 100 μg / mL ampicillin at a volume ratio of 1:100 and cultured at 37°C and 200 rpm until the bacterial culture reached OD500. 600Once the concentration reaches 0.6, IPTG is added to each bacterial culture to a final concentration of 0.15 mM and inducing expression at 18°C ​​for 18 h. The bacterial cell pellet is then collected by centrifugation.

[0067] Take 1 mL of bacterial culture before and after IPTG induction, centrifuge at 12000 rpm for 1 min, collect the precipitate, add 150 μL of buffer A (50 mM Tris-HCl, 50 mM NaCl, pH 8.0), vortex until homogeneous, and sonicate on ice (sonication conditions: 220 W, 1 s sonication, 2 s interval, total time 45 min), centrifuge and collect the supernatant. Add 150 μL of buffer A to the precipitate and resuspend by vortexing. Perform SDS-PAGE analysis on the supernatant and precipitate suspension to observe protein expression. SDS-PAGE electrophoresis showed that soluble mutant recombinant rose polyphenol oxidase was expressed in the induced E. coli cells.

[0068] Example 3: Purification of mutant recombinant rose polyphenol oxidase proenzyme

[0069] The recombinant vector obtained in Example 1 was transformed into host cells *Escherichia coli* BL21(DE3). Positive *E. coli* transformants were selected and inoculated into LB medium containing 100 μg / mL ampicillin. The mixture was cultured overnight at 37°C with shaking to obtain the seed culture. The seed culture was then inoculated into LB medium containing 100 μg / mL ampicillin at a volume ratio of 1:100 and cultured at 37°C and 200 rpm until the bacterial growth rate reached OD500. 600 Once the concentration reaches 0.6, add IPTG to each bottle of bacterial culture to a final concentration of 0.15 mM. Induce expression at 18°C ​​for 16 h, then centrifuge to collect the bacterial cell pellet and freeze at -20°C for later use.

[0070] Take 1 L of the fermentation broth and collect the frozen bacterial cells. Resuspend the cells in 10 mL of buffer A (50 mM Tris-HCl, 50 mM NaCl, pH 8.0) per gram of cells. Lyse the cells using an ultrasonic cell disruptor on ice. The sonication conditions are: 220 W, 1 s sonication, 2 s interval, total time 45 min. Place the lysed cells in a high-speed refrigerated centrifuge and centrifuge at 12000 rpm for 30 min at 4 °C. Collect the supernatant and filter it through a 0.45 μm microporous membrane for later use.

[0071] The supernatant was filtered using a 0.45 μm microporous membrane, specifically a His Trap filter. TMThe target protein was separated using a 5 mL HP chromatography column (purchased from GE Healthcare). The specific separation procedure was as follows: The column was connected to the column position valve of a rapid protein purification instrument. After washing the system and column with ultrapure water, the column was equilibrated with 5 column volumes of equilibration buffer A. The supernatant was loaded onto the column using a sample pump, and contaminating proteins were eluted with equilibration buffer A. Linear elution was then performed using a linearly proportioned elution buffer B (50 mM Tris-HCl, 50 mM NaCl, 500 mM imidazole, pH 8.0). The elution peak was detected using SDS-PAGE, and the elution peak fraction containing the target protein was collected. The protein concentration was determined using a BCA protein assay kit. The collected volume was 4.5 mL, with a concentration of 5.6 mg / mL, equivalent to 25 mg of recombinant rose polyphenol oxidase proenzyme purified from 1 L of fermentation broth. A 10 μL sample was taken and analyzed by SDS-PAGE protein electrophoresis.

[0072] The results are as follows Figure 1 As shown, the obtained mutant recombinant rose polyphenol oxidase precursor is a highly pure protein. The band at the 100.0 kDa position in the eluent is the mutant recombinant rose polyphenol oxidase precursor. This invention only requires one His-tag affinity chromatography to obtain electrophoretically pure mutant recombinant rose polyphenol oxidase precursor, without the need for other purification steps (such as ion exchange resin). Furthermore, SDS-PAGE grayscale analysis shows that the target protein content in this invention accounts for more than 60% of the total protein, indicating high expression levels.

[0073] Example 4: Activation of mutant recombinant rose polyphenol oxidase proenzyme

[0074] The recombinant vector obtained in Example 1 was transformed into host cells *Escherichia coli* BL21(DE3). Positive *E. coli* transformants were selected and inoculated into LB medium containing a small amount of 100 μg / mL ampicillin. The mixture was cultured overnight at 37°C with shaking to obtain the seed culture. The seed culture was then inoculated into LB medium containing 100 μg / mL ampicillin at a volume ratio of 1:100 and cultured at 37°C and 200 rpm until the bacterial growth rate reached OD500. 600 To reach a concentration of 0.6, IPTG was added to each vial of bacterial culture to a final concentration of 0.15 mM. Expression was induced at 18°C ​​for 16 h, followed by centrifugation to collect the bacterial cell precipitate. The mutant recombinant rose polyphenol oxidase precursor was isolated and purified according to the steps described in Example 3 and stored at 4°C for later use.

[0075] The mutant recombinant rose polyphenol oxidase proenzyme was activated at 25°C with 0.04 mg / mL trypsin in buffer (50 mM Tris-HCl, 50 mM NaCl, pH 8.0) for 15 min. The reaction was terminated by adding 12 μM aprotinin, and the precipitate was removed by centrifugation, yielding the activated mutant recombinant rose polyphenol oxidase proenzyme product with high oxidative activity. The activated product was further purified using an MBP-tagged chromatography column and a dextran gel column. A 10 μL sample was analyzed by SDS-PAGE protein electrophoresis.

[0076] Example 5: Enzyme activity test of mutant recombinant rose polyphenol oxidase progeny

[0077] The mutant recombinant rose polyphenol oxidase proenzyme obtained in Example 3 was activated at 25°C with 40 μg / mL trypsin in buffer (50 mM Tris-HCl, 50 mM NaCl, pH 8.0) for 15 min. The reaction was terminated by adding 12 μM aprotinin, and the precipitate was removed by centrifugation, yielding the activated mutant recombinant rose polyphenol oxidase proenzyme product with high oxidative activity. The activated product was further purified using an MBP-tagged chromatography column and a dextran gel column.

[0078] The purified mutant recombinant rose polyphenol oxidase proactivator was used to determine enzyme activity according to the following method. At 37℃, using 50 mM citrate-disodium hydrogen phosphate buffer (pH 5.0), 50 μg / mL of activated enzyme, and 25 mM catechol as the reaction system, the absorbance was measured at 420 nm. Timing began after the enzyme solution was added, and absorbance was recorded every 30 seconds for a total detection time of 15 min. The linear portion of the activity curve was used as a function of time to measure enzyme activity. Under the above conditions, the amount of enzyme required to release 1 μmol of quinone per minute was defined as one unit of enzyme activity (U). Samples were measured in triplicate.

[0079] The results are as follows Figure 2 As shown, compared with the unactivated mutant recombinant rose polyphenol oxidase, the activated product of the mutant recombinant rose polyphenol oxidase showed significantly enhanced activity; this further demonstrates that the activation method can successfully activate the mutant recombinant rose polyphenol oxidase.

[0080] In addition, such as Figure 3 As shown, compared with wild-type recombinant rose polyphenol oxidase, the activity of mutant recombinant rose polyphenol oxidase was significantly increased, reaching 2.65 times that of wild-type recombinant rose polyphenol oxidase.

[0081] And as Figure 4As shown, compared with the unactivated wild-type recombinant rose polyphenol oxidase, the activated mutant recombinant rose polyphenol oxidase showed a significant increase in activity, reaching 14.63 times the activity of the unactivated wild-type oxidase. Its final enzyme activity was 12347.77 U / L of fermentation broth.

[0082] Example 6: Determination of the half-life of wild-type and mutant recombinant rose polyphenol oxidase at 40 and 50 °C

[0083] The wild-type and mutant recombinant rose polyphenol oxidases obtained after activation in Example 4 were incubated at 40 and 50 °C, and the changes in enzyme activity were detected after one hour. The thermal inactivation half-life of the enzyme was defined as the time it takes for the enzyme to lose half of its initial activity at a specific temperature. The results are shown in Table 1. Compared with the wild-type recombinant rose polyphenol oxidase, the mutant recombinant rose polyphenol oxidase showed significantly increased thermal inactivation half-lives at 40 and 50 °C, which were 2.62 and 3.37 times that of the wild-type enzyme, respectively.

[0084] Table 1. Thermodynamic parameters of wild-type and mutant recombinant rose polyphenol oxidase

[0085]

[0086] In addition, such as Figure 5 As shown, compared with wild-type recombinant rose polyphenol oxidase, mutant recombinant rose polyphenol oxidase exhibits significantly higher activity at the same incubation time point at 40 and 50℃, indicating that mutant recombinant rose polyphenol oxidase has higher stability.

[0087] Example 7 Wild-type and mutant recombinant rose polyphenol oxidase catalyzes the synthesis of theaflavins from tea polyphenols.

[0088] (1) HPLC detection conditions for theaflavins: Waters C18 column (XBridge) TM The BEH130 column (4.6mm × 250mm, 5μm) was used with a detection wavelength of 280nm. Gradient elution was employed, with mobile phase B decreasing linearly from 18% to 30% over 30 min, and remaining constant at 30% from 30 to 40 min. Phase A consisted of 2% acetic acid, and phase B consisted of acetonitrile:ethyl acetate in a 7:1 ratio. The column temperature was 40℃, the flow rate was 0.8 mL / min, and the injection volume was 20 μL.

[0089] (2) Standard curves for four types of tea polyphenols and four types of theaflavins: Four standard solutions of tea polyphenols with concentrations of 0.1, 0.2, 0.3, 0.4 and 0.5 mg / mL and four standard solutions of theaflavins with concentrations of 10, 20, 50, 100 and 200 μg / mL were prepared respectively. After HPLC analysis, the peak areas were measured and standard curves were plotted.

[0090] (3) The activation products of wild-type and mutant recombinant rose polyphenol oxidase prepared in Example 4 were used as the reaction system at 30°C with 50 mM citrate-disodium hydrogen phosphate buffer (pH 5.0 or 5.5), 0.6 mg / mL of activation enzyme, 1 mM catechin (EC or ECg), and 1 or 3 mM pyrogallol (EGC or EGCg). The reaction was carried out at 30°C and 180 r / min for 30 or 40 min, and then the reaction was terminated by heating in a boiling water bath for 10 min. The reaction solution was collected, filtered through a 0.22 μm filter membrane, and the formation of the four major theaflavins was analyzed by HPLC. The proportion of the four major tea polyphenols in the substrate and the concentration of the four major synthetic theaflavins were calculated according to the standard curve. All enzymatic reaction experiments were repeated three times, and the results are expressed as the mean ± standard deviation of the three experiments.

[0091] Table 2 Synthesis of four theaflavins monomers catalyzed by wild-type and mutant recombinant rose polyphenol oxidase.

[0092]

[0093] like Figure 6 As shown, after the mutant recombinant rose polyphenol oxidase catalyzes the purification of catechin substrates, the product composition mainly includes theaflavins (TF1), theaflavins-3-gallate (TF2A), theaflavins-3'-gallate (TF2B), and theaflavins-3,3'-digallate (TF3). Compared with wild-type recombinant rose polyphenol oxidase, the mutant recombinant rose polyphenol oxidase catalyzes the synthesis of TF1, TF2B, and TF3 with increased contents of 109.9, 31.7, and 16.9 μM, respectively. Among them, the yield of TF1 under the catalysis of mutant recombinant rose polyphenol oxidase reached 70.65% (Table 2). This indicates that the mutant recombinant rose polyphenol oxidase has higher potential for enzymatic synthesis of theaflavins.

[0094] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A mutant recombinant rose polyphenol oxidase precursor, characterized in that: Its amino acid sequence is shown in SEQ ID NO:

1.

2. A DNA molecule encoding the mutant recombinant rose polyphenol oxidase proenzyme as described in claim 1, characterized in that: Its nucleotide sequence is shown in SEQ ID NO:

3.

3. A recombinant expression vector, characterized in that: It contains a nucleotide sequence encoding the mutant recombinant rose polyphenol oxidase proenzyme as described in claim 1.

4. The method for preparing the mutant recombinant rose polyphenol oxidase proenzyme as described in claim 1, characterized in that: Includes the following steps: The nucleotide sequence encoding the mutant recombinant rose polyphenol oxidase proenzyme was cloned into an expression vector to construct a recombinant expression vector; the recombinant expression vector was then transformed into a prokaryotic expression system for induced expression, the bacterial cell precipitate was collected by solid-liquid separation, and the mutant recombinant rose polyphenol oxidase proenzyme was obtained after purification.

5. The method for preparing the mutant recombinant rose polyphenol oxidase proenzyme according to claim 4, characterized in that: The prokaryotic expression system is the Escherichia coli expression system BL21(DE3); The expression vector is pMAL-c5x or pMAL-c5x-His; The specific steps for inducing expression are as follows: Positive transformants are inoculated into LB medium containing 50–100 μg / mL ampicillin and cultured until the bacterial culture reaches OD500. 600 When the concentration reaches 0.6–0.8, IPTG with a final concentration of 0.1–0.2 mM is added, and the mixture is induced at 15–20°C for 12–28 h. The mutant recombinant rose polyphenol oxidase proenzyme is then obtained through purification. The steps for inoculating positive transformants into LB medium and culturing them are as follows: The positive transformant was cultured overnight in LB medium with shaking at 25–40°C to obtain seed culture; The seed culture was inoculated into LB culture medium and cultured at 25–40°C and 150–250 r / min. The inoculation volume ratio of the seed culture to the LB culture medium was 1:50 to 1:

150. The purification steps are as follows: after lysing the cells, the supernatant is collected, and the supernatant is passed through an affinity chromatography column and eluted to obtain the purified mutant recombinant rose polyphenol oxidase proenzyme. The cell lysis steps are as follows: the bacterial cell pellet is resuspended using buffer A, and then the resuspended solution is lysed by sonication in an ice bath. The formulation of buffer A is 20-50 mM Tris-HCl and 50-200 mM NaCl; the amount of buffer A used is 10 mL of buffer A per gram of bacterial cells. The conditions for the ultrasonic fragmentation method are: power of 50-300W, ultrasonic time of 1-5s, interval of 1-5s, and duration of 2-50min. The steps for collecting the supernatant are as follows: after the lysed bacterial cells are frozen and centrifuged, the precipitate is discarded, and the supernatant is obtained by membrane filtration; the frozen centrifugation conditions are 12000 r / min for 30-40 min at 4℃; the membrane filtration is performed using a 0.45 μm microporous membrane; and the affinity chromatography column is a His-tagged affinity chromatography column.

6. The activation method of the mutant recombinant rose polyphenol oxidase proenzyme as described in claim 1, characterized in that: The process includes the following steps: the mutant recombinant rose polyphenol oxidase proenzyme is activated by treatment with 0.1-1 mg / mL trypsin, followed by solid-liquid separation to remove the precipitate, thereby obtaining the mutant recombinant rose polyphenol oxidase proenzyme activated product. The activation conditions are a temperature of 15–45°C, a time of 10–60 min, and a pH of 3.0–8.

0. The activation was performed in a buffer solution containing 50±10 mM Tris-HCl and 50±10 mM NaCl.

7. A mutant recombinant rose polyphenol oxidase proactivator product, characterized in that: It is obtained by the mutant recombinant rose polyphenol oxidase proactivation method described in claim 6.

8. The application of the mutant recombinant rose polyphenol oxidase proactivator product as described in claim 7 in catalyzing the conversion of tea polyphenols into theaflavins.

9. The application of the mutant recombinant rose polyphenol oxidase proactivator product according to claim 8 in the catalytic conversion of tea polyphenols to theaflavins, characterized in that: The theaflavins mentioned include theaflavins, theaflavins-3-gallate, theaflavins-3'-gallate, and theaflavins-3,3'-bisgallate; The reaction conditions for the application are a temperature of 10–50°C and a pH of 3.0–7.

0. The application is carried out in a buffer solution containing the following components: 20–50 mM Na2HPO4-citric acid; In the aforementioned applications, the amount of the recombinant rose polyphenol oxidase proactivator is calculated based on its concentration in the system as 0.1–1 mg / mL. In the aforementioned application, the amount of tea polyphenols used is calculated based on their concentration in the system being 0.5–10 mM.

Images