A method for constructing a homozygous mutant of the Yellow Protein gene, a body color marker gene of locust males, and its application

Abstract

The present invention belongs to the field of genetic engineering technology, and relates to pest control, in particular to a method for constructing a marker gene for the body color of male locusts. Yellow Protein Method and application of homozygous mutant. YP For the purpose of gene sequence identification and functional study, the migratory locust genome sequence and RACE technology were used to clone the migratory locust. YP Full-length gene sequence and expression profile identification YP The gene is highly expressed in the head, cuticle, and dorsal plate of adult locusts. YP The gene was knocked out and the migratory locust was constructed through screening. YP Homozygous mutants. When the mutants emerged as adults, males showed no yellowing compared to wild-type adults. Bioassays revealed decreased courtship and mating behavior, including refusal to mate. This further confirmed the functional loss of the YP gene in the YP homozygous mutants. The construction of YP homozygous mutants provides insights into phenotypic marker genes and their function for other locust studies, and also provides a theoretical basis and potential for the green control of locusts.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and relates to pest control, in particular to a method for constructing a marker gene for the body color of male locusts. Yellow Protein Methods for homozygous mutants and their applications. Background Art

[0002] East Asian migratory locust ( Locusta migratoria The East Asian migratory locust (Locusta linnaeus), belonging to the order Orthoptera, superfamily Acridoidea, family Oedipodidae, and genus Locusta, is a significant agricultural pest in my country and the primary cause of locust plagues. The East Asian migratory locust is a hemimetabolous insect with a generation cycle consisting of egg, nymph, and adult stages. Adults exhibit gregarious migratory behavior, and both nymphs and adults primarily feed on grasses and sedges, such as corn and millet.

[0003] Locust plagues are a long-term and widespread agricultural biological disaster worldwide. Nearly half of the world's countries and land have been affected by locust plagues, causing great losses to food production, forests and pastures, and people's health. Among them, locust plagues in countries such as Africa and Asia are more frequent and severe.

[0004] Currently, the primary control measure for the East Asian migratory locust remains chemical pesticides, primarily organophosphorus pesticides, pyrethroids, and flubendiamide. While chemical control offers advantages such as rapidity, high efficiency, and ease of use, long-term use has led to the development of severe pesticide resistance in the East Asian migratory locust, significantly reducing its effectiveness and causing a sharp increase in pesticide residues in grain, vegetables, and fruits. This not only reduces crop yield and quality but also seriously harms human health. Therefore, new, pollution-free control methods are urgently needed for the East Asian migratory locust.

[0005] The genetic regulation technique (GRT) of pest populations utilizes the key genes for the growth and development of the pests themselves, adopts a sex control switch, and through genetic transformation, transforms male insects into carriers of genetic control complexes (a complex of sex switch elements and target genes) that cause abnormal development of female offspring or female infertility. Genetic regulation technology is the future direction of pest control. Genome editing technology is an important means of studying the gene function of insects. Using genome editing technology to screen and study the function of target genes, the genetic regulation strain of the East Asian migratory locust is constructed, which provides theoretical and application value for the prevention and control of the East Asian migratory locust and lays the foundation for the prevention and control of agricultural pests. Genetic regulation technology of migratory locusts based on gene editing and transgenics is a research direction for green control of migratory locusts. UKAs a key gene in the development of locust body color, its gene function affects the normal courtship and mating function of locusts. It is also a gene expressed specifically in males and females, and has potential application value in the specific prevention and control of male and female locust pests.

[0006] At present, insect genetic regulation technology is one of the development directions of green pest control in the future. However, as a major migratory agricultural pest in the world, the migratory locust lacks exploration and research on genetic regulation technology. The application with publication number CN113981008A discloses a method for preparing a homozygous mutant of the migratory locust Lmzen, an RNP complex and its application. The Lmzen gene is a gene involved in multiple processes such as multinucleation of serosal cells, formation of serosal epidermis and expression of epidermal chitin synthase genes. Interference with the expression of the Lmzen gene will significantly affect the growth and development of the locust epidermis and morphology and further cause death and egg development. The patent interferes with the expression of the Lmzen gene, which leads to the death of contemporary migratory locusts. In order to further explore the key genes in migratory locusts and screen locust genes suitable for green control, our research group conducted in-depth research. Summary of the Invention

[0007] In order to solve the above technical problems, the present invention proposes a method for constructing a marker gene for the body color of locust males. Yellow Protein Method and application of homozygous mutant, this application uses locust UK The construction of genetic homozygotes verified the necessary functional genes in the courtship and mating of male locusts, laying a technical foundation for the green prevention and control of locusts.

[0008] The technical solution of the present invention is achieved as follows:

[0009] A method for constructing a marker gene for the body color of male locusts Yellow Protein ( UK ) A method for producing a homozygous mutant, comprising the following steps:

[0010] (1) Observing the body color of adult locusts after emergence, we found that males turned yellow specifically, while females did not. We used RACE technology to amplify and clone the locust. UK Gene sequence and verification UK expression trends;

[0011] (2) In locusts UK sgRNA target sequences were designed from exons 2 and 5 of the gene sequence. Target sgRNAs were synthesized by in vitro transcription and fused with Cas9 protein to form an RNP mixture in vitro. The RNP mixture was then injected into locust eggs using a locust embryo microinjection platform.

[0012] (3) Extract the genome of the locust mutant individual, use the target detection primer to perform PCR on the target, and send it to the company for sequencing; after confirming the mutant individual, hybridize it with the wild-type individual to obtain the G1 generation, use the same detection steps to confirm the G1 generation mutant individual, hybridize the G1 generation mutant individual with the wild-type individual to obtain the G2 generation individual, after the G2 generation individual mutation is successfully detected, self-pollinate the male and female individuals with the same mutation type to obtain the G3 generation individual, screen the homozygous mutants in the G3 individual through detection, and obtain after self-pollination UK Homozygous mutant population.

[0013] In the above step (1), locusts Yellow Protein The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0014] above UK The nucleotide sequence of the target site of exon 2 of the gene is shown in SEQ ID No. 2: 5′-CCTCACGGTGCAGCTCGACGACC -3′; UK The nucleotide sequence of the target site of exon 5 of the gene is shown in SEQ ID No. 3: 5'-CCGCAGACGTCGAACCCGGCAGC-3'.

[0015] In step (2), microinjection was first performed using in vitro transcribed sgRNA and Cas9 protein, both at a final concentration of 300 ng / μL, into eggs laid by locusts less than 1 hour after their incubation at a temperature of 33±1°C and a relative humidity of 40%.

[0016] The target detection primers in step (3) above are as follows:

[0017] The nucleotide sequence of LmYP-GF is shown in SEQ ID No. 4: 5′-TGGAGACCGCAGCTGCCATC-3′;

[0018] The nucleotide sequence of LmYP-GR is shown in SEQ ID No. 5: 5'-CGGCTTCAGGTCCTGCACCA-3'.

[0019] The above mutation detection success refers to genes with double peaks at the sgRNA target site.

[0020] The present application also performs the following tests on homozygous mutants of or:

[0021] ①Use qPCR and Western blot to analyze homozygous mutants UK Expression detection and confirmation UK Loss of gene function.

[0022] ② Take photos of homozygous mutant individuals and verify with bioassays UK Homozygous courtship and mating behavior.

[0023] Locust constructed using the above method Yellow Protein Application of homozygous mutants in controlling locust pests and diseases.

[0024] locusts Yellow Protein Application of genes in producing male locusts with low mating desire.

[0025] locusts Yellow Protein The application of genes as marker genes in locusts is to make locusts missing Yellow Protein Gene, resulting in male locusts with yellow body color.

[0026] The present invention has the following beneficial effects:

[0027] 1. The migratory locust (Locusta migratoria) is a significant agricultural pest that has caused significant losses to agricultural production in my country and around the world since ancient times. It is a major crop pest in my country and is listed as one of the ten pests in the "List of Category I Crop Pests and Diseases" published by the Ministry of Agriculture and Rural Affairs in 2023. Effective pest control methods for migratory locusts are lacking. With the continuous development and application of gene editing and transgenic technologies, the construction of homozygous lines of migratory locust gene mutations based on gene editing technology provides potential reference and application value for the green control of migratory locusts.

[0028] 2. Gene editing technology continues to advance in insect gene function research and has become a widely used biotechnology. A good marker gene is crucial for monitoring gene editing efficiency. The YP gene in the migratory locust is a color development gene specifically expressed in males. By constructing homozygous YP locusts, it was found that male homozygous YP males do not change in color, facilitating the screening and maintenance of mutant strains. This makes it a highly phenotypic marker gene and offers potential applications in research on other insects.

[0029] 3. The courtship and mating behavior of insects is necessary for them to reproduce and expand their population. UK Loss of gene function results in significantly lower male mating desire than wild-type locusts, leading to a significant reduction in the mating success rate of YP homozygotes. YP is also a male-specific gene with high expression, suggesting its importance to males. Loss of this gene specifically reduces mating desire in males, providing a target gene for male-specific genetic manipulation in locusts and providing technical insights for constructing gene-edited homozygous mutants in other pests and non-model organisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0031] Figure 1 Comparison of body color development trends of male and female migratory locusts before and after sexual maturity. Scale bar = 1 cm.

[0032] Figure 2 Migratory locust UK Full-length gene sequence map.

[0033] Figure 3 Migratory locust UK Schematic diagram of gene structure.

[0034] Figure 4 Migratory locust UK Protein evolutionary tree analysis diagram.

[0035] Figure 5 Lm UK Expression profile analysis diagram in different stages and tissues of migratory locusts; A: LmYP Gene expression profiles in male and female locusts at different stages. L1-L5 represent nymphs from 1st to 5th instar, and A1-A30 represent adults from 1st to 30th day. B: LmYP The expression profiles of genes in different tissues on the 15th day of the adult stage of locusts: Head; Dorsal; FG; MG; HG; Hemolymph; FB; Epi; MT; Gonad; testis / ovary.

[0036] Figure 6 CRISPR / Cas9-mediated migratory locust UK Gene mutation detection diagram of the G0 generation.

[0037] Figure 7 Migratory locust UK Schematic diagram of the construction of homozygous gene mutants.

[0038] Figure 8 Migratory locust UK Peak graph results of homozygous mutant gene mutation detection.

[0039] Figure 9 Migratory locust UK Peak graph results of gene mutation detection of homozygous and heterozygous mutants.

[0040] Figure 10 Migratory locust UKFigure 2 shows the phenotype and expression level detection results of homozygous mutants.

[0041] Figure 11 Migratory locust UK Statistical results of bioassay of homozygous mutants. DETAILED DESCRIPTION

[0042] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0043] A method for constructing a marker gene for the body color of male locusts Yellow Protein The method and application of homozygous mutants comprises the following steps:

[0044] (1) Observing the body color of adult locusts after they have emerged from their pupae, it was found that the males turned yellow specifically, while the females did not have this characteristic.

[0045] (2) Locust migratory locusts were cloned using RACE technology Yellow Protein Gene sequence and verification UK expression trends.

[0046] (3) In locusts UK sgRNA target sequences were designed for exons 2 and 5 of the gene sequence. Target sgRNAs were synthesized by in vitro transcription and fused with Cas9 protein to form an RNP mixture. The RNP mixture was then injected into locust eggs using a locust embryo microinjection platform. First, the in vitro transcribed sgRNA and Cas9 protein were injected at a final concentration of 300 ng / μL into eggs less than one hour after they were laid. Culture conditions were 33 ± 1°C and 40% relative humidity.

[0047] UK The target site of gene 1 is 5′- CCTCACGGTGCAGCTCGACGACC -3′;

[0048] UK The target site of gene No. 2 is 5'-CCGCAGACGTCGAACCCGGCAGC-3'.

[0049] (4) Extract the genome of the locust mutant individual, use the target detection primer to perform PCR on the target, and send it to the company for sequencing. After confirming the mutant individual, hybridize it with the wild-type individual to obtain the G1 generation. Use the same detection steps to confirm the G1 generation mutant individual. After hybridizing the G1 generation mutant individual with the wild-type individual, obtain the G2 generation individual. After the G2 generation individual mutation is successfully detected, self-fertilize the male and female individuals with the same mutation type to obtain the G3 generation individual. Through detection, screen the homozygous mutants in the G3 individuals, and obtain after self-fertilization. UK Homozygous mutant population.

[0050] Target detection primers are as follows:

[0051] LmYP-GF: 5'-TGGAGACCGCAGCTGCCATC-3';

[0052] LmYP-GR: 5'-CGGCTTCAGGTCCTGCACCA-3'.

[0053] The mutation detection method is as follows:

[0054] a. Egg stage detection:

[0055] After the fifth day of injection, 4-8 eggs in good development can be taken from each culture dish and placed in a 1.5 mL centrifuge tube. The egg stage genome can be extracted using the Animal Genomic DNA Rapid Extraction Kit from Sangon. Since the eggs themselves are easily broken, they can be directly crushed with a pipette tip to facilitate subsequent lysis.

[0056] Adult stage detection:

[0057] After the locusts emerge, several male and female locusts are selected for antennae clipping and testing. The antennae genome is extracted using the alkaline lysis method. The specific method is as follows:

[0058] For each locust, only one side of the antennae (about 1 cm) was cut and placed directly in a 1.5 mL centrifuge tube. 45 μL of 50 mM NaOH was added and the tube was incubated at 95°C in a metal bath for 60 min. Then, 5 μL of 1 M Tris-HCl (PH=8.0) was added and the mixture was vortexed to mix. The supernatant was collected by centrifugation to obtain the antennal genome.

[0059] Sequencing to detect mutations

[0060] Mutation detection primers were designed using NCBI, and the target fragment was amplified using the Phanta enzyme. The amplified PCR product was then subjected to gel electrophoresis. A bright, single band with a slightly lower base length compared to the control (wild-type) was selected (a successful knockout would indicate a decrease in base length). The DNA was then extracted from the gel using the Norwegian FastPure Gel DNA Extraction Mini Kit according to the manufacturer's instructions, and then sent to a sequencing company for sequencing. If the sequencing results lack double peaks and a certain number of bases are missing near the target site when compared to the wild-type genome, the knockout was successful. If the sequencing results show double peaks starting at the target site, TA cloning is required (TOPO universal vectors are sufficient, using Trans5a competent cells). The sequencing results of the single clones were then compared to the original sequence to confirm the knockout success.

[0061] The PCR method is as follows:

[0062] The interference fragment DNA template was amplified using Novozymes 2×Phanta Max Master Mix. The reaction system and procedure are as follows:

[0063] Table 1 PCR reaction system

[0064]

[0065] Table 2 PCR reaction procedure

[0066]

[0067] (5) qPCR and Western blot were used to analyze the homozygous mutants. UK Expression detection and confirmation UK Loss of gene function. qPCR was used to detect RNA expression in mutant individuals, and Western blot was used to detect protein expression in mutant individuals.

[0068] (6) Take photos of homozygous mutant individuals and verify using bioassays UK Homozygous courtship and mating behavior. UK Competitive mating test was performed between homozygotes and wild type to confirm UK Loss-of-function phenotype of homozygous mutations.

[0069] The specific steps are as follows:

[0070] Example 1

[0071] 1. Analysis of the trend of locust body color dimorphism

[0072] To identify the growth and development trends in the body color of male and female locusts, we observed locusts during their larval and adult stages, recording color changes and developmental trends. Locust larvae have five instars, and the transition from first-instar larvae to adulthood takes approximately 15-20 days. During adulthood, males reach sexual maturity and engage in courtship and mating in approximately 5-8 days; females, on the other hand, take longer to mature, generally taking about 7-9 days. Recording the body color of locusts during their larval and adult stages revealed no significant differences between male and female larvae. Upon emergence and adulthood, the coloration of males and females becomes grayish-white with black, with lighter markings on the wings and abdomen.

[0073] As they grow and develop, males and females gradually enter sexual maturity. Comparison shows that there is no obvious change in females before and after maturity. The ventral, thoracic and head sides of males gradually turn yellow. About 15 days after eclosion, the abdomen, thorax, head and legs of male locusts appear bright yellow. At this time, both males and females enter the peak mating period. About 20 days after eclosion, the male's body is bright yellow, while the female's is light yellow. There is no obvious change before and after comparison. About 30 days after eclosion, the male's body gradually darkens, and the yellow is not very bright, while the female's body turns dark black (such as Figure 1 shown).

[0074] The above-mentioned body color development records prove that there is obvious sexual dimorphism in the body color of locusts, and it appears specifically when the male locusts emerge from their cocoons and enter sexual maturity. It is speculated that the special yellow color of males plays an important role in their courtship, mating and promoting female reproduction.

[0075] 2. Cloning and expression pattern analysis of the YP gene sequence of Locust migratoria

[0076] In order to obtain UK We extracted RNA from adult locusts and prepared amplification template solution using the TAKARA RACE kit. We then designed amplification primers to obtain UK Full-length sequence Figure 2 、 Figure 3 shown. UK The gene ORF is 795 bp in length, encoding a 264-amino acid sequence and containing a JHBP conserved domain. UK The gene is approximately 20 kb in length and contains 6 exons. UK The upstream promoter sequence contains Doublesex , Kr-H1 and Met Binding site, speculated UK It may be regulated by the JH pathway and the sex determination pathway. Figure 4 As shown by Figure 4 It can be seen that the YP gene of locust has a high homology with that of Orthoptera desert locust, and it is speculated that the function of YP gene is relatively conservative.

[0077] To further explore UKWe collected tissues of male and female individuals in the nymph stage and 15-day-old adult stage (A15) of locusts for expression analysis. UK The gene expression level is extremely low in the nymph stage, and is highly expressed in male individuals during the adult stage, reaching a peak after 15 days and then gradually decreasing. UK The gene is highly expressed in the head, dorsal plate, and epidermis of the locust, and the phenotypic results also show that the head, dorsal and ventral sides of male locusts 15 days after emergence are bright yellow, which is consistent with its expression pattern. UK Protein conserved domain analysis, UK The protein belongs to the juvenile hormone binding protein family (JH Binding protein), UK The gene was also highly expressed in the hemolymph. Figure 5 As shown by Figure 5 It can be seen that the YP gene is highly expressed in the male adult stage and is expressed more strongly in the head, dorsal plate, and epidermis, suggesting that the function of the YP gene is related to the development of body color. UK The gene may be regulated by the juvenile hormone and sex-determining gene of locusts.

[0078] 3. Using gene editing technology to knock out migratory locusts UK Gene and construction of homozygous mutants

[0079] For further research UK Gene function, we in locust UK An sgRNA target site was designed on each of exons 2 and 5 of the gene. sgRNA was synthesized by in vitro transcription. Using the locust embryo microinjection technique, the RNP formed by the mixture of sgRNA and Cas9 protein was injected into the locust embryo. The embryo was cultured in an incubator and raised with wheat seedlings after hatching. As the mutants emerged into adults, their antennae were cut off, the genome was extracted, and the mutation status of the target site was detected by PCR. Figure 6 As shown, mutation detection revealed the presence of double peaks at the target site, and further ligation of the vectors determined different types of mutation sequences.

[0080] Further, if Figure 7 As shown, after we confirm the mutant individuals, we hybridize them with wild-type individuals to obtain G1 generation. We use the same detection steps to confirm the G1 generation mutant individuals. After the G1 generation mutant individuals are hybridized with wild-type individuals, we obtain G2 generation individuals. After the mutation detection of G2 generation individuals is successful, Figure 8 As shown by Figure 8 It can be seen that the mutation types of male and female individuals can be obtained by sequencing. The individuals with the same mutation types of male and female individuals are self-fertilized to obtain G3 generation individuals. The homozygous mutants in G3 individuals are screened by detection and obtained after self-fertilization. UK Homozygous mutant population.

[0081] Finally, using genetic experiments and molecular biology detection techniques, such as Figure 9 As shown, we obtained a deletion of 8 bp UK Homozygous mutant. Phenotypic observations are as follows Figure 10 As shown in A, the body color of the homozygous mutant male insects does not change during the adult stage. Figure 10 B shows the homozygote UK The expression level was significantly lower than that of wild type, as shown by Western blot analysis. Figure 10 C shows that the homozygous mutant does not express UK Protein, proving that we have UK Homozygous loss-of-function mutants.

[0082] 4. Migratory locusts UK Loss of gene function reduces male insect desire to mate

[0083] For further research UK To investigate the effects of gene function loss on male locusts, we conducted bioassays on male locusts 10 and 15 days after emergence. Figure 11 As shown by Figure 11 It can be seen that the YP homozygous mutant male insects have significantly reduced courtship desire compared with the wild type.

[0084] When the right UK When homozygous males were tested for 10 days, it was found that there was no difference between homozygous males and wild-type males in the number of times they approached females, clung to females, and attempted to mate. UK When conducting bioassays on homozygous 15-day-old males, we found that the mutant 15-day-old males did not change color to yellow, while the 15-day-old wild-type males had a noticeable yellowing. Homozygous males refused to approach females, and their mating frequency and number of pairs were significantly lower than those of wild-type females. We filmed a video that strongly demonstrated this obvious phenotype. The above bioassays further clarified that UK The gene plays an important role in male insect courtship and mating. UK This causes the mutants to lose their desire to mate.

[0085] Implementation effect analysis

[0086] Insect courtship and mating behaviors are essential for reproduction and population expansion. Loss of YP gene function results in significantly lower courtship and mating desire in males compared to wild-type individuals, leading to a significant reduction in the mating success rate in YP homozygotes. YP is also highly expressed in males, suggesting its importance to males. Loss of this gene leads to a specific reduction in mating desire in males, providing a target gene for male-specific genetic manipulation in locusts and providing technical insights for constructing gene-edited homozygous mutants in other pests and non-model organisms.

[0087] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for constructing a marker gene for the body color of male locusts Yellow Protein A method for producing a homozygous mutant, characterized in that The following steps are involved: (1) In locusts Yellow Protein An sgRNA target site was designed on exon 2 and exon 5 of the gene, and sgRNA was synthesized by in vitro transcription; (2) The sgRNA in step (1) is fused with the Cas9 protein in vitro to form an RNP mixture, which is then injected into locust eggs via microinjection to obtain locust mutants; (3) After extracting the genome of the locust mutant in step (2), PCR detection is performed using target detection primers, and the PCR products are sequenced to screen the locust mutants that have successfully been detected as G0 generation mutants; (4) The G0 generation mutants are hybridized with wild-type individuals to obtain the G1 generation, and the test in step (3) is repeated to screen and obtain the G1 generation mutants; the G1 generation mutants are hybridized with wild-type individuals to obtain the G2 generation, and the test in step (3) is repeated to screen and obtain the G2 generation mutants; (5) After the mutation test of G2 generation mutants is successful, the G2 generation mutants with the same mutation type in both sexes are self-fertilized to obtain G3 generation individuals. The homozygous mutants in the G3 generation individuals are screened and self-fertilized to obtain locusts. Yellow Protein homozygous mutant population; In the step (1), locusts Yellow Protein The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. the structure locust male insect body color Marker gene according to claim 1 Yellow Protein A method for producing a homozygous mutant, characterized in that: The nucleotide sequence of the sgRNA target site in exon 2 is shown in SEQ ID No. 2; the nucleotide sequence of the sgRNA target site in exon 5 is shown in SEQ ID No.

3.

3. the structure locust male insect body color Marker gene according to claim 1 Yellow Protein A method for producing a homozygous mutant, characterized in that: The final concentrations of sgRNA and Cas9 protein in the RNP mixture in step (2) are both 300 ng / μL.

4. the structure locust male insect body color Marker gene according to claim 3 Yellow Protein A method for producing a homozygous mutant, characterized in that: The locust eggs are eggs that have just been laid for less than 1 hour.

5. the structure locust male insect body color Marker gene according to claim 1 Yellow Protein A method for producing a homozygous mutant, characterized in that: The nucleotide sequences of the target detection primer pair in step (3) are shown in SEQ ID No. 4 and SEQ ID No.

5.

6. the structure locust male insect body color Marker gene according to claim 1 Yellow Protein A method for producing a homozygous mutant, characterized in that: Successful mutation detection refers to genes with double peaks at the sgRNA target site.

7. The locust male body color marker gene constructed by the method described in any one of claims 1 to 6 Yellow Protein Application of homozygous mutants in controlling locust pests and diseases.

8. Migratory locusts Yellow Protein The application of the gene as a locust marker gene is characterized by: By making locusts absent Yellow Protein Gene, to obtain male locusts whose body color does not change to yellow; the locust Yellow Protein The nucleotide sequence of the gene is shown in SEQ ID No.1.

Images