Application of a heat-resistant antigen of Mycobacterium tuberculosis

Abstract

This invention discloses the application of a thermostable antigen of Mycobacterium tuberculosis, belonging to the field of biomedical technology. This invention provides an application of the thermostable antigen of Mycobacterium tuberculosis (Mtb-HAg). Immunization of mice with Mtb-HAg alone and in combination with BCG showed that immunization with Mtb-HAg alone induced a significantly higher specific immune response than with BCG and significantly stimulated lymphocyte proliferation. Immunization with Mtb-HAg in combination with BCG induced a stronger specific Th1 immune response, thereby significantly improving the immunogenicity of BCG, and demonstrating the potential of Mtb-HAg as a candidate subunit vaccine.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of a heat-resistant antigen of Mycobacterium tuberculosis. Background Technology

[0002] Although the Mycobacterium tuberculosis (Mtb) genome maintains a low level of genetic variation, it is still considered one of the most evolutionarily successful pathogens. Mtb was identified as the cause of tuberculosis (TB) in 1882, and TB has now become a major global public health problem, posing a long-term threat to human life and health. Furthermore, high-risk factors such as smoking, alcohol consumption, chronic inflammation caused by unhealthy lifestyle habits, and malnutrition can, at certain times, cause dormant pathogens to reactivate and lead to active TB, especially when Mtb is co-infected with human immunodeficiency virus (HIV). In addition, the widespread use of antibiotics puts enormous survival pressure on wild-type TB strains, forcing them to evolve new survival mechanisms. Antibiotic resilience means that Mtb recovers its growth faster after drug exposure than wild-type strains, thus making Mtb drug resistance more challenging.

[0003] The introduction of Bacillus Calmette-Guérin (BCG) in 1927 helped curb the spread of tuberculosis to some extent. Due to its low cost, good immunoprotective effect, and high safety and stability, it has been included in the immunization programs of many countries. However, a recent report indicates that in a cohort study of 660 previously uninfected South African adolescents, BCG revaccination showed a preventive efficacy of only 45.4% against Mtb infection. The shortcomings of BCG in prevention or treatment are increasingly being exposed to the public. The most likely reason is that most BCG vaccines lack immunodominant antigens (such as ESAT-6, CFP-10, and PPE68), thus antigen loss and partial sequence variations limit the efficacy of BCG. The field of pathogenic biology has been working to explore the pathogenic mechanisms of Mtb and improve the body's immunity against Mtb through effective vaccines. Summary of the Invention

[0004] The purpose of this invention is to provide an application of a heat-resistant antigen of Mycobacterium tuberculosis, wherein the heat-resistant antigen Mtb-HAg has higher immunogenicity than BCG, and when Mtb-HAg is combined with BCG for immunization, the immunogenicity of BCG can be significantly improved.

[0005] This invention provides the application of the Mycobacterium tuberculosis heat-resistant antigen Mtb-HAg in the preparation of subunit vaccines against Mycobacterium tuberculosis.

[0006] Preferably, the method for preparing the heat-resistant antigen of Mycobacterium tuberculosis includes the following steps: heat-treating a weak strain of Mycobacterium tuberculosis at 121°C for 20 min, and the supernatant contains the heat-resistant antigen.

[0007] Preferably, the attenuated strain of Mycobacterium tuberculosis includes strain H37Ra.

[0008] The present invention also provides a subunit vaccine against Mycobacterium tuberculosis, comprising Mycobacterium tuberculosis heat-resistant antigen Mtb-HAg and an adjuvant;

[0009] The concentration of the Mycobacterium tuberculosis heat-resistant antigen Mtb-HAg was 0.2 mg / mL.

[0010] The present invention also provides a method for preparing the above-mentioned subunit vaccine, comprising the following steps: dissolving the heat-resistant antigen Mtb-HAg of Mycobacterium tuberculosis, mixing it with an adjuvant and emulsifying it to obtain the subunit vaccine.

[0011] Preferably, the adjuvant includes DP adjuvant.

[0012] Preferably, the method includes dissolving the Mycobacterium tuberculosis heat-resistant antigen Mtb-HAg in PBS, with the concentration of the dissolved solution being 0.2 mg / mL.

[0013] This invention also provides the application of the Mycobacterium tuberculosis heat-resistant antigen Mtb-HAg in the preparation of enhancers that improve the immunogenicity of BCG vaccine.

[0014] The present invention also provides the application of Mycobacterium tuberculosis heat-resistant antigen Mtb-HAg combined with BCG vaccine in the preparation of vaccines for the prevention and / or treatment of tuberculosis.

[0015] The present invention also provides a vaccine for the prevention and / or treatment of tuberculosis, the active ingredients of which include Mycobacterium tuberculosis heat-resistant antigen Mtb-HAg and BCG vaccine.

[0016] Beneficial Effects: This invention provides the application of Mycobacterium tuberculosis heat-resistant antigen. Immunization of C57BL / 6 mice with Mtb-HAg alone and in combination with BCG was performed, and the immunogenicity was tested. It was found that immunization with Mtb-HAg alone induced a significantly higher specific immune response than with BCG and significantly stimulated lymphocyte proliferation. Immunization with Mtb-HAg in combination with BCG effectively induced the secretion of IFN-γ, TNF-α, and IL-2 and upregulated the gene transcription levels of these three substances, increasing the number of antigen-specific pluripotent T cells (CD4+). + IFN-γ + CD4 + IL-2 + CD8 +IFN-γ + and CD8 + IL-2 + The frequency of T cells. Mtb-HAg can also upregulate the mRNA expression levels of IL-10, IL-12, and IL-17. In summary, the Mtb-HAg combined with BCG described in this invention can induce a stronger specific Th1 immune response, thereby significantly improving the immunogenicity of BCG, and demonstrating the potential of Mtb-HAg as a candidate subunit vaccine. Attached Figure Description

[0017] Figure 1 The flowchart (A) for the preparation of Mtb-HAg as described in this invention and the schematic diagram (B) for the mouse immunization procedure are shown below.

[0018] Figure 2 The image shows the SDS-PAGE detection results of Mtb-HAg.

[0019] Figure 3 Figure 1 shows the effect of Mtb-HAg immunization alone and combined immunization with HAg and BCG on the proliferation level of HAg antigen-specific lymphocytes in mice.

[0020] Figure 4 To detect CD4 using multicolor flow cytometry + IFN-γ + CD4 + IL-2 + CD8 + IFN-γ + and CD8 + IL-2 + Graph showing the frequency results of T cells;

[0021] Figure 5 To detect CD4+ cells that specifically secrete IFN-γ or IL-2 by PPD using multicolor flow cytometry + or CD8 + Graph showing the number of T cells;

[0022] Figure 6 A graph showing the levels of cytokines secreted by spleen cells in different groups of immunized mice;

[0023] Figure 7 Figure showing the results of qRT-PCR detection of mRNA transcription levels of IFN-γ, TNF-α, IL-2, IL-10, IL-12 and IL-17 in lung tissue of inoculated mice. Detailed Implementation

[0024] The present invention also provides the application of the heat-resistant antigen Mtb-HAg of Mycobacterium tuberculosis in the preparation of subunit vaccines against Mycobacterium tuberculosis.

[0025] The method for preparing the heat-resistant antigen of Mycobacterium tuberculosis according to the present invention includes the following steps: heat-treating a weakened strain of Mycobacterium tuberculosis at 121°C for 20 min, and the supernatant containing the heat-resistant antigen. The weakened strain of Mycobacterium tuberculosis preferred in this invention includes strain H37Ra. The Mycobacterium tuberculosis H37Ra preferred in this invention is grown in a Suton culture medium at 37°C. The Suton culture medium preferably comprises the following ingredients: 4 g / L asparagine, 0.5 g / L KH2PO4, 2.2 g / L citric acid, 1 g / L MgSO4·7H2O, 60 mL / L glycerol, and 0.05% Tween 80.

[0026] In this embodiment of the invention, the H37Ra strain is preferably cultured in the Suton medium for 6-8 weeks to the logarithmic growth phase, and the cells are collected. Then, the cells are centrifuged at 4500 rpm for 30 min, washed three times with sterile PBS and ultrapure water, and then Mtb is resuspended in twice the volume of sterile ultrapure water. The cells are then treated at 121°C for 20 min, and the supernatant is collected. The supernatant contains heat-resistant antigen.

[0027] The heat-resistant antigen Mtb-HAg described in this invention is preferably diluted to 0.2 mg / mL with cold sterile PBS before use. The HAg described in this invention is a mixed polypeptide, and its specific active components have not yet been determined. However, after two doses, no inflammatory reaction was observed at the injection site, and the mice's appetite and mental state were similar to the control group, suggesting that the HAg peptide has good safety.

[0028] In this embodiment of the invention, an immunization model animal method was used to demonstrate that immunization with the heat-resistant antigen Mtb-HAg alone has a better immunization effect than immunization with the existing BCG vaccine, and can also significantly stimulate lymphocyte proliferation. Therefore, it can be used to prepare subunit vaccines.

[0029] The present invention also provides a subunit vaccine against Mycobacterium tuberculosis, comprising the above-mentioned heat-resistant antigen Mtb-HAg and an adjuvant; wherein the concentration of the heat-resistant antigen Mtb-HAg is 0.2 mg / mL.

[0030] The adjuvant of this invention preferably includes DP adjuvant. The preparation method of the DP adjuvant preferably includes dissolving DDA powder in PBS, stirring and heating in an 80°C water bath until the solution becomes a homogeneous emulsion, and dissolving poly I:C in pre-cooled PBS. The final concentrations of DDA and poly I:C are 5.0 mg / ml and 1.0 mg / ml, respectively. While continuously stirring the poly I:C, twice the volume of DDA is slowly added dropwise. Stirring is stopped after the solution is completely homogeneous. The mixture of DDA and poly I:C is the DP adjuvant.

[0031] The present invention also provides a method for preparing the above-mentioned subunit vaccine, comprising the following steps: dissolving the above-mentioned heat-resistant antigen Mtb-HAg, mixing it with an adjuvant and emulsifying it to obtain the subunit vaccine.

[0032] The adjuvant described in this invention preferably includes DP adjuvant, and the preparation method is the same as above, so it will not be repeated here.

[0033] The present invention preferably uses cold sterile PBS to dilute Mtb-HAg to 0.2 mg / mL, and then mixes it thoroughly with an equal volume of DP adjuvant in a vortex mixer and emulsifies for 20 min to prepare the subunit vaccine.

[0034] This invention also provides the application of the above-mentioned heat-resistant antigen Mtb-HAg in the preparation of enhancers that improve the immunogenicity of BCG.

[0035] In this embodiment of the invention, the method of immunizing a mouse model with Mtb-HAg combined with BCG demonstrated that Mtb-HAg combined with BCG immunization can effectively induce the secretion of IFN-γ, TNF-α and IL-2 and upregulate the gene transcription levels of these three substances, increasing the number of antigen-specific pluripotent T cells CD4. + IFN-γ + CD4 + IL-2 + CD8 + IFN-γ + and CD8 + IL-2 + The frequency of T cells. Mtb-HAg can also upregulate the mRNA expression levels of IL-10, IL-12, and IL-17. In summary, the Mtb-HAg combined with BCG described in this invention can induce a stronger specific Th1 immune response, thereby significantly improving the immunogenicity of BCG.

[0036] The present invention also provides the application of the above-mentioned heat-resistant antigen Mtb-HAg combined with BCG vaccine in the preparation of vaccines for the prevention and / or treatment of tuberculosis.

[0037] The embodiments of the present invention demonstrate that Mtb-HAg combined with BCG can induce a stronger specific Th1 immune response, thereby significantly improving the immunogenicity of BCG. Therefore, the method of combining Mtb-HAg with BCG can be used to prepare vaccines with stronger immunogenicity, thereby inducing a stronger specific Th1 immune response.

[0038] The present invention also provides a vaccine for the prevention and / or treatment of tuberculosis, the active ingredients of which include the above-mentioned heat-resistant antigen Mtb-HAg and BCG vaccine.

[0039] The vaccine of this invention uses the BCG vaccine as the primary immunization and the heat-resistant antigen Mtb-HAg as the booster immunization, such as 2×10⁻⁶ injections at the primary immunization. 6 CFU BCG was administered via injection of 200 μL of the aforementioned 0.2 mg / mL Mtb-HAg at 2 and 4 weeks post-primary immunization. HAg inoculation enhances antigen specificity and multifunctional CD4+. + The frequency of T cells co-expressing IFN-γ and IL-2. Following HAg-enhanced stimulation, CD8... + The highest levels of T cell subsets were found in CD8 cells. + IFN-γ + The number of T cells was significantly higher in the BCG group than in the CD8 group. + IL-2 + The number of T cells was approximately 2.5 times that of the BCG group, indicating that HAg significantly enhanced the ability of BCG to activate cellular immunity, whether targeting CD4+ or CD4+. + T cells or CD8? + T cells.

[0040] To further illustrate the present invention, the application of a thermostable antigen for Mycobacterium tuberculosis provided by the present invention will be described in detail below with reference to embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0041] In this embodiment of the invention, all data are expressed as mean ± standard deviation (SD). Statistical analysis was performed using SPSS 29.0 software. One-way ANOVA was used for comparisons among multiple groups, and Tukey's test was used for pairwise comparisons. A two-tailed P < 0.05 was considered statistically significant. *** represents P < 0.001, ** represents P < 0.01, and * represents P < 0.05.

[0042] Example 1

[0043] Bacterial culture and preparation of Mtb-HAg

[0044] Mycobacterium tuberculosis H37Ra was grown in a Suton culture medium at 37°C. After culturing for 6–8 weeks to the logarithmic growth phase, bacterial cells were collected, centrifuged at 4500 rpm for 30 min, washed three times with sterile PBS and ultrapure water, and then resuspended in twice the volume of sterile ultrapure water. The suspension was treated at 121°C for 20 min, and finally filtered through a 0.22 μm syringe filter to obtain the Mtb-HAg peptide. Validation was performed using SDS-PAGE. Figure 2 As shown, Mtb-HAg is mainly composed of a group of polypeptides with molecular weights ranging from 10 to 15 kDa.

[0045] Example 2

[0046] Preparation of adjuvant DP and emulsified peptides

[0047] DDA powder was dissolved in PBS and heated in an 80°C water bath with stirring until the solution became a homogeneous emulsion. Poly I:C was dissolved in pre-cooled PBS. The final concentrations of DDA and polyI:C were 5.0 mg / ml and 1.0 mg / ml, respectively. Poly I:C was stirred continuously while twice the volume of DDA was slowly added dropwise. Stirring was stopped after the solution was completely homogeneous. The mixture of DDA and polyI:C was the DP adjuvant. 20 μg of Mtb-HAg was resuspended in 100 μL of cold sterile PBS and diluted to 0.2 mg / mL. This was then mixed thoroughly with an equal volume of DP adjuvant in a vortex mixer and emulsified for 20 min to obtain a homogeneous emulsified peptide for subsequent inoculation of mice.

[0048] Example 3

[0049] 3.1 Mice and Immunization Protocol

[0050] Twenty SPF-grade, 6-8 week old, 18-20g female C57BL / 6 mice were purchased from Hefei Qingyuan Biotechnology Co., Ltd. The mice were housed in IVC (Indoor Ventilation) containers at an ambient temperature of 22-25℃ and a relative humidity of 45%-65%. During the experiment, the mice had free access to irradiated feed and sterilized water. Prior to the experiment, the mice underwent a one-week acclimatization period in the laboratory. The mice were randomly divided into four groups for the experiment. Two × 10⁶ mice were placed in each group. 6 CFU containing BCG dissolved in 200 μL of sterile saline was administered subcutaneously as a positive control. 200 μL of sterile PBS was used as a negative control using the same injection strategy. Each mouse in the immunogen group was injected with 200 μL of the polypeptide DH solution described in Example 2, with 2 weeks between injections, for a total of 3 injections. The primary-enhanced group received 2 × 10⁶ CFU at week 0. 6 CFU-containing BCG was administered via injection of 200 μL of the described DH polypeptide solution in weeks 2 and 4, respectively. Vaccinated mice were monitored daily throughout the experiment. Mice were sacrificed two weeks after the final immunization, and samples were collected for analysis.

[0051] 3.2 ELISA detection of Th1 cytokines secreted by spleen cells

[0052] Two weeks after the final immunization, the spleens of mice were aseptically harvested. Splenic lymphocytes were resuspended in RPMI-1640 medium containing 10% fetal bovine serum, counted, and diluted to 5 × 10⁶ cells / mL. 6 cells / mL. At 3 × 10⁻⁶ 6Cells were seeded at a density equal to the number of wells in a 24-well plate. 10 μg of homogeneous emulsified peptide Mtb-HAg was added for incubation. Cells treated with an equal volume of PPD served as a positive control. Cells were cultured at 37°C and 5% CO2 for 24 h to detect IL-2 levels, and after 72 h of culture, IFN-γ, TNF-α, and IL-4 levels were detected. The culture supernatant was collected, and the mouse IFN-γ, TNF-α, IL-2, and IL-4 ELISA kits were used according to the product instructions.

[0053] The results are as follows Figure 4 As shown, the highest level of cell subsets was observed in the BCG-HAg combined immunization group compared to the other three groups. In CD4 + Regarding T cells, CD4 in the BCG group mice + IFN-γ + CD4 + IL-2 + The proportion of cells was higher in the combined immunization group than in the HAG group, which did not highlight the advantage of HAG. However, the highest frequency of functional CD4+ T cells was observed in the combined immunization group, which precisely demonstrates that HAG has a good ability to help enhance the immunogenicity of BCG, although the advantage of using HAG alone is not obvious. (Compared to CD4+ T cells...) + The changes in T cells were similar, and CD8 in the combined immunization group were also similar. + IFN-γ + and CD8 + IL-2 + The number of T cells was significantly higher in the group than in the BCG group, reaching the highest level among the four experimental groups.

[0054] Meanwhile, CD8+ cells secreting IFN-γ and IL-2 were observed in the spleens of mice immunized only with HAG. + The proportion of T cells was higher in mice immunized with BCG. CD8+ cells produce cytokines. + T cells play a dominant role in LTBI, while one of the drawbacks of BCG is that it cannot induce a sufficient number of CD8 cells. + T cells prevent the progression of LTBI, consistent with the above results. HAg stimulates CD8... + In terms of T-cell stimulation, it was superior to BCG, even though the difference in advantage between the two was not statistically significant. Nevertheless, HAg may be more effective than BCG in preventing LTBI. The trend observed when PPD was used as stimulation was similar to the trends described above. Figure 5 Overall, Mtb-HAg is expected to further enhance the immunogenicity of BCG by increasing the proportion of pluripotent T cells.

[0055] 3.3 Flow cytometry detection of Mtb-HAg specific T lymphocytes

[0056] Intracellular flow cytometry was used to detect T cells, and spleen cells were counted at 5 × 10⁻⁶.6 Cells were seeded in 24-well plates and cultured at 37°C and 5% CO2 for 18 h with Mtb-HAg (10 μg / mL). A 10 μg / mL PPD was used as a positive control. After adding monensin (1 μg / mL, Biolegend, USA) to block cytokine secretion for 6 h, cells were collected by centrifugation, washed with cold PBS, and stained with 2 μL FITC anti-mouse CD3 (Biolegend, USA), 1.5 μL PE anti-mouse CD4 (Biolegend, USA), and 5 μL PerCP-Cy5.5 anti-mouse CD8α (Biolegend, USA) in the dark, and incubated at 4°C for 30 min. Cells were then stained with 5 μL PE / Cy7 anti-mouse IFN-γ (Biolegend, USA) and 1.5 μL APC anti-mouse IL-2 (clone JES6-5H4, Biolegend, USA). Finally, the cells were resuspended in FACS buffer and stained with DxP Athena. TM Flow cytometry (Cytek Bioscience, CA, USA) was used to analyze CD4+ cells that secrete IFN-γ and IL-2. + T and CD8 + T cell count.

[0057] After centrifugation, the supernatant from spleen cell culture was collected, and the total amount of different types of cytokines was quantitatively detected by ELISA, including Th1 cytokines IFN-γ, TNF-α, and IL-2, and Th2 cytokine IL-4. The results are as follows: Figure 6 As shown, the PBS group had the lowest levels of cytokines secreted by spleen cells across all groups. Except for IFN-γ, mice injected with Mtb-HAg exhibited higher cytokine levels than those immunized with BCG. Regardless of whether the stimulus was Mtb-HAg or PPD, the highest levels of Th1 cytokines were observed in the BCG primordial-Mtb-HAg booster immunization group. Also noteworthy is that, compared to the Mtb-HAg group, BCG-vaccinated mice produced a higher IFN-γ response to PPD, but showed the opposite trend upon stimulation with the specific antigen Mtb-HAg. Furthermore, IL-4, representing the Th2 response, is considered one of the indicators of the balance between inflammatory response and pathological damage.

[0058] 3.4 Lymphocyte proliferation detection

[0059] In a 96-well plate, 2×10⁻⁶ holes per well 5Splenocytes were seeded at a density of 1000 mcg / well, and stimulated with 5 μg Mtb-HAg. Three replicates were performed per sample. Cells in complete culture medium alone served as a negative control. Cells were incubated at 37°C and 5% CO2 for 68 h. A blank control was prepared using RPMI-1640 medium containing 10% FBS to reduce background error. CellTiter was used. Cell proliferation assay kit (Promega, Madison, USA): OD of each well was measured after 4 hours of incubation. 490 The degree of lymphocyte proliferation response is expressed by the stimulation index (SI). SI = (OD value of Mtb-HAg stimulation well - OD value of blank well) / (OD value of negative control well - OD value of blank well).

[0060] Two weeks after the final immunization, mouse spleen lymphocytes were isolated, and the lymphocyte proliferation index was detected by the MTS assay. The proliferation level of Mtb-HAg specific lymphocytes was evaluated by the SI value. The results are as follows: Figure 3 As shown, the cell proliferation index of all three experimental groups was higher than that of the PBS group. The lymphocyte proliferation status of mice immunized with Mtb-HAg alone was significantly better than that induced by BCG. The cell stimulation index of mice immunized with the combination of BCG and Mtb-HAg was the highest. However, its degree was not statistically significant compared with that induced by Mtb-HAg alone, which may be related to the fact that the latter reached its upper limit and could not be further improved after induction.

[0061] 3.5 Expression levels of IFN-γ, TNF-α, IL-2, IL-4, IL-10, and IL-12 mRNA in lung tissue

[0062] Mouse spleens were aseptically collected, and total RNA was extracted using TRIzol (Ambion, Thermo Fisher Scientific, USA). A Nanodrop UV analyzer was used to analyze RNA based on OD values. 260 / 280 and OD 260 / 230 To detect RNA purity and concentration. (Using...) One-Step gDNA Removal and cDNA Synthesis SuperMix (Transgen, Beijing, China) were used for reverse transcription to synthesize cDNA. Real-time quantitative PCR was used to detect cytokine transcription levels. Corresponding primers were synthesized by Shanghai Sangon Biotech Co., Ltd. -ΔΔCT The method was used to calculate and compare the differences in mRNA expression between groups.

[0063] Table 1 Primer sequences

[0064] Primer name Primer sequence (5'→3') SEQ ID No. β-actin-F GGCTGTATTCCCCTCCATCG 1 β-actin-R CCAGTTGGTAACAATGCCATGT 2 IFN-γ-F CTGGAGGAACTGGCAAAAGGATGG 3 IFN-γ-R TCGCCTTGCTGTTGCTGAAGAAG 4 TNF-α-F CGCTCTTCTGTCTACTGAACTTCGG 5 TNF-α-R GTGGTTTGTGAGTGTGAGGGTCTG 6 IL-2-F TGAGCAGGATGGAGAATTACAGG 7 IL-2-R GTCCAAGTTCATCTTCTAGGCAC 8 IL-10-F ATTTGAATTCCCTGGGTGAG 9 IL-10-R CCTTGGTCTTGGAGCTTATT 10 IL-12-F TGCCTTGGTAGCATCTATGAGG 11 IL-12-R CGCAGAGTCTCGCCATTATGAT 12 IL-17-F AGGCAGCAGCGATCATCCC 13 IL-17-R TGGAACGGTTGAGGTAGTCTGAG 14

[0065] The results are as follows Figure 7As shown, the expression levels of all cytokines were lowest in the PBS control group. Regarding IL-2 and IL-10 gene expression, the transcriptional levels in BCG-immunized mice were very similar to those in the Mtb-HAg-only group. Compared to the BCG group, Mtb-HAg induced higher relative gene expression levels of cytokines, including IFN-γ, TNF-α, IL-12, and IL-17. The BCG+HAg group showed the highest cytokine mRNA expression levels detected after HAG heterologous booster immunization. These results indicate that combined immunization can significantly enhance the transcriptional levels of cytokines induced by either BCG or HAG.

[0066] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of Mycobacterium tuberculosis heat-resistant antigen Mtb-HAg in the preparation of enhancers to improve the immunogenicity of BCG vaccine, characterized in that, The method for preparing the heat-resistant antigen Mtb-HAg of Mycobacterium tuberculosis includes the following steps: heat-treating the attenuated strain H37Ra of Mycobacterium tuberculosis at 121°C for 20 min, and the supernatant contains the heat-resistant antigen.

2. The application of Mycobacterium tuberculosis heat-resistant antigen Mtb-HAg combined with BCG vaccine in the preparation of vaccines for the prevention and / or treatment of tuberculosis, characterized in that, The method for preparing the heat-resistant antigen Mtb-HAg of Mycobacterium tuberculosis includes the following steps: heat-treating the attenuated strain H37Ra of Mycobacterium tuberculosis at 121°C for 20 min, and the supernatant contains the heat-resistant antigen.

3. A vaccine for the prevention and / or treatment of tuberculosis, characterized in that, The active ingredients include Mycobacterium tuberculosis heat-resistant antigen Mtb-HAg and BCG vaccine; The method for preparing the heat-resistant antigen Mtb-HAg of Mycobacterium tuberculosis includes the following steps: heat-treating the attenuated strain H37Ra of Mycobacterium tuberculosis at 121°C for 20 min, and the supernatant contains the heat-resistant antigen.

Images