A method for constructing a humanized DEB mouse model

Abstract

The present invention belongs to the field of animal genetic engineering and genetic modification. Specifically, it discloses a method for constructing a humanized epidermolysis bullosa DEB mouse model and its application in biomedicine. The method comprises the following steps: preparing genetically engineered mice using mouse embryonic stem cells, and replacing the full-length mouse Col7a1 gene sequence with a human COL7A1 genomic sequence or a mutant sequence thereof; preferably, the human COL7A1 genomic sequence is represented by hg19:chr3:48,635,720-48,603,572; the human COL7A1 genomic mutant sequence is represented by hg19:chr3:48,635,720-48,603,572&c.6527 dup C; the mutant animals constructed by the present invention can survive for 7-10 days, which is significantly longer than the median survival of 2 days reported for Col7a1- / - knockout mice, without drug maintenance, providing a longer window of survival for therapeutic experiments.

Description

Technical Field

[0001] The invention belongs to the field of animal genetic engineering and gene genetic modification, and specifically discloses a method for constructing a humanized epidermolysis bullosa DEB mouse model. Technical Background

[0002] Epidermolysis bullosa (EB) is a hereditary skin disease that causes blisters and bullae to form after minor trauma or friction on the skin and mucous membranes. Common clinical symptoms include blisters, blood blisters, and erosions. Hereditary EB can be divided into three types based on the site of onset: epidermolysis bullosa simplex (EBS), junctional epidermolysis bullosa (JEB), and dystrophic epidermolysis bullosa (DEB).

[0003] Mutations in the COL7A1 gene are the cause of dystrophic epidermolysis bullosa (DEB). The diverse clinical phenotypes of DEB are associated with the site and form of the COL7A1 mutation. The COL7A1 gene encodes type VII collagen, which forms anchoring fibers that bind the dermis to the epidermis. The lack of functional anchoring fibers caused by COL7A1 mutations can lead to extremely fragile skin, susceptible to blisters and tears from even the slightest friction or trauma. At least 324 pathogenic COL7A1 mutations associated with DEB have been identified, including nonsense, missense, deletion, insertion, splicing, and regulatory mutations.

[0004] Genome engineering refers to strategies and techniques for the targeted, specific modification of an organism's genetic information (genome). Genome engineering is a highly active field of research due to its wide range of potential applications, particularly in human health. For example, genome engineering can be used to alter (e.g., correct or knock out) genes carrying deleterious mutations or to explore gene function. Early techniques for inserting transgenes into living cells were often limited by the random nature of the insertion of new sequences into the genome. Random insertions into the genome can disrupt the normal regulation of neighboring genes, leading to serious adverse effects. Furthermore, random integration techniques have low reproducibility because there is no guarantee that the sequence will insert into the same location in two different cells. Homologous recombination-based techniques, however, enable modification of specific regions of DNA, resulting in more precise alterations compared to other genomic modifications. While researchers and medical professionals worldwide continue to work diligently to address genetic diseases, there remains a pressing need for safe and effective treatments for COL7A1-related indications.

[0005] The use of animal models can help advance potential DEB-related treatments toward clinical trials. Many studies are targeting the COL7A1 gene to improve DEB symptoms, including anti-squamous oligonucleotide (ASO) drugs, siRNA drugs, and gene therapies delivered via CRISPR and AAV vectors. Currently reported mouse models primarily utilize gene knockdown, without humanizing the mouse genome. Emerging pharmaceutical technologies currently lack the ability to target the mouse genome, resulting in a lack of suitable animal models. Summary of the Invention

[0006] In response to the above problems, the present invention discloses a method for constructing a humanized DEB mouse model.

[0007] The present invention includes the following technical solutions.

[0008] A method for constructing a humanized DEB mouse model comprises the following steps: preparing genetically engineered mice using mouse ES embryonic stem cells, and replacing the full-length Col7a1 gene sequence of the mouse with the human Col7A1 genomic sequence or a mutant sequence thereof.

[0009] Furthermore, in the above method for constructing a humanized DEB mouse model, the human COL7A1 genome sequence is shown as hg19:chr3:48,635,720-48,603,572.

[0010] Furthermore, in the above method for constructing a humanized DEB mouse model, the human COL7A1 genomic mutation sequence is shown as hg19:chr3:48,635,720-48,603,572&c.6527dup C.

[0011] Furthermore, the above method for constructing a humanized DEB mouse model, in which the full-length mouse Col7a1 gene sequence is replaced with the human COL7A1 genomic sequence, comprises the following steps:

[0012] (1) Construction of targeting vector I, which contains a 5-arm homology arm sequence, a Puro resistance screening element, a 1.9 Kb KI sequence, and a 3-arm homology arm sequence;

[0013] The 1.9 Kb KI sequence includes a portion of the human intron 114 sequence and all genomic sequences from exon 115 to 3'UTR, and the 1.9 Kb KI sequence is obtained by gene synthesis;

[0014] The Puro has a lox2272 and loxP element on both sides respectively;

[0015] The homology arm sequence is amplified and obtained from the genome of C57BL / 6 mice;

[0016] (2) Construction of targeting Bac vector II, with a lox2272 recombinase site inserted 3 kb upstream of the human COL7A1 gene in the same orientation as that of targeting vector I, and a loxP recombinase site inserted in the same orientation as that of targeting vector I in intron 114 of the human COL7A1 gene; and a Neo resistance selection element was included between the human COL7A1 gene and loxP, with Neo flanked by Rox sequences. The BAC was RP11-118J3;

[0017] The inserted human genome sequence is hg19:chr3:48,635,720-48,603,572

[0018] (3) The constructed targeting vector I was electroporated into ES cells of the C57BL / 6 strain. The cells were screened with Puromycin, and drug-resistant ES clones were selected. The relevant ES clones were cultured and amplified, and then PCR typing and Southern analysis were performed to obtain positive ES cells I with correct targeting.

[0019] (4) The constructed Bac vector II is electroporated into ES cells I. The cells are screened with G418 drugs, and drug-resistant ES clones are selected. The relevant ES clones are cultured and amplified, and then PCR typing and Southern analysis are performed to obtain positive ES cells II with correct targeting.

[0020] (5) Inject the positive ES cell II into the blastocyst, and then transplant the blastocyst into the surrogate mouse. After a gestation period of about 20 days, the mouse is born.

[0021] (6) Cut the paws of 5-7 day old mice, extract DNA, and perform PCR typing to confirm the mouse genotype

[0022] (7) When male founder mice reach 8 weeks of age, they are mated with wild-type mice of the opposite sex to obtain F1 heterozygous mice. PCR identification is performed 7 days after the mice are born. If positive mice are born, it means that the transgene has been integrated into the germ cells;

[0023] (8) When male F1 mice reach 8 weeks of age and female F1 mice reach 6 weeks of age, they are mated with each other. PCR identification is performed 7 days after the birth of F2 mice to confirm the birth of homozygous mice;

[0024] (9) Phenotypic analysis of COL7A1 homozygous mice was performed to observe characteristics such as mouse skin.

[0025] Furthermore, the above method for constructing a humanized DEB mouse model, in which the full-length mouse Col7a1 gene sequence is replaced with the human COL7A1 genomic mutant sequence, comprises the following steps:

[0026] (10) Targeting vector III was constructed, and mutation c.6527dup C was introduced based on targeting vector II;

[0027] (11) The constructed targeting vector III is electroporated into positive cells I. The cells are screened with G418 drugs, and drug-resistant ES clones are selected. The relevant ES clones are cultured and amplified, and then PCR typing and Southern analysis are performed to obtain correctly targeted positive ES cells III;

[0028] (12) Inject positive ES cell III into blastocysts, which are then transplanted into surrogate mice. After a gestation period of about 20 days, mice are born.

[0029] (13) Clip the paws of 5-7 day old mice, extract DNA, and perform PCR typing to confirm the mouse genotype;

[0030] (14) When male founder mice reach 8 weeks of age, they are mated with wild-type mice of the opposite sex to obtain F1 heterozygous mice. PCR identification is performed 7 days after the mice are born. If positive mice are born, it means that the transgene has been integrated into the germ cells;

[0031] (15) When male F1 mice reach 8 weeks of age and female F1 mice reach 6 weeks of age, they are mated with each other. PCR identification is performed 7 days after the birth of F2 mice to confirm the birth of homozygous mice;

[0032] (16) Phenotypic analysis of hCOL7A1(c.6527dup C) homozygous mice was performed to observe the skin and other characteristics of the mice.

[0033] Furthermore, in the above method for constructing a humanized DEB mouse model, the 1.9Kb KI sequence is shown as SEQ ID No. 6.

[0034] Furthermore, the present invention discloses the use of the above-mentioned method for constructing a humanized DEB mouse model in the preparation of a drug for treating malnutrition-related epidermolysis bullosa.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] 1. The present invention uses homologous recombination technology and recombinase-mediated cassette exchange (RMCE) technology to replace the full-length mouse Col7a1 gene with the full-length human COL7A1 gene. This is achieved by two-step targeting in ES cells. The modified sequence is the human gene sequence hg19:chr3:48,635,720-48,603,572;

[0037] 2. The mice obtained by the present invention no longer express the mouse Col7a1 endogenous gene, and drive the transcriptional regulation of the full-length human COL7A1 sequence under the regulatory elements of human COL7A1, so that various sequences in therapeutic evaluation can fully target the human COL7A1 sequence.

[0038] 3. The present invention can introduce mutations into the humanized COL7A1 ES cell line. Only one more round of targeting is needed to obtain a mutant cell line, thereby obtaining a mouse with a DEB phenotype. The mutant mouse carries the human genome sequence hg19:chr3:48,635,720-48,603,572&c.6527dup C.

[0039] 4. The mutant mice constructed by the present invention can survive for 7-10 days, which is significantly longer than the median survival of 2 days for Col7a1- / - knockout mice reported in the present invention, without the need for drug maintenance, providing a longer window period for therapeutic experiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Vector map of targeting vector I;

[0041] Figure 2 Vector II map;

[0042] Figure 3 Vector III map;

[0043] Figure 4 The PCR reaction system of Example 6;

[0044] Figure 5 Example 6 PCR results for genotyping of ES cells I;

[0045] Figure 6 Example 6 ES cell I Southern blot detection results;

[0046] Figure 7 Example 6 PCR results for genotyping of ES cells II;

[0047] Figure 8 Example 6 ES cell II Southern blot detection results;

[0048] Figure 9 Example 7 PCR results for genotyping of ES cells III;

[0049] Figure 10 Example 6 ES cell III Southern blot detection results;

[0050] Figure 11Example 6 ES cell III sequencing test results;

[0051] Figure 12 Example 6 Genotype identification results of F1 generation derived from ES cell II;

[0052] Figure 13 Example 6 Genotype identification results of F1 generation derived from ES cell III;

[0053] Figure 14 Example 6 Genotype identification results of ES cell II-derived Fn generation;

[0054] Figure 15 Example 6 Genotype identification of Fn generation derived from ES cells III;

[0055] Figure 16 The humanized mice without mutations were born with normal phenotype. Figure 16 As shown;

[0056] Figure 17 Phenotypic results of homozygous mutant mice (MU / MU) and heterozygous mutant mice (MU / +). DETAILED DESCRIPTION

[0057] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0058] The reagents or instruments used in the examples of the present invention without indicating the manufacturer are all conventional reagent products that can be obtained through commercial purchase.

[0059] Example 1

[0060] Upstream primers and matching downstream primers for two homologous recombination fragments, as well as related sequences, were designed. Specifically, 5' and 3' homology arm fragments were obtained by PCR amplification using wild-type C57BL / 6 mouse genomic DNA as a template; a loxP-Puro-lox2272 resistance screening sequence (SEQ ID NO: 1) was also synthesized.

[0061] SEQ ID NO: 1:

[0062] tggcttctggaagctgagctcataacttcgtataaagtatcctatacgaagttatgaattcctcgagccccagctggttc

[0063] tttccgcctcagaagccatagagcccaccgcatccccagcatgcctgctattgtcttcccaatcctcccccttgctgtc

[0064] ctgccccaccccaccccccagaatagaatgacacctactcagacaatgcgatgcaatttcctcattttattaggaaag

[0065] gacagtgggagtggcaccttccagggtcaaggaaggcacgggggaggggcaaacaacagatggctggcaact

[0066] agaaggcacagtcgaggctgatcagcgagctctagagctcaggcaccgggcttgcgggtcatgcaccaggtgcg

[0067] cggtccttcgggcacctcgacgtcggcggtgacggtgaagccgagccgctcgtagaaggggaggttgcggggc

[0068] gcggaggtctccaggaaggcgggcaccccggcgcgctcggccgcctccactccggggagcacgacggcgctg

[0069] cccagacccttgccctggtggtcgggcgagacgccgacggtggccaggaaccacgcgggctccttgggccggt

[0070] gcggcgccaggaggccttccatctgttgctgcgcggccagccgggaaccgctcaactcggccatgcgcgggcc

[0071] gatctcggcgaacaccgcccccgcttcgacgctctccggcgtggtccagaccgccaccgcggcgccgtcgtccg

[0072] cgacccacaccttgccgatgtcgagcccgacgcgcgtgaggaagagttcttgcagctcggtgacccgctcgatgt

[0073] ggcggtccgggtcgacggtgtggcgcgtggcggggtagtcggcgaacgcggcggcgagggtgcgtacggccc

[0074] gggggacgtcgtcgcgggtggcgaggcgcaccgtgggcttgtactcggtccccatggtggcgttggctgcaggt

[0075] cgaaaggcccggagatgaggaagaggagaacagcgcggcagacgtgcgcttttgaagcgtgcagaatgccgg

[0076] gcctccggaggaccttcgggcgcccgccccgcccctgagcccgcccctgagcccgcccccggacccacccctt

[0077] cccagcctctgagcccagaaagcgaaggagcaaagctgctattggccgctgccccaaaggcctacccgcttccat

[0078] tgctcagcggtgctgtccatctgcacgagactagtgagacgtgctacttccatttgtcacgtcctgcacgacgcgag

[0079] ctgcggggcgggggggaacttcctgactaggggaggagtagaaggtggcgcgaaggggccaccaaagaacg

[0080] gagccggttggcgcctaccggtggatgtggaatgtgtgcgaggccagaggccacttgtgtagcgccaagtgccca

[0081] gcggggctgctaaagcgcatgctccagactgccttgggaaaagcgcctcccctacccggtagaattaattcgatat

[0082] caagctgaatcgatgatttaaatgtcgacgatgggccctggtaccataacttcgtataatgtatgctatacgaagttatcacagcagcaaatgcaactactacca.

[0083] 5' homology arm (4287 bp): located in the mouse mm10 database

[0084] chr9: 108,946,298-108,950,584 nucleotides, upstream primer (SEQ ID NO: 2); downstream primer (SEQ ID NO: 3). 3' homology arm (5782 bp): located in the mouse mm10 database

[0085] chr9: nucleotides 108,984,876-108,990,657; upstream primer (SEQ ID NO: 4), downstream primer (SEQ ID NO: 5). KI sequence (1897 bp): located in the human Hg19 database as chr3: nucleotides 48,601,506-48,603,402, obtained by synthesis (SEQ ID NO: 6);

[0086] The 5' homology arm fragment, 3' homology arm fragment, KI sequence and lox2272-Puro-loxP resistance screening cassette were connected to the PUC57 plasmid by infusion ligation to finally obtain the targeting vector I. The vector map is shown in Figure 1 .

[0087] SEQ ID NO:2: 5'-atctagctgtcgcgaagagtggcgcgccgccacaagcatgttggtgctcat-3'

[0088] SEQ ID NO:3': 5'-GCGGAAAGAACCAGCTGGGGCTCGAGATAACTTCGTATAGGATACTTTATA CGAAGTTATCAGTAGGATGGCATGCCCCTTGA-3'

[0089] SEQ ID NO:4:5'-aaatgtcgacgatgggccctggtaccgcgatcgctcgtacggtttaaacccttgttgttgattgtttgggtgg-3'

[0090] SEQ ID NO:5:5’-CTATAGGGCGAATTGGGTACGCGGCCGCACATGACCCCTTAGAGGCCAGTG-3’

[0091] SEQ ID NO:6:

[0092]

[0093] Example 2

[0094] BAC:RP11-118J3 was obtained from the BACPAC Resource Center (BPRC) and contains the human genomic sequence (located as chr3:48,597,786-48,757,399 in the human hg19 database). BAC modification was performed on BAC:P11-118J3. A lox2272 recombinase site was inserted 3 kb upstream of the human COL7A1 gene, in the same orientation as in targeting vector I. A loxP recombinase site was inserted at position 114 intron of the human COL7A1 gene, in the same orientation as in targeting vector I. A Neo resistance selection element was introduced between the human COL7A1 gene sequence and the loxP site. Neo contained Rox recombinase sites at both ends. The map of vector II is shown in Figure 1. Figure 2 The mutation site c.6527dup C was introduced into vector II. The map of vector III is shown in Figure 3 .

[0095] Example 3

[0096] 40 μg of the targeting vector plasmid obtained in Example 1 was extracted and electroporated into a C57BL / 6 ES cell line. 24 hours after electroporation, the ES culture medium containing the puromycin resistance drug was replaced. The ES drug screening was observed daily for 7 consecutive days, and fresh ES culture medium containing the resistance drug was replaced daily. On the 8th day, monoclonal clusters with good condition and medium to large size were selected. The clones were then cultured and subsequently genotyped and identified by Southern analysis.

[0097] Example 4

[0098] 40 ug of each of the plasmids obtained in Example 2 and the targeting vector BACIII were extracted and electroporated into the positive ES cells obtained in Example 3, and the ES culture medium containing the G418 resistance drug was replaced 24 hours after the cells were electroporated. The ES drug screening situation was observed every day for 7 consecutive days, and fresh ES culture medium containing the resistance drug was replaced every day. On the 8th day, a monoclonal group with good condition and medium to large volume was selected, and the clones were cultured and subsequently genotyped and Southern analyzed. The cells after electroporation of the targeting vector BACII plasmid were ES cell line II, and the cells after electroporation of the targeting vector BACIII plasmid were ES cell line III.

[0099] Example 5

[0100] Blastocysts of albino C57BL / 6 mice were obtained, and the positive cells of the two genotypes obtained in Example 4 were injected into the blastocysts, which were then transplanted into the oviducts of recipient female mice to produce genetically modified humanized mice, obtaining founder mice (i.e., F0 generation) on a C57BL / 6 background. The obtained mice were then hybridized and selfed to expand the population and establish a stable mouse strain.

[0101] Example 6

[0102] 1. Genotyping and Southern analysis of ES cells

[0103] The ES cell genomic DNA obtained in Example 3 was subjected to PCR analysis and identification using three pairs of primers: primer position 1F1 (SEQ ID NO: 7) was located outside the 5' homology arm, and 1R1 (SEQ ID NO: 8) was located on the Puro element; 1F2 (SEQ ID NO: 9) was located on the Puro element, and 1R2 (SEQ ID NO: 10) was located on the KI sequence; 1F3 (SEQ ID NO: 11) was located on the KI sequence, and 1R3 (SEQ ID NO: 12) was located on the 3' homology arm.

[0104] 1F1 (SEQ ID NO:7): 5'-AATTCAGTCGTTAGACTTGACAGC-3'

[0105] 1R1(SEQ ID NO:8):5'-GATTGGGAAGACAATAGCAGGCA-3'

[0106] 1F2(SEQ ID NO:9):5'-CGTGGGGCTTGTACTCGGTC-3'

[0107] 1R2(SEQ ID NO:10):5'-GAAGAGACAGCTTCACTCTGAT-3'

[0108] 1F3(SEQ ID NO:11):5'-CTCAGCAGAACCCCACTGTC-3'

[0109] 1R3(SEQ ID NO:12):5'-ACTTTACACCCCGCAGTATGATG-3'

[0110] PCR reaction system (25 μL) Figure 4 shown

[0111] The product length of primers 1F1-1R1 should be 4520 bp, the product length of primers 1F2-1R2 should be 666 bp, and the product length of primers 1F3-1R3 should be 380 bp.

[0112] Among the 180 clones obtained, 24 clones were identified as positive clones. The PCR identification results are shown in Figure 5 .

[0113] Furthermore, Southern blot was used to confirm the five clones (4A2, 4A7, 4D11, 1D1 and 1F1) that were positive by PCR.

[0114] The genome was digested with AvrII, transferred to a membrane, and hybridized. The probes were located on the outer fragments of the 5' homology arms. The primers for probe synthesis were: P1-F (SEQ ID NO: 13) and P1-R (SEQ ID NO: 14).

[0115] P1-F (SEQ ID NO:13): 5'-CTTAGCCTCACCTAGTCCTAGAATACCG-3'

[0116] P1-R (SEQ ID NO:14): 5'-AGCAGCAGAGCAAGCCTTAGCAT-3'

[0117] The successfully prepared genetically engineered cells were hybridized with probes to produce:

[0118] 5'Probe: 9.54Kb-MT (with AvrII digestion). The wild-type C56BL / 6 mouse genome has only a 6.47Kb band, and no hybridization bands are produced.

[0119] The genome was digested with Nsil enzyme, transferred to a membrane, and hybridized. The probes were located on the outer fragments of the 3' homology arms. The primers for probe synthesis were: P2-F (SEQ ID NO: 15) and P2-R (SEQ ID NO: 16).

[0120] P2-F (SEQ ID NO:15): 5'-AACATGAAACCAGCCCTTCTTCTCC-3'

[0121] P2-R (SEQ ID NO:16): 5'-CTAATGACTGACTTGCTGCCCTGGA-3'

[0122] The successfully prepared genetically engineered cells were hybridized with probes to produce:

[0123] 3'Probe: 15.25kb-MT (with NsiI digestion). The wild-type C56BL / 6 mouse genome only has an 8.02Kb band, and no hybridization bands are produced.

[0124] The experimental results showed that the sizes of the hybridization bands were consistent with expectations, confirming that all three clones were positive clones and there was no random insertion. They were numbered: 4A2, 4A7 and 4D11. The Southern blot test results are shown in Figure 6 .

[0125] 2. ES cell II genotype identification and Southern analysis

[0126] Five pairs of primers were used to perform PCR analysis and identification on the ES cell genomic DNA obtained in Example 4: primer positions F1 (SEQ ID NO: 17) and R1 (SEQ ID NO: 18) were located on the human or mouse genome on both sides of lox2272; F2 (SEQ ID NO: 19) was located on the Neo resistance element, and R2 (SEQ ID NO: 20) was located on the human KI sequence outside loxP (1.9 kb portion); F3 (SEQ ID NO: 21), R3 (SEQ ID NO: 22), F4 (SEQ ID NO: 23), R4 (SEQ ID NO: 24), F5 (SEQ ID NO: 25), and R5 (SEQ ID NO: 26) were located on the inserted human genome.

[0127] F1 (SEQ ID NO:17): 5'-CAAGCCTTGACTCTTGTCATTTGT-3'

[0128] R1 (SEQ ID NO:18): 5'-CGACTTCCTCAAAGGAAAATTGGG-3'

[0129] F2(SEQ ID NO:19):5'-CAGCACCATTGTCCACTTGTCC-3'

[0130] R2(SEQ ID NO:20):5'-GGAAGAGACAGCTTCACTCTGATG-3'

[0131] F3(SEQ ID NO:21):5'-GAAGTGTCCAGGGGAACCGT-3'

[0132] R3(SEQ ID NO:22):5'-AACTCACGAGGTCGGGTCAC-3'

[0133] F4(SEQ ID NO:23):5'-CCAGGTCAGAGGTCGTGGTT-3'

[0134] R4(SEQ ID NO:24):5'-GGGATTTAGGTTGGCAGGGGT-3'

[0135] F5(SEQ ID NO:25):5'-CAGGTCGAGATGGTGCCAGT-3'

[0136] R5(SEQ ID NO:26):5'-TCAGTGGGATTCCTTGGCCC-3'

[0137] The product length of primer F1R1 should be 243 bp, the product length of primer F2R2 should be 316 bp, the product length of primer F3R3 should be 400 bp, the product length of primer F4R4 should be 538 bp, and the product length of primer F5R5 should be 479 bp.

[0138] Among the 90 clones obtained, one clone was identified as a positive clone. The PCR identification results are shown in Figure 7 .

[0139] Furthermore, one clone (4A7-1B2) that was positive by PCR was confirmed by Southern blot.

[0140] The genome was digested with ApaLI, transferred to a membrane, and hybridized. The probes were located on the outer fragments of the 5' homology arms. The primers for probe synthesis were: P3-F (SEQ ID NO: 27) and P3-R (SEQ ID NO: 28).

[0141] P3-F (SEQ ID NO:27): 5'-CTTAGCCTCACCTAGTCCTAGAATACCG3-3'

[0142] P3-R (SEQ ID NO:28): 5'-AGCAGCAGAGCAAGCCTTAGCAT-3'

[0143] The successfully prepared genetically engineered cells were hybridized with probes to produce:

[0144] 5'Probe: 7.35kb-MT (with ApaLI digestion). The wild-type C56BL / 6 mouse genome only has a 9.81kb band, and no hybridization band will be produced.

[0145] The genome was digested with HindIII, transferred to a membrane, and hybridized. The probes were located on the outer fragments of the 3' homology arms. The primers for probe synthesis were: P4-F (SEQ ID NO: 29) and P4-R (SEQ ID NO: 30).

[0146] P4-F (SEQ ID NO:29): 5'-AACATGAAACCAGCCCTTCTTCTCC-3'

[0147] P4-R (SEQ ID NO:30): 5'-CTAATGACTGACTTGCTGCCCTGGA-3'

[0148] The successfully prepared genetically engineered cells were hybridized with probes to produce:

[0149] 3'Probe: 8.73kb-MT (with AflII digestion). The wild-type C56BL / 6 mouse genome only has an 11.98kb band, and no hybridization bands are produced.

[0150] The experimental results showed that the hybridization band sizes were consistent with expectations, confirming that one clone (4A7-1B2) was a positive clone and there was no random insertion. The Southern blot test results are shown in Figure 8 .

[0151] 3. ES cell III genotype identification and Southern analysis

[0152] The genomic DNA of ES cell III obtained in Example 4 was analyzed and identified by PCR using the same five primer pairs as in Part 2 of Experimental Example 6. Among the 90 clones obtained, one clone was identified as a positive clone. The PCR identification results are shown in FIG. Figure 9 .

[0153] Furthermore, one clone (4A7-3B12) confirmed positive by PCR was confirmed using the Southern blot method described in Part 2 of Experimental Example 6.

[0154] The experimental results showed that the sizes of the hybridization bands were consistent with expectations, confirming that one clone (4A7-3B12) was a positive clone and there was no random insertion. The Southern blot test results are shown in Figure 10 .

[0155] Furthermore, a pair of primers was used to amplify the sequence near the mutation site and sequence the mutation site. Primer positions 2F1 (SEQ ID NO: 31) and 2R1 (SEQ ID NO: 32) are located on the human introns on both sides of Exon 81.

[0156] 2F1 (SEQ ID NO:31): 5'-ATTATCTGTGACTGGAAAGGGTGA-3'

[0157] 2R1 (SEQ ID NO:32): 5'-CTCAGGGATTAACACAGAGAAGGC-3'

[0158] The experimental results showed that after sequencing, the 4A7-3B12 cell clone highlighted a base G (C), confirming that the mutation c.6527dupC existed in the genome, confirming that the clone (4A7-3B12) was the final positive clone. Figure 11 .

[0159] 4. Analysis of Chimerism Rate of F0 Generation Mice The chimerism rate of the F0 mice (ES cell line II) obtained in Example 5 was observed based on coat color. All mice were born male, and the chimerism rates are shown in the following table.

[0160] F0 mouse number Black proportion 1 100％ 2 100％ 3 100％ 4 100％ 5 90％ 6 100％ 7 100％ 8 100％

[0161] The chimerism rate approaches 100%, indicating that the positive ES cells develop into positive mice.

[0162] The chimerism rate of the F0 mice (ES cell line III) obtained in Example 5 was observed based on their coat color. All the mice were born male, and the chimerism rate is shown in the following table.

[0163] F0 mouse number Black proportion 1 100％ 2 95％ 3 100％ 4 100％ 5 100％ 6 100％ 7 100％ 8 100％

[0164] The chimerism rate approaches 100%, indicating that the positive ES cells develop into positive mice.

[0165] 5. Genotype identification of F1 generation derived from ES cell II

[0166] F0 mice were mated with wild-type mice to obtain F1 generation mice. PCR analysis was performed on the genomic DNA of the F1 generation mouse tail. PCR analysis was performed on the mouse tail genomic DNA using five pairs of primers. Primer positions F1 (SEQ ID NO: 17) and R1 (SEQ ID NO: 18) were located on the human or mouse genome on both sides of lox2272; F6 (SEQ ID NO: 33) was located on the human genome, and R2 (SEQ ID NO: 20) was located on the human KI sequence outside loxP (1.9kb portion); F7 (SEQ ID NO: 34) was located on the human KI sequence (1.9kb portion), and R7 (SEQ ID NO: 35) was located on the 3' homology arm sequence; F8 (SEQ ID NO: 36) and R8 (SEQ ID NO: 37) were located on the inserted human genome; F9 (SEQ ID NO: 38) and R9 (SEQ ID NO: 39) were located on the mouse genome. PCR analysis was performed on the mouse tail genomic DNA of the F1 generation mice.

[0167] F1 (SEQ ID NO:17): 5'-CAAGCCTTGACTCTTGTCATTTGT-3'

[0168] R1 (SEQ ID NO:18): 5'-CGACTTCCTCAAAGGAAAATTGGG-3'

[0169] F6(SEQ ID NO:33):5'-CAGGCAGGCCCCTAGAACTT-3'

[0170] R2(SEQ ID NO:20):5'-GGAAGAGACAGCTTCACTCTGATG-3'

[0171] F7(SEQ ID NO:34):5'-CTCAGCAGAACCCCACTGTC-3'

[0172] R7(SEQ ID NO:35):5'-CTCAGCAGAACCCCACTGTC-3'

[0173] F8(SEQ ID NO:36):5'-GAAGTGTCCAGGGGAACCGT-3'

[0174] R8(SEQ ID NO:37):5'-AACTCACGAGGTCGGGTCAC-3'

[0175] F9(SEQ ID NO:38):5'-ACTTAACTGGTTGGTTGTGTGGA-3'

[0176] R9(SEQ ID NO:39):5'-TAGAACCAGAGGCTTGACGAAT-3'

[0177] The product of primer F1R1 should be 243 bp in length, the product of primer F6R2 should be 377 bp in length, the product of primer F7R7 should be 380 bp in length, the product of primer F8R8 should be 400 bp in length, and the product of primer F9R9 should be 542 bp in length. The amplified product of F9R9 is used to identify the wild-type band.

[0178] Among the 6 mice born, 3 were identified as heterozygous mice. The PCR identification results are shown in Figure 12 , 25, 30, and 31 were identified as heterozygous mice.

[0179] 6. Genotype identification of F1 generation derived from ES cell III

[0180] F0 mice were bred with wild-type mice to produce F1 generation mice. PCR analysis was performed on genomic DNA from the tails of F1 generation mice. PCR analysis was performed on genomic DNA from the tails of mice using a pair of primers (2F1 (SEQ ID NO: 31), 2R1 (SEQ ID NO: 32)). PCR analysis was performed on genomic DNA from the tails of F1 generation mice.

[0181] The product length of primers 2F1-2R1 should be 423 bp.

[0182] Among the 9 mice born, 8 were identified as heterozygous mice. The PCR identification results are shown in Figure 13 ,54,58,60,61,62,55,56 and 59 were identified as heterozygous mice.

[0183] 7. Genotype identification of ES cell II-derived Fn generation

[0184] F1 mice that tested positive were mated with each other to produce Fn generation mice. PCR analysis was performed on genomic DNA from the tails of Fn generation mice. PCR analysis was performed on genomic DNA from the tails of Fn generation mice using two pairs of primers: primers F1 (SEQ ID NO: 17) and R1 (SEQ ID NO: 18) located on either side of lox2272 in the human or mouse genome, and primers F9 (SEQ ID NO: 38) and R9 (SEQ ID NO: 39) located on the mouse genome.

[0185] F1 (SEQ ID NO:17): 5'-CAAGCCTTGACTCTTGTCATTTGT-3'

[0186] R1 (SEQ ID NO:18): 5'-CGACTTCCTCAAAGGAAAATTGGG-3'

[0187] F9(SEQ ID NO:38):5'-ACTTAACTGGTTGGTTGTGTGGA-3'

[0188] R9(SEQ ID NO:39):5'-TAGAACCAGAGGCTTGACGAAT-3'

[0189] The product length of primer F1R1 should be 243bp, which cannot be detected in wild-type mice. The product length of primer F9R9 in wild-type mice is 542bp, which cannot be detected in homozygous mice.

[0190] Among the 10 Fn generation mice obtained, mice 155#, 156#, and 162# were identified as homozygous mice; the PCR identification results are shown in Figure 14 .

[0191] 8. Genotype identification of Fn generation derived from ES cells III

[0192] F1 mice that tested positive were mated with each other to produce Fn generation mice. PCR analysis was performed on genomic DNA from the tails of Fn generation mice. Two pairs of primers were used for PCR analysis of genomic DNA from the tails of Fn generation mice. Primers 2F1 (SEQ ID NO:31) and 2R1 (SEQ ID NO:32) were located on the human introns flanking Exon 81, 2F2 (SEQ ID NO:40) was located on the mouse genome, and 2R2 (SEQ ID NO:41) was located on the human genome.

[0193] 2F2 (SEQ ID NO:40): 5'-CACCCTCTTGTAAAAGTGCCAAA-3'

[0194] 2R2 (SEQ ID NO:41): 5'-CATTCCAGCACAGTAGGTTGGG-3'

[0195] The product length of primers 2F1-2R1 should be 423 bp, which cannot be detected in wild-type mice. The product length of primers 2F2-2R2 in heterozygous mice is 182 bp, which cannot be detected in homozygous mice.

[0196] Among the 5 Fn generation mice obtained, 97# mice were identified as homozygous mice; the PCR identification results are shown in Figure 15 .

[0197] Example 7

[0198] The Fn generation homozygous mice and heterozygous mice obtained in Example 5 were subjected to phenotypic analysis.

[0199] The humanized mice without mutations have normal phenotypes after birth. Figure 16 shown.

[0200] Homozygous mutant mice (MU / MU) developed redness, swelling, and blisters on their front paws on the first day of birth; on the second day, redness, swelling, and blisters appeared on both the front and back paws and the tail; on the seventh day, no redness, swelling, or blisters were seen, but extensive peeling occurred. Heterozygous mutant mice (MU / +) were phenotypically normal with no phenotypic changes. Figure 17 shown.

[0201] The constructed mutant animals can survive for 7-10 days, which is significantly longer than the median survival of 2 days in Col7a1- / - knockout mice, without drug maintenance, providing a longer window for therapeutic experiments.

[0202] Although the specific embodiments of the present invention have been described in detail, those skilled in the art will understand that various modifications and changes can be made to the details based on all the teachings published, and these changes are all within the scope of protection of the present invention. The entire invention is given by the appended claims and any equivalents thereof.

Claims

1. A method for constructing a humanized DEB mouse model, characterized in that: The following steps are involved: (1) Construction of targeting vector I, which contains a 5-arm homology arm sequence, a Puro resistance screening element, a 1.9 Kb KI sequence, and a 3-arm homology arm sequence; The 1.9 Kb KI sequence includes a portion of the human intron 114 sequence and all genomic sequences from exon 115 to 3'UTR, and the 1.9 Kb KI sequence is obtained by gene synthesis; The 1.9Kb KI sequence is shown as SEQ ID No. 6; The Puro has a lox2272 and loxP element on both sides respectively; The homology arm sequence is amplified and obtained from the genome of C57BL / 6 mice; (2) Construction of targeting Bac vector II. Inserting the lox2272 recombinase site 3 kb upstream of the human COL7A1 gene in the same orientation as that of targeting vector I. Inserting the loxP recombinase site in the same orientation as that of targeting vector I in intron 114 of the human COL7A1 gene. A Neo resistance selection element is included between the human COL7A1 gene and loxP. Neo is flanked by Rox sequences. The BAC is RP11-118J3. The inserted human genome sequence is hg19:chr3:48,635,720-48,603,572; (3) The constructed targeting vector I was electroporated into ES cells of the C57BL / 6 strain. The cells were screened with Puromycin, and drug-resistant ES clones were selected. The relevant ES clones were cultured and amplified, and then PCR typing and Southern analysis were performed to obtain positive ES cells I with correct targeting. (4) The constructed Bac vector II is electroporated into ES cells I. The cells are screened with G418 drugs, and drug-resistant ES clones are selected. The relevant ES clones are cultured and amplified, and then PCR typing and Southern analysis are performed to obtain correctly targeted positive ES cells II; (5) Inject the positive ES cell II into the blastocyst, and then transplant the blastocyst into a surrogate mouse. After a gestation period of about 20 days, the mouse is born; (6) Clip the paws of 5-7 day old mice, extract DNA, and perform PCR typing to confirm the mouse genotype; (7) When male founder mice reach 8 weeks of age, they are mated with wild-type mice of the opposite sex to obtain F1 heterozygous mice. PCR identification is performed 7 days after the mice are born. If positive mice are born, it means that the transgene has been integrated into the germ cells; (8) When male F1 mice reach 8 weeks of age and female F1 mice reach 6 weeks of age, they are mated with each other. PCR identification is performed 7 days after the birth of F2 mice to confirm the birth of homozygous mice; (9) Phenotypic analysis of COL7A1 homozygous mice was performed to observe the skin manifestations of the mice; (10) Construction of targeting vector III, introducing mutation c.6527 dup C based on targeting vector II; (11) The constructed targeting vector III is electroporated into positive cell I. The cells are screened with G418 drug, and drug-resistant ES clones are selected. The relevant ES clones are cultured and amplified, and then PCR typing and Southern analysis are performed to obtain correctly targeted positive ES cell III; (12) Inject the positive ES cell III into the blastocyst, and then transplant the blastocyst into a surrogate mouse. After a gestation period of about 20 days, the mouse is born; (13) Clip the paws of 5-7 day old mice, extract DNA, and perform PCR typing to confirm the mouse genotype; (14) When male founder mice reach 8 weeks of age, they are mated with wild-type mice of the opposite sex to obtain F1 heterozygous mice. PCR identification is performed 7 days after the mice are born. If positive mice are born, it means that the transgene has been integrated into the germ cells; (15) When male F1 mice reach 8 weeks of age and female F1 mice reach 6 weeks of age, they are mated with each other. PCR identification is performed 7 days after the birth of F2 mice to confirm the birth of homozygous mice. (16) Phenotypic analysis was performed on homozygous hCOL7A1(c.6527 dup C) mice to observe the skin characteristics of the mice.

2. Use of the method for constructing a humanized DEB mouse model according to claim 1 in the preparation of a medicament for treating dystrophic epidermolysis bullosa.

Images