A highly efficient method for using Metarhizium anisopliae Mr006

Abstract

The present invention relates to the technical field of pesticides, and relates to an efficient use method of Metarhizium reinhardtii Mr006, which is applied to the prevention and control of lepidopteran pests such as fall armyworm. Metarhizium reinhardtii Mr006 is mixed with chlorantraniliprole, and on the basis of clarifying the compatibility of the two, it is found that the treatment of first bacteria and then medicine, and first medicine and then bacteria have excellent control effects on fall armyworm, and the combination of the two has an excellent synergistic effect, achieving the purpose of improving the insecticidal activity of Metarhizium reinhardtii Mr006 and reducing the amount of chlorantraniliprole; at the same time, the effect of taking both quick-acting and lasting effects into consideration is achieved, providing ideas for pest resistance management, and providing a basis for long-term green control of fall armyworm populations.

Description

Technical Field

[0001] The invention relates to the technical field of pesticides, and in particular to an efficient use method of Metarhizium reinhardtii Mr006, which is applied to the prevention and control of lepidopteran pests such as fall armyworm. Background Art

[0002] At present, the harm of pests to crops is one of the major factors causing agricultural production reduction. The long-term and large-scale use of chemical pesticides has brought about a series of side effects such as excessive pesticide residues in agricultural products, increasing pest resistance levels year by year, and environmental pollution while killing pests. In view of this, biological control has been increasingly valued by people, and the use of insect pathogenic microorganisms to control pests is one of the important means of biological control of pests. Compared with other insecticidal microorganisms, insecticidal fungi have the advantages of being easy to spread, environmentally friendly, and not easy to develop drug resistance. However, due to their slow control speed, susceptibility to environmental conditions, and unstable control effects, the scope of use and promotion of insecticides related to them are limited. In order to overcome the shortcomings of both parties while also being able to give full play to their respective advantages and improve the control effect, the study of fungus-drug compatibility began in the 1960s. Combining biocontrol fungi with low-dose chemical agents can reduce the use of chemical pesticides, delay pest resistance, extend the control period, and enhance the stability of insecticides.

[0003] Chlorantraniliprole is a highly effective, broad-spectrum and low-toxic insecticide that acts on insect nicotinic acid receptors and was discovered and developed by DuPont from anthranilamide compounds. The strategy of chemical control has solved the emergency prevention and control of fall armyworm, ensured food security and achieved remarkable results. However, long-term chemical use has led to the resistance of fall armyworm to traditional insecticides. The resistance of the Maoming population in Guangdong to chlorantraniliprole has also reached a moderate resistance level. The large-scale use of chemical agents has also brought about a series of environmental and ecological problems, which have forced the search for alternative measures.

[0004] At present, the control of fall armyworm mainly relies on chemical pesticides such as chlorantraniliprole. At the same time, the indoor control effects of biological pesticides and natural enemy insects have been reported. In an open environment, fall armyworm generations overlap and various insect stages occur simultaneously. Once chemical pesticides lose their efficacy, new insects will follow one after another, requiring repeated application of pesticides, which increases the cost of control and easily leads to fall armyworm resistance to control agents. Natural enemy insect control has long-term effects, but fall armyworm has a strong migration ability (it can migrate 100km every night), which makes it difficult to quickly follow.

[0005] Metarhizium rileyi is an insect pathogenic fungus widely distributed in my country. It can infect a variety of lepidopteran pests, especially the fall armyworm, beet armyworm, soybean armyworm, and Spodoptera litura. It has a high infectivity and has a high development and utilization value. Metarhizium rileyi, which targets Noctuidae pests, persists in the environment and has the advantages of safety, sustainable prevention and control, and low resistance to pesticides.

[0006] The Metarhizium rapa Mr006 was isolated and identified by the biological control team of the Institute of Plant Protection and Agricultural Product Quality Safety of Anhui Academy of Agricultural Sciences from the fall armyworm infected with insect-borne fungi in the field in the Taihe corn planting area. The Metarhizium rapa Mr006 has been disclosed in CN202210572361.8 and was deposited in the General Microbiology Center of the China Microbiological Culture Collection on May 9, 2022. The deposit address is: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.40171.

[0007] The specific sequencing results are as follows (540bp):

[0008] GCTACCTGATTCGAGGTCACTCTTGGAGAAGTTTGTGCGTTTTACGGCAGTGGCCGCGCCGCGCTCCTGTTGCGAGGTTGTGCTACTACGCAGAGGAGGCCGCGACGGGGCCGCCAATTCATTTCGGGGGCGGCG CCGCAGGGAACCGCCTGAGCGGCCCGGCTGACAATCGCCGGCCCCCAACACCAAACCGCGGGGGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAG ATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTTGTATGATTCCACTCAGACGTGCCAA AGGCTAAGAGATACAGAGTTTCGGTCCCGCGGCGGGCGCCTGTTTCCGGGCGGGCTCTGGACGAGCCCGGTCCGGGGCAAATGACCCGCCGAGGCAACAGGAAAAGGGTATAAGTTCACATGGGGTTGGGAGTGA

[0009] Metarhizium reinhardtii Mr006 is an insect pathogenic fungus with strong pathogenicity to larvae of Noctuidae such as fall armyworm. It often causes high-intensity insect epidemics in nature, and pests are not easy to develop resistance to it. However, it has shortcomings such as unstable control effect, narrow insecticide spectrum, and slow effect in field use. In order to develop and promote Metarhizium reinhardtii Mr006, and at the same time delay the resistance of fall armyworm to chlorantraniliprole and reduce pesticide residues. Therefore, different combined application methods of Metarhizium reinhardtii Mr006 and chlorantraniliprole were explored, and the optimal use order of Metarhizium reinhardtii Mr006 and chlorantraniliprole for the prevention and control of fall armyworm was excavated, which can not only improve the control efficiency, reduce the use of chlorantraniliprole, and delay the development of resistance of fall armyworm, but also provide an important combination agent for the continuous and effective prevention and control of fall armyworm, and at the same time provide a new means for the green control of pests. Summary of the invention

[0010] One of the purposes of the present invention is to provide an efficient method for using Metarhizium reinhardtii Mr006, wherein Metarhizium reinhardtii Mr006 and chlorantraniliprole are used for the prevention and control of lepidopteran pests. The method of use comprises first using Metarhizium reinhardtii Mr006 and then using chlorantraniliprole, or first using chlorantraniliprole and then using Metarhizium reinhardtii Mr006, or using Metarhizium reinhardtii Mr006 and chlorantraniliprole in combination.

[0011] The second object of the present invention is to provide an insecticide composition, characterized in that the active ingredients are composed of Metarhizium anisopliae Mr006 and chlorantraniliprole, wherein the concentration of Metarhizium anisopliae Mr006 is 1-9×10 8 Spores mL -1 , the mass ratio of Metarhizium reinhardtii Mr006 to chlorantraniliprole is 1000:0.1-10. The preferred mass ratio of Metarhizium reinhardtii Mr006 to chlorantraniliprole is 1000:0.1-5.

[0012] Preferably, the concentration of Metarhizium anisopliae Mr006 is 1-9×10 8 Spores mL -1 , the concentration of chlorantraniliprole is 1-5 mg·mL -1 ; The volume ratio of the two is 10:1-1:10.

[0013] More preferably, chlorantraniliprole is 2.29 mg·mL -1 , Metarhizium anisopliae Mr006 was 1.84×10 8 Spores mL -1 ; The volume ratio of the two is 10:1-1:1.

[0014] The insecticide composition of the present invention further comprises agricultural auxiliary material components, and the dosage form of the insecticide composition is suspension, wettable powder and water granule.

[0015] The insecticide composition of the present invention is used for preventing and controlling lepidopteran pests, and the lepidopteran pests are fall armyworms.

[0016] Compared with the prior art, the present invention achieves the following beneficial technical effects:

[0017] The experiment found that the Metarhizium reinhardtii Mr006 isolated by our laboratory has a good effect on fall armyworm, and the biological test results show that chlorantraniliprole also has a high toxicity to fall armyworm. When Metarhizium reinhardtii Mr006 and chlorantraniliprole are mixed, on the basis of clarifying the compatibility of the two, it is found that the treatment of bacteria first and then medicine, or medicine first and then bacteria, has excellent control effects on fall armyworm, and the combination of the two has an excellent synergistic effect, achieving the purpose of improving the insecticidal activity of Metarhizium reinhardtii Mr006 and reducing the amount of chlorantraniliprole; at the same time, it achieves the effect of taking into account both rapid and persistent effects, providing ideas for the management of pest resistance and providing a basis for the long-term green control of fall armyworm populations. DETAILED DESCRIPTION

[0018] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without making any creative work shall fall within the scope of protection of the present invention.

[0019] The present invention is further explained below in conjunction with specific implementation modes.

[0020] Example 1: Compatibility test of Metarhizium anisopliae Mr006 with pesticides

[0021] 1. Materials and Methods

[0022] 1. Test insect source

[0023] The fall armyworm used for indoor bioassay was collected from spring corn fields in Huangshan, Anhui Province in 2019. It was a laboratory population raised indoors on artificial diet for a long time without any exposure to pesticides during the breeding process. The breeding conditions were 27±1℃, photoperiod L:D=14:10h, and relative humidity 75±10%. The first larvae of the third instar with uniform body and healthy appearance were selected for the test.

[0024] 2. Test reagents

[0025] Tetracycline, 90%, Bayer AG; tetrachlorvinphos, 95%, Shenyang Kechuang Chemicals Co., Ltd.; cyantraniliprole, 94%, Shanghai DuPont Agrochemical Co., Ltd.; chlorantraniliprole, 95.3%, FMC Inc., USA; flubendiamide, 95%, Bayer AG.

[0026] Use acetone to prepare the stock solution of each agent into a certain concentration, and then use 0.1% Tween 80 aqueous solution to dilute it into 5-7 series of treatment solutions with concentration gradients. Use 0.1% Tween 80 aqueous solution without chemical agents as a control, and the amount of each concentration of the solution is not less than 50mL.

[0027] 3. Toxicity determination of diamide insecticides against fall armyworm

[0028] The determination was carried out in accordance with NY / T1154.6-2006 "Guidelines for Indoor Bioassay Tests of Pesticides" (Part 6, Insect Immersion Method). After the test insects were immersed in the liquid for 10 seconds, the excess liquid was absorbed with filter paper, and the test insects were transferred to normal conditions and fed with fresh corn leaves. The total number of insects in each treatment was 30, repeated 3 times, and the treatment with Tween 80 aqueous solution without pesticide was used as a control. The death of the test insects was investigated 24, 48 and 72 hours after treatment, and the total number of insects and the number of dead insects were recorded, and the mortality rate was calculated.

[0029] 4. Effect of chlorantraniliprole on spore germination of Mr006

[0030] The spores of Metarhizium anisopliae Mr006 cultured for 14 days on the SMAY plate were washed with sterile water containing 0.05% Tween-80, poured into a beaker, stirred thoroughly on a magnetic stirrer and diluted to a certain concentration. The spore concentration was checked with a hemocytometer under a microscope and adjusted to 1.0×10 8 spores / mL as the mother solution. 20mL SMY culture medium, 2mL spore liquid mother solution and the corresponding amount of chlorantraniliprole stock solution were added to a 50mL centrifuge tube in sequence, and the final spore concentration was 1.0×10 7 spores, the final concentration of chlorantraniliprole (24h) was 33.57 mg / L (LC 90 )、2.29mg / L(LC 50 )、0.56mg / L(LC 25 ). Tie the centrifuge tube with a rubber band and place it in a shaker. Set the temperature in the shaker to (28±1)℃ and the speed to 150r / min. Take it out after 18 hours of incubation and observe the spore germination under a microscope. Repeat 3 times for each treatment, observe 100 spores in each repeat, record the number of germinated spores, and calculate the spore germination rate. Use the spore solution without pesticide as the control.

[0031] 5. Effect of chlorantraniliprole on the mycelial growth of Mr006

[0032] Add the corresponding amount of drug to SMAY medium to prepare three concentrations of 33.57 mg / L (LC 90 )、2.29mg / L(LC 50 )、0.56mg / L(LC 25) containing drug plate (diameter 90 mm). Use a pipette to take 2 μL of a concentration of 1.0×10 7 Spore suspension of spores / mL was inoculated in the center of the drug-containing plate. After the culture plate was sealed, it was placed in an incubator at (27±1)℃ and 85% relative humidity. After 15 days, the colony diameter was measured by the cross method. Each treatment was repeated 3 times. The plate without drug was used as the control.

[0033] 6. Effect of chlorantraniliprole on the sporulation of Mr006

[0034] After completing the above-mentioned colony diameter measurement, pour 30 mL of sterile water containing 0.05% Tween-80 on the SMAY plate cultured for 15 days, use a glass spreading rod to scrape the spores of Metarhizium anisopliae Mr006, pour the spore liquid into a beaker, oscillate and mix on a magnetic stirrer, quantitatively dilute, check the spore concentration with a hemocytometer under a microscope, and calculate the spore production of each treatment.

[0035] 7. Effects of the sequence and time of application of Metarhizium anisopliae Mr006 and chlorantraniliprole on the synergistic effect of Spodoptera frugiperda

[0036] Preparation of chlorantraniliprole LC solution concentration 50 Dilution: The concentration of Mr006 spore suspension was selected as 1×10 7 Spores / mL, the concentration of chlorantraniliprole was 0.88mg / L (48h). Two groups of experiments were set up to determine the toxicity of fall armyworm by insect immersion method. ① First, treat with Mr006 spore suspension (immersion for 10s), and then conduct normal bioassay of chlorantraniliprole after 12h, 24h, 36h, and 48h; ② First, use chlorantraniliprole LC 50 After the treatment with the agent (immersion for 10 seconds), normal bioassay was carried out with Mr006 after intervals of 12h, 24h, 36h, and 48h; normal bioassay was carried out with Mr006 after intervals of 12h, 24h, 36h, and 48h.

[0037] 8. Data Statistical Methods

[0038] According to the toxicity test results, the LC of the toxicity regression line was calculated using the SAS 8.0 statistical analysis system. 25 , LC 50 and LC 90 The insecticidal activity against Spodoptera frugiperda was evaluated using the 95% confidence limit, b value and its standard error (SD).

[0039] 2. Results and Analysis

[0040] 1. Comparison of contact activity of diamide pesticides against fall armyworm (insect immersion method)

[0041] Table 1 Contact activity of diamide pesticides against the third instar larvae of fall armyworm (insect immersion method)

[0042]

[0043] The bioassay was carried out by insect immersion method. The median lethal concentration, 95% confidence interval and toxicity regression equation of the five diamide pesticides on the third instar larvae of fall armyworm 24, 48 and 72 hours after application are shown in Table 1. As can be seen from the table, the contact activity of the five pesticides on the third instar larvae of fall armyworm gradually increased with the extension of the action time. The contact activity of chlorantraniliprole was the highest 24h, 48h and 72h after application. 50 The values ​​were 2.29, 0.88 and 0.74 mg·L -1 Flubendiamide had the lowest contact activity, with the LC values ​​at 24h, 48h and 72h after application. 50 303.45, 179.78 and 114.92 mg·L respectively -1 Therefore, chlorantraniliprole was selected as the test agent in subsequent experiments to carry out compatibility tests and combined toxicity determinations with Metarhizium anisopliae Mr006.

[0044] 2. Effect of chlorantraniliprole on spore germination of Mr006

[0045] Table 2 Effect of chlorantraniliprole on spore germination of Metarhizium anisopliae Mr006

[0046] deal with Spore germination rate (%) CK 83.90±2.89a <![CDATA[0.56mg / L(LC 25 )]]> 87.32±1.53a <![CDATA[2.29mg / L(LC 50 )]]> 88.80±2.35a <![CDATA[33.57mg / L(LC 90 )]]> 90.76±2.16a

[0047] From the results in Table 2, we can see that the spore germination rates of Metarhizium anisopliae Mr006 treated with three concentrations of chlorantraniliprole were all higher than those of the control, among which LC 90 The spore germination rate of Mr006 was the highest, which was 90.76%, but there was no significant difference among the treatments.

[0048] 3. Effect of chlorantraniliprole on the mycelial growth of Mr006

[0049] Table 3 Effect of chlorantraniliprole on the growth rate of Metarhizium anisopliae Mr006

[0050] deal with Colony diameter (cm) CK 1.70±0.05a <![CDATA[0.56mg / L(LC 25 )]]> 1.63±0.04a <![CDATA[2.29mg / L(LC 50 )]]> 1.60±0.05a <![CDATA[33.57mg / L(LC 90 )]]> 1.70±0.03a

[0051] From the results in Table 3, it can be seen that the colony diameters of Metarhizium anisopliae Mr006 treated with three concentrations of chlorantraniliprole were 1.63 cm, 1.60 cm and 1.70 cm, respectively, with no significant differences compared with the control.

[0052] 4. Effect of chlorantraniliprole on the sporulation of Mr006

[0053] Table 4 Effect of chlorantraniliprole on the spore production of Metarhizium anisopliae Mr006

[0054]

[0055]

[0056] The results in Table 4 show that the conidia production of Metarhizium anisopliae Mr006 treated with three concentrations of chlorantraniliprole were 1.55×10 7 Pieces / cm 2 , 1.54×10 7 Pieces / cm 2 and 1.95×10 7 Pieces / cm 2 , there was no significant difference compared with the control.

[0057] 5. Effects of the sequence and time of application of Metarhizium anisopliae Mr006 and chlorantraniliprole on the synergistic effect of Spodoptera frugiperda

[0058] The above test results show that three different concentrations of chlorantraniliprole (original drug) have no effect on the mycelial growth, spore germination and spore production of Metarhizium reinhardtii Mr006. It can be seen that chlorantraniliprole (original drug) has good compatibility with Metarhizium reinhardtii Mr006.

[0059] Table 5 Toxicity of Metarhizium anisopliae Mr006 to Spodoptera frugiperda after chlorantraniliprole treatment at different times

[0060]

[0061]

[0062] The results in Table 5 show that the larvae of Spodoptera frugiperda were first treated with chlorantraniliprole, and then treated with Metarhizium anisopliae Mr006 after 12h, 24h, 36h and 48h, respectively. 50 The values ​​are 2.49×10 6 ,3.19×10 6 , 3.35×10 6 , 1.88×10 6 Spores mL -1 ; At the same time, the LC of the control strain Metarhizium anisopliae Mr006, which was not treated with chlorantraniliprole, was 50 The values ​​are 1.58×10 8 , 1.92×10 8 , 1.49×10 8 , 1.51×10 8 Spores mL -1 LC of Metarhizium anisopliae Mr006 after treatment with chlorantraniliprole at four time periods50 The values ​​were significantly lower than those of the control. The LC 50 The value was reduced by nearly 100 times. It can be seen that chlorantraniliprole showed excellent synergistic effect on Metarhizium anisopliae Mr006.

[0063] Table 6 Toxicity of chlorantraniliprole to fall armyworm at different times after treatment with Metarhizium brevis Mr006

[0064]

[0065] The results in Table 6 show that the larvae of fall armyworm were first treated with Metarhizium anisopliae Mr006, and then treated with chlorantraniliprole after 12h, 24h, 36h and 48h, respectively. 50 The values ​​were 0.094, 0.045, 0.016, and 0.039 mg·mL, respectively. -1 ; At the same time, the LC of chlorantraniliprole in the control group without treatment with Metarhizium anisopliae Mr006 was 50 The values ​​were 0.957, 0.589, 0.248, and 0.646 mg·mL, respectively. -1 LC of chlorantraniliprole after treatment with Metarhizium anisopliae Mr006 in four time periods 50 The values ​​were significantly lower than those of the control. The LC 50 The value was reduced by more than 10 times. It can be seen that Metarhizium anisopliae Mr006 also showed excellent synergistic effect on chlorantraniliprole.

[0066] Conclusion: Diamide pesticides are the mainstream chemical pesticides for the control of Noctuidae pests such as fall armyworm. Compared with other diamide pesticides, chlorantraniliprole showed excellent insecticidal activity against fall armyworm. It had no effect on the mycelial growth, spore germination and spore production of Metarhizium anisopliae Mr006, and the two had good compatibility.

[0067] The combination of Metarhizium reinhardtii Mr006 and chlorantraniliprole, chlorantraniliprole first treatment can significantly reduce the LC of Metarhizium reinhardtii Mr006 50 The value was more than 100 times, and the first treatment with Metarhizium anisopliae Mr006 could also significantly reduce the LC value of chlorantraniliprole. 50 The value was more than 10 times; the order of use was not affected, and both showed excellent synergistic effects. In addition, the first treatment with Metarhizium anisopliae Mr006 could significantly reduce the LC value of chlorantraniliprole 50 The value can provide data support for the subsequent treatment of the resistance of fall armyworm by using Metarhizium muscardine Mr006. The above test results have not been reported in the literature.

[0068] Example 2: Test on the combined effect of Metarhizium anisopliae Mr006 and chlorantraniliprole on Spodoptera frugiperda

[0069] Test method: Refer to NY / T1154.6-2006 "Guidelines for Indoor Bioassay of Pesticides" (Part 6, Immersion Method) for determination. After the test insects are immersed in the liquid for 10 seconds, the excess liquid is absorbed with filter paper, and the test insects are transferred to normal conditions and fed with fresh corn leaves. The total number of insects per treatment is 30, repeated 3 times, and the Tween 80 aqueous solution without pesticide is used as a control. 24 hours after treatment, the death of the test insects is investigated, the total number of insects and the number of dead insects are recorded, and the mortality rate is calculated.

[0070] Based on the single-dose LC50, chlorantraniliprole solution and Mr006 bacterial solution (chlorantraniliprole is 2.29 mg mL -1 , Metarhizium anisopliae Mr006 was 1.84×10 8 Spores mL -1 ), and the Mr006 bacterial solution and chlorantraniliprole were compounded at volume ratios of 0:10, 1:9, 3:7, 1:1, 7:3, 9:1 and 10:0, respectively.

[0071] Calculation of combined toxicity enhancement:

[0072] Eth=I 1×V1+I2×V2; where Eth is the theoretical control effect of the compound, i.e., the theoretical insecticidal activity of the compound against fall armyworm, I 1 is the insecticidal activity of Mr006 against fall armyworm, V1 is the volume ratio of Mr006 in the mixture, I2 is the insecticidal activity of chlorantraniliprole against fall armyworm, and V2 is the volume ratio of chlorantraniliprole in the mixture.

[0073] IR = Eab / Eth; wherein IR is the synergistic ratio, and Eab is the actual protective effect of the compound agent, that is, the insecticidal activity of the compound agent against fall armyworm.

[0074] The synergistic effect of different formulations was determined based on the IR value. IR>1 indicated a synergistic effect; IR=1 indicated an additive effect; and IR<1 indicated an antagonistic effect.

[0075] Test results: As shown in Table 7, the combination of Metarhizium anisopliae Mr006 and chlorantraniliprole has a significant synergistic effect on Spodoptera frugiperda, which can significantly reduce the dosage of active ingredients and slow down the development of insecticide resistance in pests.

[0076] Table 7 Combined effects of Metarhizium anisopliae Mr006 and chlorantraniliprole on Spodoptera frugiperda

[0077]

[0078]

[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention, rather than to limit it.

Claims

1. A use of an insecticidal composition for controlling fall armyworm, characterized in that: The active ingredients of the insecticide composition are composed of Metarhizium raiberii Mr006 and chlorantraniliprole, wherein the concentration of Metarhizium raiberii Mr006 is 1-9×10 8 Spores mL -1 , the concentration of chlorantraniliprole is 1-5 mg·mL -1 The volume ratio of the two is 10:1-1:

10.

2. The use according to claim 1, characterized in that The concentration of chlorantraniliprole was 2.29 mg·mL -1 , the concentration of Metarhizium anisopliae Mr006 was 1.84×10 8 Spores mL -1 .

3. The use according to claim 1 or 2, characterized in that: It also contains agricultural auxiliary material components, and the dosage form of the insecticide composition is suspension, wettable powder and water dispersible granules.

Images