A self-assembled nano-complex based on CRISPR / Cas9 system and ursolic acid, and a preparation method and application thereof

By delivering the CRISPR/Cas9 system and ursolic acid through self-assembled nanoparticles, the safety of CRISPR/Cas9 system delivery in vivo and the limitations of traditional treatment are resolved, efficient targeted delivery and gene knockout of liver cancer are achieved, and the effect of tumor immunotherapy is enhanced.

CN118453916BActive Publication Date: 2025-10-14FUZHOU UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202410536024.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-30
Publication Date
2025-10-14
Estimated Expiration
2044-04-30

AI Technical Summary

Technical Problem

The existing CRISPR/Cas9 system has safety and efficacy issues during in vivo delivery. Traditional immune checkpoint antibody therapy has disadvantages such as high price, easy development of drug resistance and complex operation. In addition, traditional chemotherapy and gene therapy have limited effects in the treatment of liver cancer.

Method used

Through self-assembly technology, the natural drug ursolic acid, the CRISPR/Cas9 system targeting the TIM3 gene, and low molecular weight protamine are co-assembled to form nanoparticles, achieving tumor-targeted delivery and gene knockout, thereby enhancing the effect of immunotherapy.

Benefits of technology

It achieves efficient and safe tumor-targeted delivery and TIM3 gene knockout, improves the tumor microenvironment, synergizes chemotherapy and gene therapy, and provides a new strategy for multimodal combination treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118453916B_ABST
    Figure CN118453916B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to preparation and application of a self-assembled nanocomposite based on a CRISPR / Cas9 system and ursolic acid. The nanocomposite takes UA self-assembled nanodrug UA NPs as a core, and is co-assembled with low-molecular-weight protamine LMWP having good cell penetration capacity and a CRISPR / Cas9 plasmid pTIM3 for knocking down TIM3 to form a nanocomposite ULP NPs. The nanocomposite prepared in the application can be enriched at a tumor site through EPR effect, and can reach the effect of enhancing liver cancer immunotherapy by knocking down the inhibitory immune checkpoint TIM3. The regulation characteristics and molecular mechanism of the UA NPs as a self-assembled general template for delivering the CRISPR / Cas9 system to inhibit the immune checkpoint TIM3 are disclosed, and the application has a wide application prospect in liver cancer immunotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a self-assembled nanocomposite based on the CRISPR / Cas9 system and ursolic acid, and a preparation method and application thereof. Background Art

[0002] Liver cancer (HCC) is the most common and lethal cancer worldwide. Hepatocellular carcinoma (HCC), which accounts for over 90% of all liver cancer cases, is a common malignancy of the digestive system. Its morbidity and mortality rates rank sixth and fourth worldwide, respectively. Despite significant advances in clinical cancer treatment, patient survival remains low due to high rates of tumor metastasis and recurrence after surgery.

[0003] In recent years, immunotherapy has shown great potential in the treatment of liver cancer. Immunotherapy has revolutionized traditional cancer treatment approaches. Compared to chemotherapy and drugs that directly kill cancer cells, immunotherapeutic drugs activate or enhance the immune system, allowing the body's own immune system to attack cancer cells and reshape the tumor immune microenvironment. Currently, immunotherapies that harness the body's own immune system include immunostimulation, adoptive T cell transfer, vaccination, and immune checkpoint blockade (ICB). Among them, immune checkpoint blockade immunotherapy has made significant progress in cancer treatment. Immune checkpoint proteins are stimulatory or inhibitory regulatory factors that play a key role in maintaining immune homeostasis and suppressing autoimmunity. T-cell immunoglobulin mucin 3 (TIM-3) is an important new immune checkpoint protein that negatively regulates antitumor immune responses and plays a crucial role in immunomodulation of the tumor microenvironment. It has gradually become a new target for tumor immunotherapy. However, these immune checkpoint antibodies often have disadvantages such as high cost, susceptibility to drug resistance, complex procedures, and continuous dosing.

[0004] Clustered regularly interspaced short palindromic repeats / CRISPR-associated nucleus 9 (CRISPR / Cas9), an emerging gene editing technology, offers the advantages of high specificity and irreversibility when combined with immune checkpoints. Furthermore, this technology overcomes the shortcomings of traditional immune checkpoints, offering advantages such as low cost, high efficiency, and ease of use. Therefore, CRISPR / Cas9 gene editing technology has become a powerful tool for identifying new targets for cancer immunotherapy. Chinese patent CN107130000A, "A CRISPR-Cas9 system for simultaneous knockout of KRAS and EGFR genes and its application," discloses a CRISPR-Cas9 system for simultaneous knockout of both KRAS and EGFR genes, including a sgRNA specifically targeting KRAS. Studies have shown that this system can be used to treat various cancers with abnormal expression of EGFR and KRAS.

[0005] Due to the large size of CRISPR plasmids, safe and effective in vivo delivery is an urgent challenge. Compared to viral vectors, delivering CRISPR plasmids via nanomedicines is safe and non-mutagenic. Chinese patent CN115068631A, "A CRISPR / Cas9 delivery system, its preparation method, and application," discloses a method for efficiently delivering the CRISPR system to lesions using superparamagnetic nanoparticles, cationic polymers, and targeting molecules. Ursolic acid (UA) self-assembled nanomedicines are ideal nanocarriers, serving as both a drug and a carrier. Building on previous research, Chinese patent CN106581693A, "An ursolic acid conjugate with anticancer activity as a drug carrier or molecular probe carrier," describes the use of ursolic acid-UA conjugates to encapsulate drugs or molecular probes to form nanoparticles, which can be used as carriers for anticancer drugs or fluorescent substances, effectively addressing a range of anticancer drug solubility issues. Therefore, ursolic acid can deliver the CRISPR / Cas9 system to tumors through the EPR effect. In addition, UA nanoparticles (UA NPs) have the ability to synergize immunotherapy and can further improve the gene editing efficiency of plasmids.

[0006] Cell-penetrating peptides possess the inherent ability to transport across cell membranes, making them a safe and effective method. Naturally derived low molecular weight protamine (LMWP) is highly cationic and is a suitable cell-penetrating peptide for intracellular protein and gene delivery. While its effects are similar to those of TAT peptide, its toxicity is less than that of other transmembrane peptides. Due to the presence of a nuclear localization site (NLS) in the sequence, the nanocomposite can be delivered directly to the cell nucleus to achieve targeted gene knockout, avoiding off-target effects. Chinese patent CN116139274A, "A Self-Assembled Propranolol Nanodrug and Its Preparation Method," discloses a nanodrug that self-assembles a propranolol nanodrug with low molecular weight protamine. Studies have shown that this nanodrug significantly inhibits the migration of hemangioma stem cells. Compared to the original propranolol drug, the self-assembled propranolol nanodrug synthesized in this invention exhibits significantly enhanced transdermal permeability.

[0007] Therefore, the present invention leverages mature nanotechnology to combine chemotherapy drugs with gene therapy. Through carrier-free self-assembly technology, this effectively combines gene therapy and chemotherapy, constructing a gene-chemotherapeutic drug nano-delivery system. Appropriately modifying the nano-drug surface with protamine enhances its stability, targeting, and biocompatibility.

[0008] Based on this background, the present invention proposes to construct a cell-penetrating peptide and co-assemble CRISPR / Cas9 with ursolic acid's unique "drug-by-drug" properties to form a simple and efficient nano-delivery system. Ursolic acid not only exerts anti-tumor effects but can also be combined with gene therapy to block the expression of the immune checkpoint TIM3 protein, improve the immunosuppressive tumor microenvironment, and achieve synergistic effects between chemotherapy and gene therapy, providing new ideas for multimodal cancer treatment. Summary of the Invention

[0009] To address the above-mentioned issues, the present invention aims to provide a self-assembling nanocomplex based on the CRISPR / Cas9 system and ursolic acid, as well as its preparation method and application. This invention co-assembles the natural drug ursolic acid, the CRISPR / Cas9 system targeting the TIM3 gene, and LMWP into nanoparticles through intermolecular electrostatic and hydrophobic interactions. This nanocomplex possesses excellent tumor recognition and immune evasion capabilities, resulting in a multifunctional nanodrug delivery system with tumor-targeting capabilities. The nanocomplex prepared by this invention can be enriched at the tumor site through the EPR effect and, by knocking down the inhibitory immune checkpoint TIM3, enhances the immunotherapy effect of liver cancer. This multifunctional nanoparticle integrates a multidrug and multitherapy combination strategy to achieve enhanced tumor suppression. This study reveals the regulatory characteristics and molecular mechanisms of UA NPs as a self-assembling universal template for delivering the CRISPR / Cas9 system to inhibit the immune checkpoint TIM3, demonstrating broad application prospects in liver cancer immunotherapy.

[0010] In order to achieve the above object, the present invention adopts the following technical solutions:

[0011] A self-assembling nanocomplex based on the CRISPR / Cas9 system and ursolic acid. It uses ursolic acid (UA), a naturally occurring small molecule with anti-tumor activity, as its core. This nanocomplex is co-assembled with a cell-penetrating peptide and a CRISPR / Cas9 plasmid. The CRISPR / Cas9 plasmid is pTIM3, which targets the TIM3 immune checkpoint gene, and the cell-penetrating peptide is low molecular weight protamine (LMWP).

[0012] The method for preparing the self-assembled nanocomplex based on the CRISPR / Cas9 system and ursolic acid comprises the following steps:

[0013] 1) Under vortex conditions, a small molecule ursolic acid (UA) methanol solution was slowly dropped into ultrapure water, and the methanol was evaporated by ultrasonication at 25°C for 20 minutes to obtain small molecule ursolic acid nanoparticles (UA NPs);

[0014] 2) Dissolve low molecular weight protamine (LMWP) in water, add the CRISP / Cas9 plasmid pTIM3, mix, and incubate overnight on a shaker at 37°C, 220 rpm to form positively charged LMWP@pTIM3;

[0015] 3) Under vortex conditions, the LWWP@pTIM3 solution was slowly dripped into the UA NPs to obtain self-assembled nanocomplex particles ULP NPs based on the CRISPR / Cas9 system and ursolic acid.

[0016] Furthermore, in step 1), the concentration of the UA methanol solution is 4 mg / mL.

[0017] Furthermore, in step 2), the concentration of LWMP is 5 mg / mL, and the mass ratio of LMWP:pTIM3 is 10:1.

[0018] Furthermore, in step 2), the CRISP / Cas9 plasmid pTIM3 is prepared by adding a double-stranded DNA sequence of the oligonucleotide sequence 5'-ATAGGCATCTACATCGGAGC-3' of the sgRNA targeting TIM3 to the pX459 plasmid digested with Bpil enzyme. The specific preparation method includes the following steps:

[0019] Based on the requirements of the Bpil restriction site in the pX459 plasmid, the oligonucleotide sequence 5'-ATAGGCATCTACATCGGAGC-3' of the sgRNA targeting TIM3 was synthesized to obtain the following forward and reverse oligonucleotide sequences:

[0020] TIM3-sgRNA-F: 5'-CACCGATAGGCATCTACATCGGAGC-3';

[0021] TIM3-sgRNA-R: 5'-AAACGCTCCGATGTAGATGCCTATC-3';

[0022] The two synthesized oligonucleotide sequences were annealed to form complementary DNA double strands; then, T4 DNA ligase was used to ligate the DNA double strands to the pX459 plasmid digested with Bpil enzyme to form the recombinant plasmid pTIM3.

[0023] Furthermore, in step 3), the amount of UA NPs input was 160 μg, and the mass ratio of UA:LWMP:pTIM3 was 80:10:1;

[0024] Furthermore, in step 3), the particle size of the ULP NPs is 165 nm.

[0025] Application of the above-mentioned self-assembled nanocomplex based on CRISPR / Cas9 system and ursolic acid in liver cancer immunotherapy preparations.

[0026] The advantages of the present invention are:

[0027] (1) The nanocomplex prepared by the present invention utilizes the unique "drug-to-drug" property of the natural active small molecule ursolic acid and uses it as a nanocore to co-assemble pTIM3 and cell-penetrating peptides through intermolecular forces to form a simple and efficient nanodelivery system, avoiding the potential toxicity brought by traditional carriers.

[0028] (2) The nanocomplex prepared by the present invention is based on CRISPR / Cas9 technology to achieve more thorough and efficient TIM3 gene knockout, and the natural product ursolic acid is selected as the nanodrug for delivering CRISPR / Cas9. Ursolic acid can regulate the tumor immune microenvironment while killing tumor cells, and cooperate with the TIM3 target combined immune regulation mechanism to overcome the limitations of traditional chemotherapy and gene monotherapy, providing new strategies and methods for advanced combined therapy of malignant tumors.

[0029] (3) Naturally derived low molecular weight protamine (LMWP) is highly cationic and is a cell-penetrating peptide suitable for intracellular protein and gene delivery. Although its effect is similar to that of TAT peptide, its toxicity is less than that of other cell-penetrating peptides.

[0030] (4) The multifunctional nanosystem prepared by the present invention has good stability under various physiological conditions.

[0031] (5) The preparation process of the multifunctional nanoparticles prepared by the present invention is simple and efficient. It integrates the multi-drug and multi-therapy strategy into the same nano-drug delivery system, which changes the limitations of traditional single chemotherapy on tumor inhibition and shows great potential in the field of liver cancer treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Figure 2 shows the particle size of UA NPs and ULP NPs.

[0033] Figure 2 Stability of ULP NPs particle size under different physiological conditions for 5 days.

[0034] Figure 3 This is a graph showing the uptake of ULP NPs by liver cancer cell HepG2 cells at different times.

[0035] Figure 4 This is a diagram showing the uptake of different nanoparticle drugs by liver cancer cell HepG2 cells.

[0036] Figure 5 This is a diagram showing the inhibition of nanomedicine on the proliferation of tumor cells and normal cells.

[0037] Figure 6 Figure 2 shows the efficiency of nanomedicine for gene knockout. Control: PBS phosphate buffer; LP: LMWP@pTIM3, a mixture of LMWP and pTIM3; UA NPs: ursolic acid nanoparticles; ULP NPs: self-assembled nanocomposite particles based on the CRISPR / Cas9 system and ursolic acid.

[0038] Figure 7 Tyndall effect of UA NPs and ULP NPs. DETAILED DESCRIPTION

[0039] In order to make the contents of the present invention easier to understand, the technical solutions of the present invention are further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0040] Example 1

[0041] A preparation method for a nanocomplex based on the co-assembly of the self-assembling drug UA with LMWP and the CRISP / Cas9 plasmid pTIM3 comprises the following steps:

[0042] 1) Under vortex conditions, a 4 mg / mL UA methanol solution was slowly dropped into ultrapure water, and the methanol was evaporated by ultrasonication at 25°C for 20 min to obtain UA nanoparticles (UA NPs).

[0043] 2) Low molecular weight protamine (LMWP) (Shanghai Sangon Biotech Co., Ltd.) was dissolved in water to a concentration of 5 mg / mL. CRISP / Cas9 plasmid pTIM3 was added at a LMWP:pTIM3 mass ratio of 10:1. The mixture was mixed and incubated overnight on a shaker at 37°C, 220 rpm to form positively charged LMWP@pTIM3.

[0044] 3) With an input amount of 160 μg of UA NPs, the LWWP@pTIM3 solution was slowly added dropwise to the UA NPs at a mass ratio of UA:LWMP:pTIM3 of 80:10:1 under vortexing conditions to obtain ULP nanocomposite particles (ULP NPs).

[0045] In the above method, the CRISPR / Cas9 plasmid pTIM3 is a plasmid targeting the TIM3 immune checkpoint gene. Its construction method is as follows: First, based on the requirements of the Bpil restriction site of the pX459 plasmid, the oligonucleotide sequence of the sgRNA targeting TIM3 (ATAGGCATCTACATCGGAGC) was synthesized to obtain the following forward and reverse oligonucleotide sequences:

[0046] TIM3-sgRNA-F: 5'-CACCGATAGGCATCTACATCGGAGC-3';

[0047] TIM3-sgRNA-R: 5'-AAACGCTCCGATGTAGATGCCTATC-3';

[0048] Secondly, the two synthesized oligonucleotide sequences were annealed to form complementary DNA double strands. T4 DNA ligase was then used to ligate the DNA double strands to the pX459 plasmid digested with Bpil enzyme to form a recombinant plasmid. The ligated recombinant plasmid was then transformed into competent Escherichia coli DH5α, and positive clones were screened on ampicillin-coated plates. Finally, gene sequencing was used to verify whether the plasmid in the strain was successfully linked to the TIM3-targeting sgRNA oligonucleotide sequence. The verified correct plasmid was named pTIM3.

[0049] Example 2

[0050] The particle size of the ULP nanoparticles (ULPNPs) prepared in Example 1 was evaluated using a Zetasizer NanoZS90 (Malvern, UK).

[0051] like Figure 1 As shown, the particle size of the prepared nanoparticles is about 165 nm.

[0052] Example 3

[0053] The storage stability of ULP NPs was studied by monitoring size changes. The ULP NPs prepared in Example 1 were placed in ddH2O, RPMI-1640 + 10% fetal bovine serum (1640 + 10% FBS), and DMEM + 10% fetal bovine serum (DMEM + 10% FBS) for 5 days. Changes were observed and the particle size of the ULP NPs was measured daily.

[0054] like Figure 2 As shown in Figure 3, the particle size changes of ULP NPs in ddH2O, DMEM+10% fetal bovine serum, and RPMI-1640+10% fetal bovine serum for 5 days were detected by Malvern particle size analyzer, verifying the physiological stability of the nanocomposite.

[0055] Example 4

[0056] The human liver cancer HepG2 cell line was used as the experimental cell line. To image the cellular uptake of each group of nanomedicines, ICG was used as a fluorescent dye to label the nanomedicines. After washing the cells with saline, 1 mL of trypsin was added to a 12-well plate, and then the cells were washed with saline. When the cells floated, culture medium was added to terminate the digestion. The cells were collected by centrifugation and 5×10 4 Cells were seeded in 12-well plates at 4 wt% paraformaldehyde per well. The culture medium was discarded, and the cells were fixed with 4 wt% paraformaldehyde for 15 minutes. The cells were washed with saline, and then 200 μL (5 μg / mL) of Hoechst 33342 was added and nucleation was allowed to proceed for 10-15 minutes. After treatment, the slides were blocked with an anti-fluorescence quencher. The uptake of different groups of nanoparticles by cells was observed under a laser confocal microscope. The cell nuclei are represented by blue, and the nanodrugs are represented by red. The same method was used to study the uptake of nanodrugs by HepG2 cells at different times. The cells were treated with ULP NPs and incubated for 1 h, 2 h, 2 h, 4 h, and 8 h. The uptake of nanodrugs by cells at different times was then photographed using the same method as above.

[0057] like Figure 3 As shown in the figure, with the increase of administration time, the accumulation of ULP NPs in tumor cells continued to increase and the uptake of ULP NPs was time-dependent.

[0058] like Figure 4 As shown in the figure, the uptake of different groups of drugs by HepG2 liver cancer cells. Laser confocal microscopy results showed that compared with ULP NPs, the red fluorescence intensity of UANPs near HepG2 was lower, while ULP NPs showed stronger fluorescence intensity, indicating that the introduction of LMWP can enhance the cellular uptake of nanocomplexes.

[0059] Example 5

[0060] The toxicity of the nanomedicine to normal liver cells L02 and liver cancer cells HepG2 was verified by MTT assay. L02 cells were digested with 1 mL of trypsin-containing EDTA for 2-3 min and digestion was terminated by adding 1 mL of culture medium. The cells were blown off and transferred to an EP tube. The supernatant was removed and resuspended in culture medium. Approximately 10 cells were added to each well. 4 Cells were dispersed in a 96-well plate, with five wells per group, and incubated overnight. These cells adhered to the cell wall. UA NPs and ULP NPs were diluted in DMEM medium to a concentration gradient of 1 μg / mL, 5 μg / mL, 10 μg / mL, 20 μg / mL, and 40 μg / mL, respectively, and incubated for 24 hours. At the end of the dosing period, the medium was discarded and the cells were incubated with MTT for 4 hours. 100 μL of DMSO was added, the plates were shaken for 5-10 minutes, and the absorbance was measured at 490 nm using a microplate reader. Cell viability was calculated, and the effects of different concentrations of UANPs and ULP NPs on the growth of normal cells and liver cancer cells were analyzed.

[0061] like Figure 5 As shown in the MTT assay, UA NPs and ULP NPs had little effect on the proliferation of normal cells, indicating that they had no significant toxic side effects on normal cells. UA NPs had a certain killing effect on liver cancer cells, demonstrating that UANPs have anti-tumor activity and exhibit synergistic effects in the delivery of pTIM3.

[0062] Example 6

[0063] The efficiency of gene editing was evaluated using the T7EI enzyme digestion method. T7EI is an unpaired endonuclease. Under the action of the CRISPR / Cas9 system, mutant DNA and wild-type DNA fragments can anneal to form mismatched DNA fragments, which T7EI enzyme cleaves to form new DNA fragments. If the genome is not mutated, T7EI enzyme will not cut it, and no new DNA fragments will be generated.

[0064] (1) Cell collection:

[0065] HepG2 cells growing logarithmically were digested with 1 mL of trypsin and spread in a 6-well plate. After the cells adhered to the cell wall and grew, UA NPs, LP, and ULPNPs diluted in DMEM were added. After 48 hours of culture, the cells were digested with trypsin and collected by centrifugation.

[0066] (2) Genome extraction:

[0067] After repeated centrifugation twice, resuspend the cells in buffer, add the binding solution, and immediately shake to mix. Then, add protease and place in a 70°C oven for 10 minutes. After cooling, add isopropanol and shake well. Remove the inhibitor solution at 12,000 rpm, discard the solution for 30 seconds, and then wash twice with rinse solution. Remove the rinse solution, apply the preheated eluate to the adsorption column, incubate at room temperature for 5 minutes, and repeat the elution once to obtain the extracted genomic DNA.

[0068] (3) PCR amplification:

[0069] Design upstream and downstream verification primers 600-800 bp before and after the TIM3 target gene sgRNA sequence:

[0070] TIM3-F: 5'-GAATACAGAGCGGAGGTCGG-3';

[0071] TIM3-R: 5'-CATTGCAAAGCGACAACCCA-3'.

[0072] According to the designed primers, the fragment containing the mutation site was amplified by PCR using mutant DNA and wild-type DNA as templates.

[0073] (4) Denaturation and annealing of PCR products:

[0074] The PCR products were denatured and annealed.

[0075] (5) T7EI enzyme digestion:

[0076] T7EI enzyme was added to the annealed PCR product and incubated at 37°C for 20 min. The digestion was immediately terminated by adding DNA loading buffer, mixed, and incubated at 65°C for 10 min. The digestion results were verified by electrophoresis on a 1 wt% agarose gel.

[0077] like Figure 6 As shown, T7EI digestion results showed that ULP NPs had high gene editing efficiency in HepG2 cells.

[0078] Example 7

[0079] Use vials to fill UA NPs and ULP NPs solutions respectively, and then irradiate the vials with laser.

[0080] like Figure 7 As shown, the light beam can pass through the vial, showing a Tyndall effect, indicating the presence of a synthesized nanocomposite.

Claims

1. A self-assembled nanocomplex based on the CRISPR / Cas9 system and ursolic acid, characterized by: The nanoparticle drug, which is self-assembled from the natural product small molecule ursolic acid, is co-assembled with a cell-penetrating peptide and a CRISPR / Cas9 plasmid to form a nanocomplex. The membrane-penetrating peptide is a low molecular weight protamine with cell penetrating ability; The CRISPR / Cas9 plasmid is a plasmid pTIM3 that can target the TIM3 protein immune checkpoint gene; The preparation method of the self-assembled nanocomposite comprises the following steps: 1) Under vortex conditions, the small molecule ursolic acid UA methanol solution was slowly dripped into ultrapure water, and the methanol was evaporated by ultrasonication to obtain small molecule ursolic acid nanoparticles UA NPs; 2) Dissolve low molecular weight protamine (LMWP) in water, add plasmid pTIM3, mix, and incubate on a shaker overnight to form positively charged LMWP@pTIM3. 3) Under vortex conditions, the LMWP@pTIM3 solution was slowly dripped into the UA NPs prepared in step 1) to obtain self-assembled nanocomplex particles ULP NPs based on the CRISPR / Cas9 system and ursolic acid.

2. The self-assembled nanocomposite according to claim 1, wherein: The plasmid pTIM3 is formed by ligating a double-stranded DNA of the oligonucleotide sequence 5'-ATAGGCATCTACATCGGAGC-3' of the sgRNA targeting TIM3 to the pX459 plasmid digested with Bpil enzyme.

3. The self-assembled nanocomposite according to claim 1, wherein: In step 1), the concentration of the small molecule ursolic acid methanol solution is 4 mg / mL.

4. The self-assembled nanocomposite according to claim 1, wherein: In step 1), the ultrasonic volatilization of methanol is carried out under the following conditions: ultrasonication at 25° C. for 20 minutes.

5. The self-assembled nanocomposite according to claim 1, wherein: In step 2), the concentration of LMWP is 5 mg / mL, and the mass ratio of LMWP:pTIM3 is 10:

1.

6. The self-assembled nanocomposite according to claim 1, wherein: In step 2), the incubation temperature is 37°C.

7. The self-assembled nanocomposite according to claim 1, wherein: In step 3), the amount of UA NPs input was 160 μg, and the mass ratio of UA:LMWP:pTIM3 was 80:10:

1.

8. Use of the self-assembled nanocomplex based on the CRISPR / Cas9 system and ursolic acid as claimed in claim 1 in the preparation of a liver cancer immunotherapy preparation.

Citation Information

Patent Citations

  • Application of ursolic acid conjugate having anticancer activity and serving as drug carrier or molecular probe carrier

    CN106581693A

  • CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas9 system capable of simultaneously knocking out KRAS genes and EGFR (Epidermal Growth Factor Receptor) genes and application thereof

    CN107130000A

  • CRISPR / Cas9 delivery system as well as preparation method and application thereof

    CN115068631A

  • Self-assembled propranolol nano-drug and preparation method thereof

    CN116139274A

  • Aptamer-ursolic acid conjugate carrier-free self-assembly nanoparticles for and preparation and application thereof

    CN107349429A