Application of protein and its related biomaterials in regulating soybean plant type and improving yield

By using proteins and their derivatives with amino acid sequences of SEQ ID No. 1 or SEQ ID No. 4, and by using CRISPR-Cas9 gene editing technology to knock out the GmMBR2 and GmMBR4 genes, soybean plant architecture and yield were regulated, solving the problem of unclear soybean plant architecture regulation mechanism and achieving increased soybean yield.

CN118546225BActive Publication Date: 2026-04-14INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410793561.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-19
Publication Date
2026-04-14
Estimated Expiration
2044-06-19

AI Technical Summary

Technical Problem

The mechanism of soybean plant architecture regulation is unclear in existing technologies, there is insufficient research on its impact on soybean yield improvement, and there is a lack of effective breeding methods.

Method used

By using proteins and their derivatives with amino acid sequences of SEQ ID No. 1 or SEQ ID No. 4, combined with CRISPR-Cas9 gene editing technology, the GmMBR2 and GmMBR4 genes were knocked out, thereby regulating soybean plant architecture and yield.

Benefits of technology

It can significantly increase the number of branches and pods in soybeans, reduce plant height, cultivate high-yielding soybean varieties, and guide soybean breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004900801670000091
    Figure BDA0004900801670000091
  • Figure BDA0004900801670000101
    Figure BDA0004900801670000101
  • Figure HDA0004900801680000011
    Figure HDA0004900801680000011
Patent Text Reader

Abstract

The application discloses application of a protein and related biomaterials thereof in regulating soybean plant type and improving yield. The application belongs to the technical field of biotechnology, and particularly relates to application of the protein and related biomaterials thereof in regulating soybean plant type and improving yield. The protein of the application is a composition of proteins with amino acid sequences of SEQ ID No. 1 and / or SEQ ID No. 4; or a protein with a function of regulating plant type or / and yield, which is obtained by substitution, deletion and / or addition of amino acid residues on the above-mentioned protein; or a fusion protein obtained by connecting a protein tag to the N terminal and / or C terminal of the above-mentioned protein. By regulating the activity or content of the above-mentioned protein, a soybean variety with changed plant type and improved yield can be obtained.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of proteins and related biomaterials in regulating soybean plant architecture and increasing yield. Background Technology

[0002] Soybeans, as an important crop used for both grain and oilseed production, play a crucial role in ensuring my country's food security and agricultural trade. With the continuous improvement of people's living standards, the demand for vegetable oil and feed protein has increased dramatically. Compared with major soybean producing countries such as the United States, Brazil, and Argentina, my country's soybean production is relatively low, unable to meet daily production and living needs, resulting in a strong dependence on imported soybeans. Given the limited soybean planting area, how to rapidly and effectively improve soybean varieties and increase soybean yield through modern bio-breeding technologies is a critical production problem that urgently needs to be solved and a breeding technology bottleneck that urgently needs to be overcome.

[0003] Crop plant architecture plays a decisive role in the morphogenesis of individual plants and the crop population, and is a crucial factor influencing plant yield, crop production level, and economic benefits. Crop plant architecture includes plant height, branching (tillering), leaf shape, and spike type (pod-setting habit). Crop plant architecture domestication or improvement plays a vital role in achieving significant breakthroughs in crop yield. However, current research on the regulatory mechanisms of soybean plant architecture and key genes involved in this regulation is still in the exploratory stage, with few related research reports. The molecular mechanisms, key genes, and functional networks affecting soybean plant architecture regulation remain unclear. In particular, due to limitations in research materials, there is a lack of research on which plant architecture is more conducive to increasing soybean yield under field production conditions. Therefore, further exploration of more plant architecture regulatory genes is not only of significant theoretical value for discovering superior soybean plant architecture regulatory genes and cultivating high-yielding ideal plant architectures; but also, through the creation of specific materials, allows for the systematic evaluation and selection of ideal soybean plant architectures under production conditions, which has significant practical application value for ultimately realizing breeding applications and improving soybean yield. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to regulate plant shape and increase yield.

[0005] To address the problems existing in the prior art, the present invention provides a protein.

[0006] The protein provided by this invention may be any of the following:

[0007] G1) A composition consisting of a protein whose amino acid sequence is SEQ ID No. 1 and a protein whose amino acid sequence is SEQ ID No. 4;

[0008] G2) The amino acid sequence of the protein is SEQ ID No. 1 or / and the amino acid sequence of the protein is SEQ ID No. 4;

[0009] G3) Proteins obtained by substituting and / or deleting and / or adding amino acid residues of proteins G1) and G2) have more than 75% identity with the protein shown in A1) and have functions related to regulating plant architecture and / or yield; for example, those skilled in the art can, based on the amino acid sequence shown in SEQ ID No. 1 or SEQ ID No. 4 and other conventional techniques such as the conserved substitution of amino acids, obtain protein mutants with the same function as the amino acid sequence shown in SEQ ID No. 1 or SEQ ID No. 4 by substituting, deleting and / or adding one or more amino acids without affecting their activity;

[0010] G4) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of G1) or G2).

[0011] The protein with the above amino acid sequence as SEQ ID No. 1 is the GmMBR2 protein.

[0012] The protein with the above amino acid sequence, SEQ ID No. 4, is the GmMBR4 protein.

[0013] To facilitate the purification or detection of proteins in G1, a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 1 or SEQ ID No. 4 in the sequence listing.

[0014] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0015] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.

[0016] Those skilled in the art can readily mutate the nucleotide sequences encoding the proteins GmMBR2 or GmMBR4 of this invention using known methods, such as directed evolution or point mutation. Artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the proteins GmMBR2 or GmMBR4 isolated in this invention, provided they encode and function as proteins GmMBR2 or GmMBR4, are derived from and equivalent to the nucleotide sequences of this invention.

[0017] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0018] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid or nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of a pair of amino acid sequences or nucleotide sequences, then the identity value (%) can be obtained.

[0019] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0020] In this document, the 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0021] The protein mentioned above is derived from soybean (Glycine max (L.) Merr.).

[0022] The present invention also provides biomaterials related to the above-mentioned proteins, said biomaterials may be any of the following: B1) nucleic acid molecules encoding the proteins described above;

[0023] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0024] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0025] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0026] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0027] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0028] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0029] C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the genes encoding the proteins described above;

[0030] C2) expresses the gene encoding the nucleic acid molecule described in C1);

[0031] C3) contains an expression cassette encoding the gene described in C2);

[0032] C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3);

[0033] C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);

[0034] C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);

[0035] C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);

[0036] C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0037] In the above-mentioned biological materials, the nucleic acid molecule described in B1) may be a gene as shown in E1) or E2) below:

[0038] E1) The coding sequence is a cDNA molecule or DNA molecule of SEQ ID No. 2 or SEQ ID No. 5;

[0039] E2) The nucleotide is a cDNA molecule or DNA molecule of SEQ ID No. 3 or SEQ ID No. 6.

[0040] The DNA molecule shown in SEQ ID No. 2 (the GmMBR2 gene that regulates plant architecture and yield traits) encodes the protein GmMBR2, whose amino acid sequence is the same as that in SEQ ID No. 1.

[0041] The DNA molecule shown in SEQ ID No. 5 (the GmMBR4 gene that regulates plant architecture and yield traits) encodes the protein GmMBR4, whose amino acid sequence is the same as that in SEQ ID No. 4.

[0042] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0043] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, it may be the vector cas9 / gRNA.

[0044] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0045] In one specific embodiment, the recombinant vector is GmMBRTWF–sgRNA.

[0046] The structure of the recombinant plasmid GmMBRTWF–sgRNA is described as follows: An expression cassette containing sgRNA1 and sgRNA2 (the nucleotide sequence of the expression cassette is SEQ ID No. 7 in the sequence listing) was inserted into the vector cas9 / gRNA, while keeping the other sequences of the cas9 / gRNA vector unchanged to obtain the recombinant vector GmMBRTWF–sgRNA. The target sequence of sgRNA1 is the DNA fragment at positions 810-829 of SEQ ID No. 3 (corresponding to the DNA fragment at positions 159-178 of SEQ ID No. 2), and the target sequence of sgRNA2 is the DNA fragment at positions 1799-1818 of SEQ ID No. 6 (corresponding to the DNA fragment at positions 258-277 of SEQ ID No. 5).

[0047] The microorganisms described in this article can be yeast, bacteria, algae, or fungi. Among them, bacteria can originate from genera such as *Escherichia*, *Erwinia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus*. Specifically, *Agrobacterium tumefaciens* EHA105 is an example.

[0048] In this invention, the recombinant microorganism may specifically be recombinant Agrobacterium EHA / GmMBRTWF–sgRNA.

[0049] The recombinant Agrobacterium EHA / GmMBRTWF–sgRNA is the recombinant bacterial EHA / GmMBRTWF–sgRNA obtained by transforming the recombinant vector GmMBRTWF–sgRNA into Agrobacterium EHA105.

[0050] The present invention also provides any of the following applications:

[0051] U1) The application of the proteins or gene expression substances or substances that regulate the activity or content of the proteins mentioned above in regulating plant architecture and yield.

[0052] U2) The application of the proteins or gene expression substances or substances that regulate the activity or content of the proteins mentioned above in the preparation of products that regulate plant architecture and yield.

[0053] U3) The application of the proteins or gene expression substances or substances that regulate the activity or content of the proteins mentioned above in the cultivation of plants with altered plant structure and yield.

[0054] U4) The application of the proteins or gene expression substances or substances that regulate the activity or content of the proteins mentioned above in the preparation of products that cultivate plants with altered plant structure and increased yield.

[0055] U5) The application of the proteins or gene expression substances or substances that regulate the activity or content of the proteins mentioned above in plant breeding.

[0056] In the above applications, the substance regulating gene expression or the substance regulating the activity or content of the protein is a biological material related to the protein, and the biological material may be any of the following:

[0057] C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the genes encoding the proteins described above;

[0058] C2) expresses the gene encoding the nucleic acid molecule described in C1);

[0059] C3) contains an expression cassette encoding the gene described in C2);

[0060] C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3);

[0061] C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);

[0062] C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);

[0063] C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);

[0064] C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0065] The present invention also provides a method for regulating plant architecture and / or yield, including regulating the activity and / or content of the proteins described above in the target plant, and / or regulating the expression level of the encoding genes of the proteins described above, to regulate plant architecture and / or yield.

[0066] The present invention also provides a breeding method for cultivating plants with altered plant type and / or yield, comprising regulating the activity and / or content of the proteins described above in the target plant, and / or regulating the expression level of the encoding genes of the proteins described above, to obtain plants with altered plant type and / or yield.

[0067] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein GmMBR2 or GmMBR4.

[0068] In the above text, the substance that regulates gene expression can be a substance that performs at least one of the following six types of regulation:

[0069] 1) Regulation occurring at the transcriptional level of the aforementioned gene;

[0070] 2) Regulation that occurs after the gene is transcribed (i.e., regulation of the splicing or processing of the primary transcript of the gene);

[0071] 3) Regulation of RNA transport of the gene (that is, regulation of the transport of mRNA of the gene from the nucleus to the cytoplasm);

[0072] 4) Regulation of the translation of the aforementioned genes;

[0073] 5) Regulation of mRNA degradation of the aforementioned gene;

[0074] 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0075] In the above method, regulating the activity and / or content of the proteins mentioned above in the target plant, or / and the expression level of the gene encoding the proteins mentioned above, includes introducing a recombinant expression vector containing a nucleic acid molecule that inhibits, reduces, or silences the expression of the gene encoding the proteins mentioned above into the recipient plant to obtain the target plant with altered plant type and / or yield; the gene encoding the protein GmMBR2 or GmMBR4 mentioned above.

[0076] The importation refers to the importation through recombination methods, including but not limited to Agrobacterium-mediated transformation, bio-projectile methods, electroporation, in-planta technology, and so on.

[0077] In the above applications and methods, the regulation can be to increase, enhance, or upregulate.

[0078] In the above applications and methods, the regulation can be suppression, reduction, or silencing.

[0079] In this article, regulating the expression of the gene encoding the protein can be achieved by inhibiting, reducing, or downregulating the expression of the gene. Inhibition, reduction, or downregulation of the gene expression can be achieved through gene knockout or gene silencing.

[0080] Gene knockout refers to the phenomenon of inactivating a specific target gene through gene editing technology. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0081] By using any vector that can guide the expression of exogenous genes in plants, the coding gene or gene fragment of the present invention for knocking out proteins GmMBR2 or GmMBR4 can be introduced into plant cells or recipient plants to obtain transgenic cell lines and transgenic plants with altered plant architecture and / or yield.

[0082] Expression vectors carrying the coding genes for the knockout proteins GmMBR2 or GmMBR4 can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.

[0083] In this invention, the plant type may include the number of branches, and / or the number of pods per plant, and / or the number of seeds per plant, and / or the plant height.

[0084] In this invention, the purpose of plant breeding may include cultivating plants with increased number of branches, and / or the number of pods per plant, and / or the number of seeds per plant, and / or increased yield.

[0085] In this article, the plant may be any of the following:

[0086] N1) Dicotyledons

[0087] N2) Leguminosae;

[0088] N3) Leguminosae (family legumes);

[0089] N4) Plants of the genus *Glycine*;

[0090] N5) soybeans.

[0091] This invention investigates the combined effects of proteins GmMBR2 and GmMBR4 on soybean plant architecture and yield. By simultaneously knocking out both GmMBR2 and GmMBR4 genes using CRISPR-Cas9 gene editing, the results showed that, compared to the wild-type control, mutants with GmMBR2 and GmMBR4 knockout exhibited significantly reduced plant height, significantly increased branching number, and significantly increased number of pods and seeds per plant. This provides important guidance for breeding high-yielding soybean varieties. Attached Figure Description

[0092] Figure 1 The mutation types of the GmMBR2 and GmMBR4 genes in the gmmbrtwf homozygous mutant are identified.

[0093] Figure 2 Comparison of plant architecture between gmmbrtwf homozygous mutant and wild-type soybean. Detailed Implementation

[0094] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0095] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0096] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0097] The cultivated soybean Jack in the following examples has been described in: Chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of soybean Agrobacterium-mediated transformation efficiency by adding glutamine and asparagine into the culture media. International Journal of Molecular Sciences 19, 3039. It is available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences. This biological material is only for repeating the experiments of this invention and should not be used for other purposes.

[0098] The Agrobacterium tumefaciens EHA105 used in the following examples is described in the following literature: Cai Y, Chen L, Liu X, Guo C, Sun S, Wu C, Jiang B, Han T and Hou W (2018a), CRISPR / Cas9-mediated targeted mutationnesis of GmFT2a delays flowering time in soya bean. Plant Biotechnol J16, 176-185, which is available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0099] The cas9 / gRNA vector used in the following examples was purchased from Beijing Weishang Lide Biotechnology Co., Ltd., catalog number: VK005-15.

[0100] MS Salt: PhytoTech, Catalog No.: M524.

[0101] MS Organic: PhytoTech, Catalog No.: M533.

[0102] B5 Organic: Phytotech, catalog number: G219.

[0103] B5 Salt: Phytotech, Catalog No.: G768.

[0104] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0105] Example 1: Construction of CRISPR vector for dual gene editing of GmMBR2 and GmMBR4

[0106] I. Obtaining sgRNA

[0107] The soybean GmMBR2 genome sequence was obtained from the Phytozome database. GmMBR2 is located on chromosome 4. The GmMBR2 gene in the genomic DNA of the soybean variety Jack is shown in SEQ ID No. 3 of the sequence listing, the coding sequence (CDS) of the GmMBR2 gene is shown in SEQ ID No. 2 of the sequence listing, and the protein GmMBR2 with the amino acid sequence shown in SEQ ID No. 1 of the sequence listing is encoded.

[0108] The soybean GmMBR4 genome sequence was obtained from the Phytozome database. GmMBR4 is located on chromosome 17. The GmMBR4 gene in the genomic DNA of the soybean variety Jack is shown in SEQ ID No. 6 of the sequence listing, the coding sequence (CDS) of the GmMBR4 gene is shown in SEQ ID No. 5 of the sequence listing, and the protein GmMBR4 whose amino acid sequence is shown in SEQ ID No. 4 of the sequence listing is also shown.

[0109] The online web tool CRISPR-P (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) was used to select the target site sequence for GmMBR2sgRNA.

[0110] Target 1 is located in the second exon region of GmMBR2, and the target sequence 1 of sgRNA1 is 5'-AGATTATTGTGTTTGGAGAG-3' (sequence 3, positions 810-829); Target 2 is located in the third exon region of GmMBR4, and the target sequence 2 of sgRNA2 is 5'-AATTGGGAAACTTCAGAGTT-3' (sequence 6, positions 1799-1818).

[0111] After the target sites are designed, they need to be integrated into the vector. First, target primers for sgRNA1 and sgRNA2 are synthesized. The primer sequence for synthesizing sgRNA1 is as follows:

[0112] GmMBR2-F:5'-TTG AGATTATTGTGTTTGGAGAG -3'

[0113] GmMBR2-R: 5'-AAC CTCTCCAAACACAATAATCT -3'

[0114] (The underlined sequence is a 20bp sgRNA)

[0115] Add 5 μL of GmMBR2-F and GmMBR2-R primers and 15 μL of water to a 25 μL system. Anneal at 95 °C for 3 min, then anneal at 0.1 °C / s to 16 °C and hold at 16 °C for 10 min to complete the annealing process, and obtain the annealed product of sgRNA1 with sticky ends.

[0116] The primer sequences for synthesizing sgRNA2 are as follows:

[0117] GmMBR4-F: 5'-TTGAATTGGGAAACTTCAGAGTT-3'

[0118] GmMBR4-R: 5'-AACAACTCTGAAGTTTCCCAATT-3'

[0119] (The underlined sequence is a 20bp sgRNA)

[0120] Add 5 μL of GmMBR4-F and GmMBR4-R primers and 15 μL of water to a 25 μL system. Anneal at 95 °C for 3 min, then anneal at 0.1 °C / s to 16 °C and hold at 16 °C for 10 min to complete the annealing process, and obtain the annealed product of sgRNA2 with sticky ends.

[0121] II. Preparation of recombinant vectors expressing sgRNA1 and sgRNA2

[0122] Take 1 μL of the annealed sgRNA1 product with sticky ends obtained in step one and perform homologous recombination ligation with the cas9 / gRNA vector (which contains the Cas9 protein expression unit) to obtain the recombinant vector Cas9-GmMBR2-sgRNA, which can express sgRNA1. The coding sequence of the target sequence binding region in sgRNA1 is positions 1775-1794 of SEQ ID No. 3 (i.e. positions 159-178 of SEQ ID No. 2).

[0123] Take 1 μL of the annealed sgRNA2 product with sticky ends obtained in step one and perform T4 ligation with the cas9 / gRNA vector (which contains Cas9 protein expression units) to obtain the recombinant vector Cas9-GmMBR4-sgRNA, which can express sgRNA2. The coding sequence of the target sequence binding region in sgRNA2 is positions 1799-1818 of SEQ ID No. 6 (i.e. positions 258-277 of SEQ ID No. 5).

[0124] The Cas9-GmMBR2-sgRNA plasmid was digested with Asc1 and Spe1, and a 570 bp fragment was recovered. The Cas9-GmMBR4-sgRNA plasmid was digested with Asc1 and Avr11, and a 14000 bp fragment was recovered. The two fragments were then ligated using T4 ligase to obtain the double knockout recombinant vector Cas9-GmMBRTWF-sgRNA.

[0125] Example 2: Obtaining and phenotypic identification of the gmmbr2 and gmmbr4 dual-gene mutant gmmbrtwf.

[0126] I. Preparation of Recombinant Bacteria

[0127] The double knockout target recombinant vector Cas9-GmMBRTWF-sgRNA prepared in Example 1 was transformed into E. coli DH5α and plated on LB+Kan solid medium. Single clones were picked, plasmids were extracted, and sent for sequencing.

[0128] Sequencing primer SQ: 5'-TGAAGTGGACGGAAGGAAGGAGG-3', the plasmid with the correctly inserted fragment was named recombinant plasmid GmMBRTWF-sgRNA.

[0129] The structure of the recombinant plasmid GmMBRTWF–sgRNA is described as follows: The vector cas9 / gRNA was inserted into an expression cassette containing sgRNA1 and sgRNA2 (the nucleotide sequence of the expression cassette is SEQ ID No. 7) through homologous recombination, while keeping the other sequences of the cas9 / gRNA vector unchanged, to obtain the recombinant vector GmMBRTWF–sgRNA.

[0130] The target sequence of sgRNA1 is the DNA fragment at positions 810-829 of SEQ ID No. 3 or the DNA fragment at positions 159-178 of SEQ ID No. 2, and the target sequence of sgRNA2 is the DNA fragment at positions 1799-1818 of SEQ ID No. 6 or the DNA fragment at positions 258-277 of SEQ ID No. 5.

[0131] The recombinant plasmid GmMBRTWF-sgRNA was transformed into Agrobacterium tumefaciens EHA105 by electroporation. The plasmid was extracted and sequenced for verification. The recombinant strain that was correctly sequenced was named EHA / GmMBRTWF–sgRNA.

[0132] II. Agrobacterium-mediated transformation

[0133] The preparation method for the culture medium used in Agrobacterium-mediated transformation is as follows:

[0134] YEP solid medium consists of a solvent and a solute; the solutes and their concentrations in YEP solid medium are as follows: NaCl 5 g / L, yeast extract 5 g / L, tryptone 10 g / L, and agar 15 g / L; the solvent is water. The pH of YEP solid medium is 7.0.

[0135] Germination medium (pH 5.8): 3.12 g / L B5 salt, 1 ml / L B5 organic, 20 g / L sucrose, 7.5 g / L agar, with the remainder being water.

[0136] Liquid culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 3.9 mg / L 2-morpholinoethanesulfonic acid, balance water.

[0137] Co-culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 7.5 g / L agar, 3.9 mg / L 2-morpholinoethanesulfonic acid, balance water.

[0138] Recovery medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 0.98 g / L 2-morpholinoethanesulfonic acid, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0139] Screening medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 0.98 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0140] Elongation medium (pH 5.6): 4.0 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 0.1 mg / L IAA, 0.5 mg / L GA, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0141] Rooting medium (pH 5.7): 2.165 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 20 g / L sucrose, 7.5 g / L agar, 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.

[0142] The constructed EHA / GmMBRTWF–sgRNA was transformed into the soybean variety Jack (hereinafter referred to as wild-type soybean) using Agrobacterium-mediated transformation. The specific method is as follows:

[0143] 1. Seed sterilization

[0144] 1) Take healthy, plump, uniform, and dry Jack soybean seeds that are free from pests, diseases, and spots, spread them evenly in a petri dish, and then place the petri dish in a desiccator.

[0145] 2) After completing step 1), place a 100ml beaker in the desiccator, pour 80ml of 12M sodium hypochlorite aqueous solution into the beaker, then slowly add 4ml of concentrated hydrochloric acid, and then quickly cover the desiccator, seal it with petroleum jelly, and place it for 16 hours for chlorine sterilization.

[0146] 2. Preparation of infecting bacterial solution

[0147] 1) Incubate the EHA / GmMBRTWF–sgRNA bacterial culture obtained above at 28℃, resuspend in liquid culture medium, and obtain OD. 600nm =0.6% of the infecting bacterial solution.

[0148] 2) Place the seeds treated in step 1 into a clean bench. Under a microscope, peel off the seed coat and separate the two cotyledons along the long axis, keeping the cotyledon with the intact hypocotyl. Make 3-5 cuts at the junction of the hypocotyl and cotyledon. Then, immerse the seeds in a 28°C incubator for 2 hours.

[0149] 3) Place the cotyledons with the inner (smooth) side up on a co-culture medium lined with sterile filter paper, and incubate in the dark at 22°C for 5 days.

[0150] 4) After 5 days of co-culture, the hypocotyl of the explants elongated to 2 cm. Part of the hypocotyl was cut off, leaving 0.5 cm. The treated explants were then placed in recovery medium and cultured at 28°C under 16 h light / 8 h dark conditions for 7 days.

[0151] 5) Remove the explants from the recovery medium, remove the new shoots, cut off part of the hypocotyl, leaving 0.5 cm of the hypocotyl, and then transfer the trimmed explants into the selection medium and culture them at 28℃ for 21 days under 16h light / 8h dark conditions.

[0152] 6) After 21 days of selection and induction, the explants produced a large number of adventitious buds. The cotyledons and brown leaves were removed, and the remaining parts were transferred to elongation medium for culture at 28°C under 16h light / 8h dark conditions.

[0153] 7) In the elongation medium, when the clustered buds produce 5-8cm young stems, cut them off from the base of the adventitious buds; dip the stem base in 1mg / LIBA solution for 1min, and then transfer it to the rooting medium for culture. Culture at 28℃ under 16h light / 8h dark conditions for one week. After a large number of roots are produced at the base of the stem, transplant them into pots. The resulting plants are T0 generation transformed soybeans.

[0154] III. Molecular Detection of Edited Plants

[0155] DNA was extracted from leaves of T0 generation transformed soybeans as a template for PCR molecular detection, with wild-type soybeans as a control.

[0156] PCR primers were designed near the target sites of the GmMBR2 and GmMBR4 genes for PCR amplification and sequencing. Primers MBR2-F (5′-GTGCCTGGAGAGGGATAGCA-3′) and MBR2-R (5′-CTGGAGAGCATTTTCCAGGAGT-3′) amplified the GmMBR2 gene. Primers MBR4-F (5′-GGTGACCGCAATGGAAGACA-3′) and MBR4-R (5′-TGTCGTGGTGAAGAAAAACGA-3′) amplified the GmMBR4 gene.

[0157] PCR reaction system: 12.5 μL 2×PhantaMax Buffer, 0.5 μL dNTP Mix (10 mM), 1 μL DNA (200 ng / μL), 1 μL F (10 pmol / μL), 1 μL R (10 pmol / μL), 0.5 μL Super-Fidelity DNA Polymerase, 8.5 μL ddH2O, total volume 25 μL. Amplification reaction system: 95℃ for 3 min; 95℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, 35 cycles; 72℃ for 5 min. PCR products were sent to the company for sequencing verification.

[0158] The plants exhibiting overlapping peaks near the target location were identified as heterozygous edited plants and named T0 generation transgenic GmMBRTWF soybeans.

[0159] After sowing T0 generation GmMBRTWF soybeans, seeds of T1 generation GmMBRTWF soybeans were harvested and cultivated to obtain T1 generation GmMBRTWF soybeans.

[0160] The T1 generation GmMBRTWF soybean was detected using the PCR molecular detection method described in step three above. Sequencing results showed that in the T1 generation GmMBRTWF soybean, the mutant plant (gmmbrtwf) exhibited the following mutations near the target site, causing premature termination of protein translation. The mutant plant showed one mutation type in the GmMBR2 gene: -5bp; and one mutation type in the GmMBR4 gene: -8bp. Figure 1 ).

[0161] The GmMBR2 gene mutation type -5bp in the T1 generation soybean gmmbrtwf homozygous mutant plants is: deletion of nucleotides 821-825 of SEQ ID No. 3, while keeping other nucleotides unchanged; the GmMBR4 gene mutation type -8bp in the gmmbrtwf homozygous mutant plants is: deletion of nucleotides 1808-1815 of SEQ ID No. 6, while keeping other nucleotides unchanged.

[0162] Compared to the wild type, the homozygous mutant gmmbrtwf exhibits a deletion of nucleotides 821-825 ("5'-TTTGG-3'") in the GmMBR2 gene of SEQ ID No. 3 (corresponding to a deletion of nucleotides 170-174 of SEQ ID No. 2). This deletion causes a frameshift, leading to premature termination of translation and loss of GmMBR2 protein function, thus knocking out the GMMBR2 gene. Sequencing results of this mutation site and its surrounding nucleotides are shown in [link to sequencing data]. Figure 1 For the GmMBR4 gene, the nucleotide "5'-ACTTCAGA-3'" is deleted at positions 1808-1815 of SEQ ID No. 6 (corresponding to the deletion of nucleotide "5'-ACTTCAGA-3'" at positions 267-274 of SEQ ID No. 5). This nucleotide insertion causes a frameshift, leading to premature termination of translation and loss of function of the GmMBR4 protein, thus knocking out the GmMBR4 gene. The sequencing results of this mutation site and its surrounding nucleotides are shown in [link to sequencing data]. Figure 1 .

[0163] The T1 generation of the above-mentioned gmmbrtwf homozygous soybean mutant was further cultured, and T2 generation gmmbrtwf homozygous soybean mutants without transgenic elements were screened and phenotypically identified.

[0164] IV. Mutant strain type identification

[0165] Planted under natural light conditions in a netted greenhouse in Beijing during summer, with a plant spacing of 10 cm and a row spacing of 50 cm. Plant morphological traits (plant height, number of nodes, number of branches, number of pods per plant, and number of seeds per plant) of wild-type control plants and gmmbrtwf homozygous mutants were statistically analyzed. At least six individual plant data points were collected for each material.

[0166] The results of the phenotypic study are shown in Table 1 and Figure 2Regarding plant type, compared with the control plant height of 148.3 cm, the average height of the gmmbrtwf mutant plant was 118.5 cm, which was significantly lower than that of the control. Regarding branching phenotype, the control plant had 1.5 branches, while the mutant plant had an average of 1.7 branches, with no significant difference between the mutant and control. Regarding the number of nodes, the control plant had 25.0 nodes, while the mutant plant had an average of 26.5 nodes, with no significant change between the mutant and control.

[0167] In terms of yield per plant, the control plants had an average of 106.5 pods and 257.8 seeds per plant, while the mutant plants had an average of 126.8 pods and 306.5 seeds per plant. The number of pods and seeds per mutant plant was increased compared to the wild type.

[0168] In summary, compared with the wild-type control, the mutant plants were significantly shorter, had a significantly increased number of branches, and significantly increased the number of pods and seeds per plant.

[0169] Table 1. Statistics on soybean plant type data

[0170]

[0171]

[0172] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of substances that simultaneously knock out or silence the genes encoding proteins GmMBR2 and GmMBR4 in any of the following: Application of U1 in regulating plant architecture; Application of U2 in the preparation of products that regulate plant architecture; U3) Application in plants for cultivating plant shape; U4) Application in the preparation of products that cultivate plants with altered plant structure; Application of U5 in plant breeding; The amino acid sequence of the protein GmMBR2 is SEQ ID No. 1; The amino acid sequence of the protein GmMBR4 is SEQ ID No. 4; The plant in question is soybean; The regulation of plant architecture involves reducing soybean plant height and increasing the number of branches, the number of pods per plant, and the number of grains per plant. The plant type change is characterized by a decrease in plant height and an increase in the number of branches, the number of pods per plant, and the number of grains per plant. The purpose of the breeding is to select soybean varieties with reduced plant height and increased number of branches, pods per plant, and grains per plant.

2. Use according to claim 1, characterized in that: The substance is any one of the following: C1) Simultaneously silence or knock out the nucleic acid molecules encoding the genes of the proteins GmMBR2 and GmMBR4 described in claim 1; C2) expresses the gene encoding the nucleic acid molecule described in C1); C3) contains an expression cassette containing the gene encoding described in C2); C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3); C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4).

3. A method for regulating plant architecture, characterized in that: The method includes simultaneously knocking out or silencing the genes encoding the proteins GmMBR2 and GmMBR4 described in claim 1 to regulate plant architecture; the plant is soybean. The plant architecture regulation aims to reduce soybean plant height and increase the number of branches, pods per plant, and grains per plant.

4. A breeding method for cultivating plants with altered plant architecture, comprising simultaneously knocking out or silencing the encoding genes of the proteins GmMBR2 and GmMBR4 described in claim 1 in a target plant to obtain a plant with altered plant architecture; wherein the plant is soybean; The plant type change is characterized by a decrease in plant height and an increase in the number of branches, the number of pods per plant, and the number of grains per plant.

5. The method according to claim 4, characterized in that: The simultaneous knockout or silencing of the encoding genes of the proteins GmMBR2 and GmMBR4 in the target plant according to claim 1 includes introducing a recombinant expression vector containing the encoding genes of the proteins GmMBR2 and GmMBR4 in claim 1 into the recipient plant to obtain the target plant with altered plant architecture; the encoding genes encode the proteins in claim 1.