Application of the cotton GhMYB transcription factor GhMYB4 gene in increasing cotton fiber length

By inhibiting the expression of the cotton GhMYB4 gene and utilizing its binding site with the GhLTP4 promoter to regulate auxin signaling and lipid content, the problem of unclear regulation of cotton fiber length was solved, resulting in a significant improvement in fiber quality and yield.

CN118703516BActive Publication Date: 2026-03-17NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410706711.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-03
Publication Date
2026-03-17
Estimated Expiration
2044-06-03

AI Technical Summary

Technical Problem

In existing technologies, the mechanism for regulating cotton fiber length is unclear, making it difficult to improve fiber quality and yield, and the function of the MYB transcription factor GhMYB4 is not fully utilized.

Method used

By inhibiting the expression of the GhMYB4 gene in cotton through virus-induced gene silencing (VIGS), and utilizing the MYB binding site on the GhMYB4 promoter, the expression of GhLTP4 is negatively regulated, affecting the auxin signaling pathway and lipid content, thereby regulating the elongation of fibroblasts.

Benefits of technology

It significantly improved cotton fiber length and yield, increased cotton boll size, and improved fiber quality, clarifying the negative regulatory role of GhMYB4 in fiber development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118703516B_ABST
    Figure CN118703516B_ABST
Patent Text Reader

Abstract

This invention discloses the application of the cotton GhMYB transcription factor GhMYB4 gene in increasing cotton fiber length. This invention utilizes biotechnology to clarify that the GhMYB4 gene has a negative regulatory effect on fiber cell elongation, and downregulation of GhMYB4 gene expression leads to a significant increase in fiber length. Studies have shown that auxin content and auxin response pathways were significantly altered in GhMYB4-silenced cotton lines and transgenic Arabidopsis. In cotton fibers from GhMYB4-silenced lines after 20 days of development, Cers content was significantly increased. GhMYB4 inhibits the expression of the lipid transporter gene GhLTP4 by binding to the MYB cis-element on the GhLTP4 promoter. GhMYB4 affects fiber cell development by regulating auxin content, auxin response pathways, and lipid content. Regulating fiber cell elongation by inhibiting GhMYB4 expression has high breeding application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology applications and relates to a cotton GhMYB transcription factor, GhMYB4 gene, and its application in increasing cotton fiber length. The full-length ORF of this gene is 681 bp, encoding 226 amino acids. RT-qPCR analysis revealed that this gene is predominantly expressed during the fiber elongation stage. In cotton, the GhMYB4 transcription factor negatively regulates fiber cell development by inhibiting the expression of its downstream genes. The function of this gene in cotton has not been reported in the literature. This invention shows that comparing the expression levels of the GhMYB4 gene in various tissues and organs reveals that its expression level is highest in elongating fiber cells. Inhibiting GhMYB4 gene expression in cotton leads to increased boll size and fiber length; while heterologous expression of GhMYB4 in Arabidopsis thaliana results in decreased plant height, root length, and hypocotyl length. Transcriptomic and lipidomic analyses, combined with EMSA, dual-luciferase reporter assays, LUC validation, and GUS staining, demonstrated that GhMYB4 regulates cotton fiber cell development by binding to the MYB cis-element (TTTAGTG) on the GhLTP4 promoter, thereby affecting the auxin signaling pathway and lipid content in cotton fibers. This invention utilizes biotechnology to clarify the negative regulatory effect of GhMYB4 on fiber cell elongation and proposes the breeding application value of regulating fiber cell elongation by inhibiting GhMYB4 expression. Background Technology

[0002] Plant growth and development depend on cell expansion, driven by internal tension within vacuoles. At the apex of elongated cotton fiber cells, there is no organelle differentiation, nor do secretory vesicles aggregate; microtubules and newly deposited cellulose microfilaments in the cytoplasm are transverse relative to the growth axis of the fiber cell. Furthermore, the cell apex has high calcium content. 2+ Concentration gradient, abundant vesicle distribution, and ROS bursts activate Ca2+. 2+Influx maintains rapid cell elongation, thus fiber cells are considered a combination of apical and diffuse growth, also known as linear cell growth. Upland cotton is an important cotton variety worldwide and a significant source of cotton fiber. Fiber length is a crucial indicator of fiber quality; the rate and duration of fiber cell elongation are critical to the length of mature fibers, significantly determining cotton fiber yield. Upland cotton fibers typically grow to approximately 3–4 cm in length. Cotton fibers develop from unicellular trichomes on the ovule epidermis. Fiber cells are among the longest single cells in plants and serve as an ideal model for studying cell elongation. Cotton fiber development is a complex process involving numerous regulatory pathways. The differentiation and development of cotton fibers can be divided into four overlapping phases: initiation, elongation, secondary cell wall biosynthesis, and maturation. Plant hormones are crucial for cotton fiber development, including gibberellins, indoleacetic acid, cytokinins, abscisic acid, ethylene, strigolactones, brassinolide, and jasmonic acid. Studies have reported that these hormones participate in regulating plant growth and development. In addition, fatty acids of different carbon chain lengths and different types of lipids also play key roles in cotton fiber development. Research reports indicate that very long-chain fatty acids activate downstream ethylene biosynthesis, promoting fiber cell elongation; linolenic acid activates phosphatidylinositol biosynthesis, also promoting fiber cell elongation; and ceramides play an important role in fiber cell development.

[0003] Currently, numerous reports have documented the role of MYB transcription factors in regulating plant growth and development. In Arabidopsis thaliana, the MYB transcription factor MYB30 regulates root cell elongation downstream of ROS signaling, and its expression is upregulated after ABA treatment. Furthermore, MYB30 and BES1 jointly promote hypocotyl elongation in Arabidopsis, and MYB30 also participates in the regulation of root growth and immune responses. AtMYB42 inhibits hypocotyl cell elongation through signal transduction and participates in coordinating BR homeostasis. Heterologous expression of GbMYB2 in Arabidopsis leads to thickening of leaf trichomes and elongation of roots. AtMYB59 participates in plant growth and stress responses by regulating calcium signaling. MYB-associated protein 1 (MRP-1) is a key regulator of maize cell differentiation. Auxin binds to maMYB and functions in root hair elongation in Arabidopsis. Compared to the wild type, silencing maMYB leads to significant root hair shortening, but no significant change in root hair density, indicating that maMYB plays a crucial role in root hair elongation. Exogenous application of root hair growth analogues can rescue the short root hair phenotype and induce the expression of maMYB.

[0004] Cotton is an allotetraploid containing over 200 MYB genes, many of which are predominantly expressed during fiber development. GhMYB transcription factors play a crucial role in regulating cotton fiber initiation and elongation. GhMYB25 regulates early fiber and trichome development; overexpressing GhMYB25 significantly increases the number of trichomes and fibers compared to their wild-type counterparts. Inhibiting GhMYB25 expression delays fiber initiation, leading to shorter cotton fibers and reduced yield. Heterologous expression of GbMYB2 in Arabidopsis increases leaf trichome and root length. Inhibiting GhMYB109 expression significantly reduces the number of fiber-initiating cells, indicating that GhMYB109 plays a key role in fiber initiation. Knockout of the R2R3 MYB transcription factor GhMYB25-like reduces the number of villous fibers on cotton seeds. The expression level of GhMYB25 in GhMYB25-like silent lines was almost zero, and the expression level of GhMYB109 was also significantly reduced in GhMYB25-like silent lines. Therefore, it is believed that GhMYB25-like may play an upstream role in other MYB transcription factors related to fiber development. Recent studies have shown that genetic variations in MYB5_A12 are associated with cotton fiber initiation. GhMML4_D12 interacts with the WD40 repeat protein GhWDR to regulate cotton fiber development, and GhMML4_D12 and GhMML3 jointly regulate the initiation of long and short fibers. In cotton, knockout of the HD-ZIP transcription factor GhHD-1 delays fiber initiation, while overexpression of GhHD-1 increases the number of fiber initiators. The expression level of GhHD-1 was significantly reduced in GhMYB25-like silent lines, indicating that GhHD-1 plays a downstream role in GhMYB25-like. GhSWEET12 regulates fiber development by transporting sucrose into fiber cells. Inhibition of GhSWEET12 expression leads to shorter fiber length, reduced lint percentage, and decreased soluble sugar content in the fiber. GhMYB212 binds to the promoter of GhSWEET12 and activates its expression. GhSWEET12 transports sucrose into fiber cells, where it is further converted into UDP-glucose or other types of sugars to regulate fiber development. In cotton, GhMYB7 is mainly expressed in developing fibers and regulates secondary cell wall biosynthesis in transgenic Arabidopsis. Further studies have found that overexpression or inhibition of GhMYB7 in cotton affects the rate of cellulose biosynthesis, leading to changes in fiber length and cell wall thickness. GhMYB7 binding to the promoters of GhCesA4-2, GhCesA7-3, and GhCesA8-2 regulates the expression of cellulose synthase genes, promoting cellulose deposition in the secondary cell wall of fibers.

[0005] Plant hormones play a crucial role in fiber elongation. Auxin (IAA), gibberellin (GA), brassinolide (BR), ethylene (Eth), and strigolactone (SL) promote fiber elongation, while cytokinin (CK) and abscisic acid (ABA) inhibit it. Supplementation with indole-3-acetic acid can compensate for deficiencies in fiber elongation. Furthermore, exogenous application of IAA significantly increased total fiber volume. Auxin efflux genes GhPIN1a_Dt, GhPIN6_At, and GhPIN8_At are predominantly expressed during fiber initiation and elongation. Leaf trichomes, which are organelles similar to fiber cells, showed increased density and length due to overexpression of these genes. These results indicate that GhPIN-mediated auxin transport plays a vital role in auxin-specific accumulation in cotton fibers. Gibberellin accumulation is also associated with cotton fiber elongation; gibberellin levels increase rapidly after flowering, peaking in fiber cells at 10 dpa, and then rapidly decline. The bioactive form of gibberellin, GA3, was found in significantly higher concentrations in long-staple cotton varieties than in short-staple cotton varieties. Furthermore, overexpression of the gibberellin oxidase GhGA20ox1 in cotton significantly increased gibberellin content, and GhGA20ox1-overexpressing lines produced more and longer fibers. The transcriptional level of the sucrose synthase gene GhSusA1 in GhGA20ox1-overexpressing transgenic fiber cells was significantly higher than that in the wild type. Moreover, gibberellin induced the expression of xyloglucan hydrolase (GhXTH) and dilatation protein (GhEXP) genes involved in cell elongation. The transcription factor GhHOX3 is a core regulator of the GA signaling pathway. Knockout of GhHOX3 significantly inhibited cotton fiber elongation, while overexpression of GhHOX3 significantly promoted fiber elongation. GhHOX3 regulates cell wall development and thus affects cotton fiber elongation by binding to the promoters of two cell wall localization genes, GhRDL1 and GhEXPA1. When GA levels are low, the DELLA protein GhSLR1 interacts with GhHOX3, preventing GhHOX3 from regulating its target genes. However, when GA levels are high, the GhSLR1 protein degrades and releases GhHOX3. Recent studies have found that auxin promotes fiber elongation in cotton by facilitating gibberellin biosynthesis. The auxin response factor GhARF18 directly binds to the AuxRE element on the promoters of the gibberellin oxidase genes GhGA3OX4D and GhGA20OX1D-2, and GhGA3OX4D and GhGA20OX1D-2 promote fiber elongation by increasing GA content. In cotton, the application of low concentrations of brassinolide significantly promotes fiber cell elongation, while the brassinolide biosynthesis inhibitor (BRZ) significantly inhibits fiber cell development in vitro. BR regulates cotton fiber elongation by modulating the biosynthesis of very long-chain fatty acids (VLCFAs).When BR is absent, the expression of GhKCSs, a key rate-limiting enzyme in very long-chain fatty acids, is significantly downregulated, and the content of VLCFAs is significantly reduced, thereby inhibiting fiber elongation. BR acts upstream of VLCFAs; GhBES1.4 directly binds to the BRRE element in the GhKCS10_At promoter region to activate its expression, promoting VLCFA accumulation and ultimately promoting fiber elongation. Ethylene plays a crucial role in plant growth and development, including regulating root hair development and hypocotyl growth. Ethylene biosynthesis involves two steps: S-adenosylmethionine is catalyzed by ACC synthase (ACS) to 1-aminocyclopropane-1-carboxylic acid (ACC), and ACC is further catalyzed by ACC oxidase (ACO) to ethylene. In cotton, in vitro application of ethylene significantly promotes fiber cell elongation, while application of ethylene synthesis inhibitors (AVG) inhibits fiber cell elongation. The ethylene biosynthesis pathway is one of the most important biochemical pathways in the fiber elongation stage. GhACO1-3 is highly expressed during fiber elongation, which coincides with the peak ethylene content in elongating fiber cells. Ethylene may also promote fiber elongation by promoting the production of hydrogen peroxide (H2O2). VLCFAs promote ethylene biosynthesis and regulate cotton fiber elongation. Ethylene can effectively eliminate the inhibitory effect of VLCFA biosynthesis inhibitors (ACE) on fiber cell elongation, while VLCFAs cannot eliminate the inhibitory effect of ethylene biosynthesis inhibitors (AVG) on fiber cell elongation. In vitro application of C24:0 fatty acids significantly increased the expression level of ACO and promoted ethylene accumulation. Stigrolium lactones (SL), originally isolated from cotton root exudates, are a class of carotenoid-derived plant hormones. SL can regulate the growth of root hairs and lateral roots in Arabidopsis thaliana. In cotton, SL acts downstream of gibberellins to regulate cotton fiber cell elongation. SL induces the expression of GhNAC100-2, GhBLH51, GhGT2, and GhB9SHZ1, directly activating the transcription of these genes to transmit SL signals to two ketoacyl-CoA synthase genes (KCSs). KCSs further catalyze the biosynthesis of VLCFAs to regulate cotton fiber elongation. Cytokinins regulate many aspects of plant development, such as cell division, senescence of plant tissues and organs, and apical dominance. Endogenous cytokinins accumulate primarily in ovules, not in fiber cells. Cytokinin concentrations are relatively low in unpollinated ovules, but increase steadily after flowering. Studies have shown that cytokinins play a crucial role in ovule development; exogenous addition of cytokinins to the ovule culture medium significantly promotes ovule growth but inhibits fiber cell elongation. Cytokinin oxidase (CKX) can cause cytokinin inactivation and is an important negative regulator of cytokinin metabolism.Inhibiting CKX expression increases the level of endogenous cytokinin in plants, and knocking out GhCKX using RNAi interference technology significantly increases seed number. In vitro application of ABA inhibits fiber cell elongation, and this inhibitory effect is positively correlated with ABA concentration. ABA accumulation gradually increases during the fiber cell initiation and elongation stages (0-10 dPa), gradually decreases during the rapid fiber elongation stage (10-20 dPa), and finally returns to its original low level during the maturation stage (30-50 dPa). In fibers developing for 16 dPa, ABA accumulation undergoes a transition, consistent with the formation of secondary cell walls, indicating that ABA may be involved in the biosynthesis of secondary cell walls. The ABA content in short fibers is significantly higher than in long fibers. Moreover, the endogenous ABA level in cotton ovules is positively correlated with the yield of short fibers. These results suggest that ABA may be a negative regulator of cotton fiber initiation, but the specific regulatory mechanism needs further confirmation through investigation of transgenic cotton overexpressing ABA synthesis genes or the fiber length of cotton ovules with high ABA content.

[0006] During fiber elongation, the continuous synthesis and transport of lipids and proteins are crucial for supporting the expansion of vacuoles and plasma membranes. Studies have shown that fatty acids and cellulose are deposited alternately in concentric cell wall layers, and developing fibroblasts can incorporate various polar lipids into their cell walls from 3 to 20 days. Lipid profiling analysis of elongated fibroblasts revealed that total fatty acid content was highest during the elongation phase and gradually decreased with the thickening of the secondary cell wall. Furthermore, phospholipid content continuously increased during fiber elongation, reaching its peak from 5–14 dPa during fiber development, and then gradually decreased, indicating that phospholipids are essential for fibroblast expansion. Very long-chain fatty acids (VLCFAs) promote sphingolipid biosynthesis by upregulating serine palmitoyltransferase; the addition of VLCFAs to ovule culture media significantly increased fibroblast elongation. In plants, long-chain fatty acids, as components of membrane lipids, bind to glycerides in plastids through different metabolic pathways. VLCFAs may be converted into phospholipids or sphingolipids, serving as precursors of cellular components or regulating the expression of target genes. Sphingolipids play a positive role in regulating cotton fiber elongation, with ceramides (Cers) being the most abundant. Exogenous application of Cers promoted cotton fiber elongation in ovule in vitro culture experiments. Targeted lipidomics studies have shown that linolenic acid promotes cotton fiber elongation by activating the biosynthesis of phosphatidylinositol and phosphatidylinositol monophosphate. Plant hormones can regulate lipid accumulation and play a role in plant growth, development, and metabolism. Recent studies have shown that bromelains (BRs) and sphingolipids (SLs) positively regulate cotton fiber elongation by modulating the biosynthesis of VLCFAs.

[0007] In this invention, we discovered a MYB binding site (MBS) on the GhLTP4 promoter. GhMYB4 binds to the MBS element on the GhLTP4 promoter, negatively regulating GhLTP4 expression in cotton. GhLTP4 promotes fiber cell elongation by transporting ceramides, activating the auxin signaling pathway, and regulating auxin levels. The expression level of GhLTP4 in fibers at different developmental stages of GhMYB4-silenced plants was significantly increased compared to control plants. Ceramide and auxin levels were significantly increased in GhMYB4-silenced plants. GhMYB4 negatively regulates plant cell elongation; compared to control plants, silencing GhMYB4 resulted in larger bolls and longer fibers. Therefore, GhMYB4, as a transcription factor negatively regulating fiber elongation, plays a role in fiber cell elongation by regulating GhLTP4 expression. Summary of the Invention

[0008] The purpose of this invention is to provide a cotton GhMYB transcription factor (GhMYB4) and its application in regulating cotton fiber length and cultivating new germplasm for improved cotton fiber length. The full-length ORF nucleotide sequence of this gene and the amino acid sequence of the encoded protein in upland cotton TM-1 are provided. Using this gene as a target gene, GhMYB4 expression was inhibited through virus-induced gene silencing (VIGS) to clarify its role in cotton fiber development and to cultivate new germplasm for production applications.

[0009] Another object of the present invention is to provide a method for improving the quality of cotton fibers (mainly cotton fiber length).

[0010] The objective of this invention is achieved through the following technical solution:

[0011] In a first aspect, the present invention seeks protection for the use of the cotton GhMYB transcription factor GhMYB4 gene as shown in SEQ ID NO.1 or related biological materials in the following (a1) or (a2):

[0012] (a1) Increase cotton fiber length;

[0013] (a2) Develop new germplasm for improving cotton fiber length.

[0014] Furthermore, the biological material related to the cotton GhMYB transcription factor GhMYB4 gene is as follows (b1) or (b2):

[0015] (b1) The protein GhMYB4 encoded by the cotton GhMYB transcription factor GhMYB4 gene;

[0016] (b2) Biological materials for silencing, interfering with or inhibiting the expression of the cotton GhMYB transcription factor GhMYB4 gene.

[0017] Furthermore, the amino acid sequence of the protein GhMYB4 described in (b1) is shown in SEQ ID NO.2.

[0018] Furthermore, the biological material described in (b2) for silencing, interfering with, or inhibiting the cotton GhMYB transcription factor GhMYB4 gene is at least one of the following (c1) to (c4):

[0019] (c1) The interference or silence fragment of the cotton GhMYB transcription factor GhMYB4 gene;

[0020] (c2) Primers used to amplify the interference or silence fragment of the GhMYB transcription factor GhMYB4 gene described in (c1);

[0021] (c3) The interference expression vector or silencing vector of the cotton GhMYB transcription factor GhMYB4 gene;

[0022] (c4) Recombinant microorganisms containing the interference expression vector or silencing vector as described in (c3).

[0023] Furthermore, the above application is to increase cotton fiber length by inhibiting the expression level of the cotton MYB transcription factor GhMYB4 gene or reducing the level (activity or content) of the GhMYB4 gene-encoded protein GhMYB4.

[0024] Furthermore, the process of inhibiting the expression of the cotton GhMYB transcription factor GhMYB4 gene is as follows: constructing an interference expression vector or silencing vector for the cotton GhMYB transcription factor GhMYB4 gene, and transforming cotton with the constructed interference expression vector or silencing vector through Agrobacterium-mediated transformation to obtain cotton material with significantly reduced GhMYB4 gene expression.

[0025] Secondly, the present invention claims protection for a method for increasing cotton fiber length by inhibiting the expression level of the cotton MYB transcription factor GhMYB4 gene or reducing the level (activity or content) of the protein GhMYB4 encoded by the cotton MYB transcription factor GhMYB4 gene.

[0026] Thirdly, the present invention seeks protection for a cotton GhMYB transcription factor GhMYB4 gene having the nucleotide sequence shown in SEQ ID NO.1.

[0027] Fourthly, the present invention seeks protection for a protein encoded by the aforementioned GhMYB4 gene, the protein having the amino acid sequence shown in SEQ ID NO.2.

[0028] Fifthly, this invention seeks protection for biological materials related to the aforementioned cotton MYB transcription factor GhMYB4 gene, which are recombinant vectors, expression cassettes, transgenic cell lines, or recombinant bacteria containing the aforementioned GhMYB4 gene, or biological materials used to silence, interfere with, or inhibit the cotton MYB transcription factor GhMYB4 gene. In specific embodiments of this invention, a CLCrV vector, expression cassette, and recombinant bacteria containing a specific fragment of the aforementioned cotton MYB transcription factor GhMYB4 were constructed.

[0029] This invention clones a cotton GhMYB transcription factor GhMYB4 gene, the ORF sequence of which is shown in SEQ ID NO. 1. The protein encoded by this gene has the amino acid sequence shown in SEQ ID NO. 2. Studies have found that inhibiting the expression of the GhMYB4 gene can significantly increase cotton fiber length. The interference or silencing expression vector of the target gene is introduced into existing commercially available varieties to improve the cotton fiber quality. In a specific embodiment of this invention, using the cotton MYB transcription factor GhMYB4 gene as the target gene, the expression of the GhMYB4 gene is inhibited by viral-induced gene silencing (VIGS) or gene interference methods, resulting in the cultivation of new cotton germplasm with significantly improved fiber length for production application.

[0030] The advantages of this invention are as follows:

[0031] (1) The gene cloned in this invention is a MYB transcription factor, GhMYB4. Previous studies have shown that MYB plays an important role in regulating cotton fiber cell development. However, the function of this gene in cotton fiber development is unknown. This invention discovered a single nucleotide polymorphism (SNP) site in the promoter region of GhMYB4, which divided 242 natural upland cotton populations into two haplotypes (Hap.1 and Hap.2), significantly correlated with four fiber quality and yield traits. The fiber length, fiber strength, fiber uniformity, and boll weight of the Hap.1 genotype (229 materials) were significantly lower than those of the Hap.2 genotype (13 materials), indicating that GhMYB4 plays an important role in cotton fiber cell development. Clarifying its molecular mechanism of action in regulating fiber development has important theoretical significance and application value for improving cotton fiber quality.

[0032] (2) The GhMYB4 gene cloned in this invention has not been studied in cotton before. The GhMYB4 gene in cotton was identified for the first time and its expression pattern and function were systematically analyzed, clarifying the important role of GhMYB4 in cotton fiber quality.

[0033] (3) Real-time quantitative PCR results showed that the gene was predominantly expressed during the fiber elongation period of the upland cotton genetic standard line TM-1. The expression level of the gene varied in different tissues and organs and in cotton fibers at different developmental stages. The expression level was low in roots, stems, leaves and ovules, and increased during the rapid fiber elongation period (5-23 days after flowering). This result indicates that the gene is closely related to the fiber development and elongation process.

[0034] (4) Virus-induced gene silencing (VIGS) was used to suppress the expression of this gene, and the upland cotton genetic standard line (G. hirsutum acc.TM-1) was used as the recipient for phenotypic studies. RT-qPCR analysis showed that the expression level of GhMYB4 in cotton fibers at different developmental stages was significantly reduced in GhMYB4-silenced plants compared with control plants. The length of cotton fibers at different developmental stages was measured by the water flow method, and the results showed that the length of cotton fibers in GhMYB4-silenced plants at different developmental stages was significantly increased compared with control plants. Further observation of boll size at different developmental stages revealed that the bolls of GhMYB4-silenced plants were larger than those of control plants. Yield analysis showed that compared with control plants, plants with suppressed GhMYB4 expression had significantly increased lint percentage, lint index, and boll weight. This indicates that the expression level of this gene affects the quality and yield traits of cotton fibers.

[0035] (5) Systematic molecular biology experiments confirmed that GhMYB4 inhibits the expression of GhLTP4 by binding to the MYB cis-element (TTTAGTG) on the promoter of the lipid transporter gene GhLTP4. GhMYB4 further affects the auxin signaling pathway and lipid content, thereby regulating cotton fiber cell development. Attached Figure Description

[0036] Figure 1 GhMYB4 is significantly correlated with fiber quality.

[0037] A. SNPs in the GhMYB4 promoter region classified 242 natural upland cotton accessions into two haplotypes. * and ** indicate significant differences between the two haplotypes in fiber length, fiber strength, fiber uniformity, and boll weight (0.05 and 0.01, respectively). B. Expression patterns of GhMYB4 in different tissues and developing fibers of TM-1. Data were collected from three biological replicates, with three technical replicates for each reaction. Error bars represent the standard deviation (SD) between biological replicates. C. Nuclear localization of GhMYB4 in tobacco leaf epidermal cells. Tobacco epidermal cells were transiently transformed using vectors containing an empty plasmid (35S::eGFP) or a fusion plasmid (35S::GhMYB4-eGFP). AtHTB2 was used as the nuclear marker. Scale bar = 20 μm.

[0038] Figure 2 Expression level and phenotypic analysis of GhMYB4 silenced plants

[0039] A. Relative expression levels of GhMYB4 in fibers at different developmental stages in three independent GhMYB4-silenced plants and control plants. Data were collected from three biological replicates, with three technical replicates for each reaction. B. Fiber phenotypic analysis (B) and fiber length measurements (C) at different developmental stages in three independent GhMYB4-silenced plants and control plants. Scale bar = 1 cm. Data were collected from three biological replicates. D. Scanning electron micrographs of ovules at 0 dpa and 2 dpa in three independent GhMYB4-silenced plants and control plants. E. Fiber length measurements of ovules at 2 dpa in three independent GhMYB4-silenced plants and control plants. Scanning electron micrographs were taken at the same location in the middle of the ovule. Scale bar = 50 μm, with at least three ovules observed. Data were collected from 24 biological replicates. Error bars represent the standard deviation (SD) between biological replicates. * and ** indicate significant differences of 0.05 and 0.01, respectively, by t-test.

[0040] Figure 3 Yield traits of GhMYB4 silent plants and control plants

[0041] A. Boll phenotypes at different developmental stages in GhMYB4 silent plants and control plants. Scale bar = 3 cm. B. Comparison of yield traits between GhMYB4 silent plants and control plants. Data were collected from three biological replicates. Error bars represent the standard deviation (SD) between biological replicates. * and ** indicate significant differences of 0.05 and 0.01, respectively, using t-tests.

[0042] Figure 4 Identification and phenotypic analysis of heterologous expression of GhMYB4 in Arabidopsis thaliana

[0043] A. DNA identification of Arabidopsis thaliana lines overexpressing GhMYB4. B. Expression levels of GhMYB4 in GhMYB4 transgenic lines and WT. Data were collected from three biological replicates, with three technical replicates for each reaction. C. Phenotypic analysis of taproot length in WT and GhMYB4 overexpressing lines after 7 days of growth under long-day conditions. Scale bar = 1 cm. D. Measurement of taproot length in WT and GhMYB4 overexpressing lines after 7 days of growth under long-day conditions. Data were collected from 6 biological replicates. E. Phenotypic analysis of hypocotyl length in WT and GhMYB4 overexpressing lines after 7 days of growth under dark conditions. Scale bar = 1 cm. F. Measurement of hypocotyl length in WT and GhMYB4 overexpressing lines after 7 days of growth under dark conditions. Data were collected from 20 biological replicates. G. Phenotypic analysis of primary root trichome length in WT and GhMYB4 overexpressing lines after 8 days of growth under long-day conditions. Scale bar = 1 mm. The length of primary root trichomes of H.WT and GhMYB4 overexpressing lines was measured after 8 days of growth under long-day conditions. Data were collected from 15 biological replicates. Error bars represent the standard deviation (SD) between biological replicates. * and ** indicate significant differences of 0.05 and 0.01, respectively, using t-tests.

[0044] Figure 5 Analysis of plant height and pod phenotype in Arabidopsis thaliana overexpressing GhMYB4

[0045] Phenotypic and measurement analysis of plant height in AB.GhMYB4 transgenic lines and WT. Data were collected from 6 biological replicates. Scale bar = 5 cm. Statistical analysis of pod phenotype and length in CD.GhMYB4 transgenic lines and WT. Scale bar = 1 cm, data were collected from 10 biological replicates. Analysis of the number of seeds per pod per plant in E.GhMYB4 transgenic lines and WT, data were collected from 10 biological replicates. * and ** indicate significant differences of 0.05 and 0.01, respectively, using t-tests.

[0046] Figure 6 Transcriptome analysis of cotton fibers from GhMYB4-silenced plants

[0047] A. RNA-seq analysis using fibers developed for 20 days revealed differentially expressed genes (DEGs) between GhMYB4-silenced plants and control plants, with a q-value of 0.05 and a fold change > 1. B. GO analysis showed that, compared to control plants, the upregulated differentially expressed genes in GhMYB4-silenced plants were significantly enriched in auxin metabolism and signaling pathways.

[0048] Figure 7 Transcription levels of auxin-responsive genes in fibers of GhMYB4-silenced plants and control plants

[0049] Data were collected from three biological replicates, with three technical replicates for each reaction. Error bars represent the standard deviation (SD) between biological replicates. * and ** indicate significant differences of 0.05 and 0.01, respectively, using t-tests.

[0050] Figure 8 Analysis of auxin content in GhMYB4 silenced plants and control plants

[0051] A. Transient transformation of proDR5::GUS in fibers of GhMYB4-silenced and control plants. Scale bar = 1 cm. B. IAA content in fibers developed from GhMYB4-silenced and control plants after 20 dpa. Data collected from 3 biological replicates. C. Phenotypic analysis of ovules developed from GhMYB4-silenced and control plants after 3 weeks of culture in BT medium supplemented with different concentrations of IAA and NPA. Scale bar = 1 cm. D. Determination of fiber length in in vitro cultured ovules. Data collected from 5 biological replicates. Error bars represent the standard deviation (SD) between biological replicates. * and ** indicate significant differences of 0.05 and 0.01, respectively, using t-tests.

[0052] Figure 9 Transcriptome analysis of Arabidopsis thaliana overexpressing GhMYB4

[0053] A. RNA-seq analysis of GhMYB4-overexpressing Arabidopsis thaliana and WT revealed differentially expressed genes (DEGs) between the GhMYB4-overexpressing lines and WT, with a q-value of 0.05 and a fold change > 2. B. GO analysis showed that, compared to WT, downregulated genes in GhMYB4-overexpressing Arabidopsis thaliana were significantly enriched in auxin metabolism and signaling pathways. C. Expression levels of auxin-responsive genes AtPIN, AtARFs, and AtSAURs in GhMYB4-overexpressing Arabidopsis thaliana and WT. Data were collected from three biological replicates, with three technical replicates for each reaction. D. Determination of IAA content in leaves of GhMYB4-overexpressing Arabidopsis thaliana and WT. Data were collected from three biological replicates. Error bars represent the standard deviation (SD) between biological replicates. * and ** indicate significant differences of 0.05 and 0.01, respectively, using t-tests.

[0054] Figure 10 GhMYB4 inhibits GhLTP4 expression by binding to the GhLTP4 promoter.

[0055] A. EMSA verification of promoter binding of GhMYB4 to GhLTP4. B. Expression levels of GhLTP4 in fibers at different developmental stages in GhMYB4-silenced plants and control plants. C. Dual-LUC reporter system showed that GhMYB4 negatively regulates GhLTP4 expression, and GhbHLH105 inhibits the negative regulatory effect of GhMYB4 on GhLTP4. Data were collected from three biological replicates, with three technical replicates for each reaction. Error bars represent the standard deviation (SD) between biological replicates. * and ** indicate significant differences of 0.05 and 0.01, respectively, using t-tests. D. LUC experiments showed that GhMYB4 negatively regulates GhLTP4 expression, and GhbHLH105 inhibits the negative regulatory effect of GhMYB4 on GhLTP4.

[0056] Figure 11 Combining MBS elements on GhMYB4 and GhLTP4 promoters

[0057] A. The LUC reporting system shows that GhMYB4 binds to the MBS element on the GhLTP4 promoter. B. GUS experiments show that GhMYB4 binds to the MBS element on the GhLTP4 promoter.

[0058] Figure 12 Lipidomics analysis of 20 dpa fiber development in GhMYB4-silenced plants and control plants

[0059] A. Differential lipids between GhMYB4-silenced plants and control plants. VIP>1, p-value<0.05, fold change>1. B. Heatmap shows 33 differentially expressed lipid classes between GhMYB4-silenced plants and control plants. C. Among all differentially expressed lipids, Cers was the most significantly increased lipid in GhMYB4-silenced plants. D. Functional enrichment analysis of differentially expressed lipids showed significant enrichment in the Cers biosynthetic pathway.

[0060] Figure 13 Expression levels of genes related to the synthesis of very long chain fatty acids (VLCFAs) and ceramides (Cers)

[0061] Expression levels of VLCFAs and Cers biosynthesis-related genes in fibers developed by GhMYB4-silenced plants and control plants over 20 dpa. Data were collected from three biological replicates, with three technical replicates for each reaction. Error bars represent the standard deviation (SD) between biological replicates. * and ** indicate significant differences of 0.05 and 0.01, respectively, using t-tests.

[0062] Figure 14 Phenotypic and expression analysis of ovules cultured in BT medium supplemented with Cer.

[0063] A. Phenotypic analysis of ovules cultured for 2 days in BT medium supplemented with Cerebrolysin from silencing GhMYB4 plants and control plants. Scale bar = 1 cm. B. Measurement of ovule fiber length in BT medium supplemented with Cerebrolysin. Data collected from 6 biological replicates. C. Expression levels of auxin-responsive genes in fibers cultured in BT medium. Data collected from three biological replicates, with two technical replicates for each reaction. Error bars represent the standard deviation (SD) between biological replicates. * and ** indicate significant differences of 0.05 and 0.01, respectively, by t-test. Detailed Implementation

[0064] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this invention should be included within the scope of protection of this invention.

[0065] Example 1: Planting and Growth Conditions of Plant Materials

[0066] The upland cotton genetic standard line *G. hirsutum* acc.TM-1 was cultivated in the experimental field of Nanjing Agricultural University for the collection of various tissues and organs, as well as cotton fibers at different developmental stages. Cotton used in virus-induced gene silencing (VIGS) experiments was grown in a greenhouse (16h:8h, light:dark, 24℃:20℃), with fibers and ovules from the same location collected at each developmental stage. The cotton was tagged on the day of flowering, and ovules or fibers were harvested at specific developmental stages, immediately frozen in liquid nitrogen, and stored at -70℃. Each treatment was replicated at least three times.

[0067] Example 2: GhMYB4 is significantly correlated with fiber quality

[0068] Association analysis of cotton fiber quality in 242 upland cotton accessions revealed a SNP site on the promoter of GhMYB4 that divided the accessions into two haplotypes. The Hap.1 genotype (229 accessions) showed significantly lower fiber length, strength, uniformity, and boll weight than the Hap.2 genotype (13 accessions). This indicates that GhMYB4 is significantly associated with fiber quality and may play a negative regulatory role in cotton fiber development (e.g., Figure 1 (As shown in A).

[0069] Example 3: RT-qPCR analysis of cotton MYB transcription factor GhMYB4

[0070] Design specific primers for GhMYB4:

[0071] F:5'-TGAGCAGAGGTATTGACCCT-3'

[0072] R:5'-AAGTGCACTCCTTGCTGTTT-3'

[0073] Quantitative RT-qPCR was performed on different tissues and organs of the upland cotton genetic standard line TM-1. The results showed that the gene expression level was low in roots, stems, and leaves, and differentially expressed at different stages of fiber development. Specifically, expression gradually increased during the rapid fiber elongation period (days 5-23) and then gradually decreased thereafter (e.g., ...). Figure 1 (as shown in B).

[0074] Example 4: Subcellular localization of GhMYB4

[0075] After removing the stop codon from the ORF of the target gene GhMYB4, recombinant primers were designed in CE Design V1.03 software (see Table 1). PCR amplification was performed using cDNA from the upland cotton genetic standard line TM-1 as a template. After the amplification reaction, 2 μL of 10× Loading buffer was added, and agarose gel electrophoresis was performed. The target band was then excised and recovered from the gel; specific steps are detailed in the gel recovery kit instructions. The pBINGFP4 vector plasmid was digested with enzymes, and then incubated with the target fragment at 37°C for 30 min in a PCR instrument for recombination. Immediately after 30 min, the plasmid was removed and placed on ice. The recombinant product was transformed into competent E. coli cells, plated, and incubated upside down at 37°C for 12 h. Single colonies were picked from the plates and placed in liquid LB medium containing 700 μL of the corresponding antibiotic, and incubated at 37°C with a shaker at 200 rpm for 5–6 h. Using bacterial culture as a template, PCR amplification was performed using universal primers on the vector. After gel running, the positive bacterial cultures were sequenced. Plasmids were extracted from bacterial cultures with correct sequencing sequences and transformed into commercially available Agrobacterium GV3101 (Qingke Biotechnology, Nanjing). The mixed bacterial culture was injected into the back of tobacco leaves. After dark incubation for 12-16 hours, the tobacco was cultured normally for 2-3 days. The localization of the target protein was observed using a laser confocal microscope (Zeiss, LSM780, Germany). Subcellular localization showed that the green fluorescence signal of GhMYB4-GFP protein was consistent with the red fluorescence signal of AtHTB2, a nuclear localization marker, indicating that GhMYB4 is a nuclear localization protein (e.g., AtHTB2). Figure 1 (as shown in C).

[0076] Table 1: Primers used for amplification

[0077]

[0078] Example 5: Construction of cotton pCLCrV-GhMYB4 vector

[0079] CLCrV is a publicly available cotton leaf-wrinkling geminitroviral vector. pCLCrV-B is used as an auxiliary vector. A specific target fragment (366 bp) of the GhMYB4 gene was cloned into the pCLCrV-A vector, with Spe I and AscI restriction enzyme sites. Homologous recombination primers were designed using CE Design software (see Table 2). PCR amplification was performed using cDNA from the upland cotton genetic standard line TM-1 as a template. After amplification, 2 μL of 10× Loading buffer was added, followed by agarose gel electrophoresis. The target band was then excised and recovered from the gel; specific steps are described in the gel recovery kit instructions. The pCLCrV-A vector plasmid was digested with enzymes, and then incubated with the target fragment at 37°C for 30 min in a PCR instrument for recombination. Immediately after 30 min, the product was placed on ice, transformed into competent E. coli cells, plated, and incubated upside down at 37°C for 12 h. Pick single colonies from the plate and place them in 700 μL of liquid LB medium containing the corresponding antibiotic. Incubate at 37°C and 200 rpm for 5-6 hours. Using the bacterial culture as a template, perform PCR amplification with universal primers on the vector. After gel running, sequence the positive bacterial cultures. Extract plasmids from bacterial cultures with correct sequencing sequences and store at -20°C.

[0080] Table 2: Primers used for amplification

[0081]

[0082] Target fragment (366bp) sequence:

[0083] AATCATTGGAATACCCACATAAAGAGGAAGCTACTGAGCAGAGGTATTGACCCTTT

[0084] GACACATCGACCGGTCAATGAACAAGCTGCAATTCACACCATAGATACAGTCTCAT

[0085] CAACAGCAGTTCTAAGAGAAGATGAGAGACAAACGAACCAAGAATTGAATCTTGAG

[0086] CTGCAGATAAGTCCACCATCGTTACATTCACACCCACCGCAGGTATTGCGGAAAAG

[0087] AAACAGAAAAGTCATTTGCTTCTACTGTAGCTTGGGGCTTCGAAACAGCAAGGAGT

[0088] GCACTTGTGAGGGTAGTAGTCATAGTAGAAGTATACAACATGTGAGCTTTTGCACTTGGCGAAAGGCGTTTCAAAGTGAGAATTGA(SEQ ID NO.3)

[0089] Example 6 Virus-mediated transient gene silencing (VIGS) experiment

[0090] CLCrV is a cotton leaf-wrinkling beta virus vector. pCLCrV-B is an auxiliary vector. The magnesium chelate subunit I (ChlI) gene is essential for chlorophyll production, and pCLCrV-ChlI serves as a positive control. All the vectors mentioned above are publicly available vectors (Gu Z, Huang C, Li F, Zhou XA versatile system for functional analysis of genes and microRNAs in cotton. Plant Biotechnol J. 2014:12(5):638–649).

[0091] (https: / / doi.org / 10.1111 / pbi.12169). The constructed pCLCrV-GhMYB4 and pCLCrV-ChlI vectors were transformed into Agrobacterium tumefaciens LBA4404. The bacterial culture was cultured in 50 mL of liquid LB medium containing kanamycin and rifampin antibiotics, and incubated overnight at 28°C and 200 rpm for 12 h until OD was reached. 600 The bacterial cells were collected by centrifugation at 4000 rpm for 10 min to approximately 1.5 μL. The supernatant was discarded, and 10 mL of the prepared resuspension solution was added to each tube to resuspend the bacteria at the bottom of the tube. After resuspending Agrobacterium, the cells were centrifuged at 4000 rpm for 5 min, and the supernatant was discarded. The Agrobacterium was resuspended again with the resuspension solution, and the OD of the bacterial culture was adjusted. 600 The concentration was set at 1.0-1.2, and the prepared bacterial solution was incubated at 28℃ in the dark for 3 hours. Then, equal volumes of Agrobacterium tumefaciens solutions of pCLCrV-GhMYB4, pCLCrV-ChlI, pCLCrV-A and pCLCrV-B were mixed and injected into the underside of the cotyledons of cotton seedlings.

[0092] Example 7: Analysis of the expression pattern of GhMYB4 in GhMYB4-silenced plants

[0093] RNA was extracted from cotton fibers at different developmental stages of GhMYB4-silenced plants and control plants and reverse transcribed into cDNA. The expression level of the GhMYB4 gene in GhMYB4-silenced plants was analyzed. RT-qPCR analysis showed that, compared with control plants, the expression level of GhMYB4 in cotton fibers at different developmental stages of GhMYB4-silenced plants was significantly reduced (e.g., ...). Figure 2 (As shown in A).

[0094] Example 8: Measured the length of mature fibers in GhMYB4 silent plants and control plants 15 and 20 days after flowering using the flow-through method.

[0095] Three independent GhMYB4 silenced plants and control plants were selected, and cotton bolls were carefully separated at 15 and 20 days of development. The bolls were boiled in 0.1% hydrochloric acid solution for 2–3 minutes, then gently rinsed under running water to separate the fibers from the ovules. The fiber length was measured with a ruler. Mature fibers were carefully separated from the ovules using a comb. The results showed that compared to the control plants, the cotton fiber length was significantly increased at different developmental stages in GhMYB4 silenced plants (e.g., ...). Figure 2 (As shown in B and C).

[0096] Example 9: Scanning electron microscopy observation of cotton ovules at days 0 and 2.

[0097] The fibrous protrusions on the surface of ovules that have developed to 2 days postpartum (dpa) were observed using a scanning electron microscope (SEM). Ovules that have developed to 2 days postpartum were carefully peeled off with tweezers, taking care not to scratch the surface. The ovules were fixed with 2.5% (v / v) glutaraldehyde, and then the atmosphere was aspirated to ensure complete immersion in the fixative. The ovules were thoroughly fixed. They were washed three times with phosphate buffer for 10 min each, followed by dehydration with a gradient of 50%, 70%, 80%, and 90% ethanol for 15 min each, and then dehydrated three times with 100% ethanol for 30 min each. Finally, they were replaced three times with tert-butanol for 30 min each. The samples were dried using a freeze dryer. The samples were attached to the stage with double-sided tape, observation side up. A 10 nm gold film was deposited on the samples using an ion sputtering apparatus, and then observed using a Hitachi S-3000N scanning electron microscope. The results showed that, compared with the control plants, there was no significant difference in the number of fibrous protrusions on the surface of ovules in GhMYB4 silent plants at 0 dpa, but when the ovules developed for 2 dpa, the fiber length on the surface of the ovules in GhMYB4 silent plants was significantly higher than that in the control plants (e.g., ...). Figure 2 (As shown in D and E).

[0098] Example 10: Analysis of yield traits in silencing GHMYB4 plants and control plants

[0099] Observations on boll size at different developmental stages revealed that bolls from GhMYB4-silenced plants were larger than those from control plants (e.g., ...). Figure 3As shown in A). Furthermore, yield phenotypic analysis showed that plants with suppressed GhMYB4 expression had significantly increased lint percentage, lint index, and boll weight compared to control plants (e.g., ...). Figure 3 (as shown in B).

[0100] Example 11: Positive identification and phenotypic analysis of Arabidopsis thaliana overexpressing GhMYB4.

[0101] An overexpression vector was constructed using the full-length fragment of the gene SEQ NO ID.1 of this invention, and then transformed into Agrobacterium (primers are shown in Table 3). Arabidopsis thaliana was transformed using the flower sac method and verified to obtain Arabidopsis thaliana plants overexpressing GhMYB4 driven by the 35S promoter. DNA was extracted from the transgenic plants for PCR identification (e.g., ...). Figure 4 As shown in A). RT-qPCR analysis showed that, compared with the wild type, the expression level of this gene was significantly increased in Arabidopsis plants overexpressing GhMYB4 (e.g., ...). Figure 4 (As shown in B). After being cultured under the same normal growth conditions for 7 days, both GhMYB4-overexpressing Arabidopsis thaliana and wild-type WT plants showed significantly shorter root lengths compared to WT (e.g., ...). Figure 4 (As shown in C and D). Additionally, after culturing GhMYB4-overexpressing Arabidopsis thaliana and wild-type WT plants under the same dark growth conditions for 7 days, the hypocotyl length was observed. The results showed that compared to WT, the hypocotyl length of GhMYB4-overexpressing Arabidopsis thaliana was significantly shorter (e.g., ...). Figure 4 (As shown in E and F). Analysis of root trichome length in GhMYB4-overexpressing Arabidopsis thaliana and WT after 8 days of normal growth showed that, compared to WT, the root trichome length in GhMYB4-overexpressing Arabidopsis thaliana was significantly shorter (e.g., E and F). Figure 4 (As shown in G and H). The plant heights of GhMYB4-overexpressing Arabidopsis and WT were statistically analyzed. Compared with WT, the plant heights of GhMYB4-overexpressing Arabidopsis at 50, 60, and 70 days of growth were significantly reduced (e.g., ...). Figure 5 (As shown in A and B). Statistical analysis was performed on the pod length and seed count per pod in GhMYB4-overexpressing Arabidopsis and WT. Compared with WT, the pod length of GhMYB4-overexpressing Arabidopsis was significantly shorter, and the seed count per pod was significantly reduced (e.g., ...). Figure 5 (as shown in CE).

[0102] Table 3: Primers used for amplification

[0103]

[0104] Example 12: Transcriptome analysis of fibers in GhMYB4-silenced plants and control plants

[0105] There were 283 differentially expressed genes between CLCrV-GhMYB4 and CLCrV-A (a cut-off of 0.05 qvalue and a fold change of >1), of which 234 differentially expressed genes were upregulated and 49 differentially expressed genes were downregulated (e.g., ...). Figure 6 (As shown in A). GO analysis of 234 upregulated differentially expressed genes revealed that they were mainly enriched in tryptophan metabolism, auxin metabolism, auxin transport and efflux pathways (e.g., Figure 6 (As shown in B). Tryptophan is a precursor for auxin synthesis. Therefore, we hypothesize that auxin content and the auxin response pathway were also altered in cotton fibers from GhMYB4-silenced plants.

[0106] The expression levels of auxin efflux genes (GhPIN1a, GhPIN1C, GhPIN9), SAUR-like auxin-responsive genes (GhSAUR32), and auxin-responsive genes (GhARF18 and GhARF19) in the fibers of GhMYB4-repressed lines and control plants were identified. Compared with control plants, the expression levels of these genes were significantly increased in GhMYB4-repressed lines (e.g., ...). Figure 7 (As shown).

[0107] Example 13: Determination of auxin levels in fibers of 3GhMYB4 silenced plants and control plants

[0108] This method utilizes Agrobacterium-mediated transient transformation of cellulose with the auxin-inducible promoter pDR5. Agrobacterium transformed with the publicly available pDR5::GUS recombinant vector is streaked and incubated at 28°C for 2-3 days. Single positive colonies are picked and placed in liquid culture medium containing kanamycin and rifampin antibiotics, incubated overnight, and the culture is allowed to mature until the OD of the culture is reached. 600 When the OD value reaches 14–1.8, centrifuge at 4,000 rpm for 10 min at room temperature, then resuspend in the conversion solution. OD of the culture medium. 600 The value was 0.8-0.9. Before use, the conversion solution was degassed and treated with a vacuum pump at 0.07 MPa for 3 minutes. Fresh cotton bolls were picked and the boll epidermis was disinfected with 70% ethanol (v / v). The bolls were carefully peeled off with tweezers, and the ovules containing fibers were placed in an Erlenmeyer flask filled with Agrobacterium tumefaciens containing the pDR5::GUS recombinant vector. The fibers were incubated in the dark for 2 minutes at 0.07 MPa, and then co-cultured with Agrobacterium cells in the dark for 3 hours (25°C, 50 rpm / min). The fibers were then removed, rinsed with sterile water, and transferred to 1 / 2 MS medium. After culturing at 26 / 20°C (day and night) for 2 days, the fibers were stained with GUS to identify the auxin level in the fibers. The GUS staining results showed that, compared with the control plants, the GhMYB4 silent plants had deeper staining (e.g., ...). Figure 8 (As shown in A).

[0109] The endogenous IAA content in the fibers of control plants and GhMYB4-silenced plants was further determined. Using a plant growth regulator (IAA) enzyme-linked immunosorbent assay (ELISA) kit (Meimian Industrial Co., Ltd, China), 10 μL of the sample and 40 μL of sample diluent were added to the bottom of the ELISA plate. After sealing with a sealing film, the plate was incubated at 37°C for 30 min. The sealing film was carefully removed, the liquid was discarded, and the plate was dried. Wash buffer was added to each well and allowed to stand for 30 s, then discarded. 50 μL of enzyme-labeled reagent was added to each well and incubated at 37°C for 30 min. The liquid was discarded, and 50 μL of chromogenic reagent A and 50 μL of chromogenic reagent B were added to each well. The mixture was gently shaken and incubated at 37°C in the dark for 10 min. 50 μL of stop solution was added to each well, and the absorbance (OD value) of each well was measured sequentially at 450 nm. The results showed that the IAA level in GhMYB4-silenced plants was significantly higher than that in control plants (e.g., […]). Figure 8 (as shown in B).

[0110] Example 14 Ovule in vitro culture experiment

[0111] Take cotton ovules that have developed to 2 dpa. First, disinfect the surface of the ovules with 70% ethanol for about 1 minute, then rinse 2-3 times with sterile water (ddH2O). Sterilize with 30% H2O2 for 5-10 minutes, then rinse 2-3 times with ddH2O. Under sterile conditions, peel off the ovules and place them in liquid BT medium. Incubate in the dark at 30℃. After culturing ovules developed to 2 dpa in BT medium from GhMYB4 silent plants and control plants for 3 weeks, observe the fibrous protrusions on the surface of the ovules. The results show that the ovules of GhMYB4 silent plants produce more fibers on the surface than those of the control plants (e.g., ...). Figure 8 As shown in C), the fiber length of GhMYB4-silenced plants was significantly increased (e.g., as shown in C). Figure 8 (As shown in D). After culturing ovules in BT medium supplemented with IAA and NPA for 3 weeks, more fibers were observed in the ovules of GhMYB4 silenced plants, and the promoting effect of IAA on fiber elongation was more significant, while the effect of NPA on fiber elongation was inhibited (e.g., ...). Figure 8 (As shown in C and D). These results indicate that GhMYB4 affects auxin levels and auxin response pathways in cotton fibers by regulating GhLTP4 expression.

[0112] Example 15: Transcriptome analysis of GhMYB4-overexpressing Arabidopsis thaliana

[0113] Further analysis of the transcriptome data of Arabidopsis thaliana overexpressing GhMYB4 revealed that, compared with WT, GhMYB4 overexpression in Arabidopsis thaliana upregulated 561 genes and downregulated 698 genes (e.g., ...). Figure 9 As shown in A). GO enrichment of these downregulated genes also revealed enrichment of tryptophan synthesis, auxin response, and auxin-mediated signaling pathways (such as...). Figure 9 (As shown in B). Expression pattern analysis of auxin-responsive and efflux genes showed that, compared with wild-type, the expression of these genes was significantly reduced in GhMYB4-overexpressing Arabidopsis thaliana (e.g., ...). Figure 9 (As shown in C). Furthermore, the auxin content in the leaves was measured, and the endogenous auxin content was significantly reduced in GhMYB4-overexpressing Arabidopsis thaliana (e.g., ...). Figure 9 (As shown in D). Therefore, these data indicate that heterologous overexpression of GhMYB4 in Arabidopsis regulates Arabidopsis cell elongation by modulating auxin levels and auxin response pathways.

[0114] Example 16: Verification of promoter binding of GhMYB4 and GhLTP4

[0115] Electrophoretic mobility shift assay (EMSA) showed that GhMYB4 can bind to the promoter of GhLTP4. Using the 50 bp promoter sequence of GhLTP4 as a probe, GhMYB4 protein can bind to the biotin-labeled probe, while the binding affinity is significantly reduced upon the addition of an unlabeled probe (e.g., ...). Figure 10 (As shown in A). RT-qPCR analysis was performed on the expression level of GhLTP4 in GhMYB4-silenced plants. The results showed that, compared with control plants, the expression level of GhLTP4 in GhMYB4-silenced plants was significantly increased (e.g., as shown in A). Figure 10 (As shown in B). In the Dual-LUC reporter system, GhMYB4 was used as the effector. The promoter sequence 1500 bp upstream of GhLTP4 was recombined into the upstream of the LUC gene to construct the reporter factor (pGhLTP4::LUC). The REN gene included in the reporter construct served as an internal reference gene. When the reporter factor and effector were co-transfected into tobacco leaves, the LUC / REN ratio was significantly lower than that of reporter factor alone (e.g., ...). Figure 10 As shown in Figure C), this indicates that promoter binding of GhMYB4 with GhLTP4 negatively regulates GhLTP4 expression. We have already demonstrated that GhbHLH105 binds to pGhLTP4 via an E-box element and positively regulates GhLTP4 expression, promoting cotton fiber elongation. GhMYB4, on the other hand, binds to pGhLTP4, negatively regulating GhLTP4 expression. To explore the roles of GhbHLH105 and GhMYB4 in regulating GhLTP4 expression, a Dual-LUC reporter system was used. The results showed that when GhMYB4 and GhbHLH105 were co-injected with pGhLTP4 into tobacco leaves, the LUC / REN ratio was significantly higher compared to when GhMYB4 and pGhLTP4 were co-injected into tobacco leaves (e.g., as shown in Figure C). Figure 10(As shown in C). Furthermore, in the LUC experiment, GhMYB4 served as the effector, and pGhLTP4::LUC constituted the reporter factor. Tobacco leaves infected with the reporter factor alone showed strong fluorescence signals, while tobacco leaves co-infected with both the effector and reporter factors showed extremely weak fluorescence signals (e.g., as shown in Figure C). Figure 10 (As shown in D). LUC experiments also showed that the fluorescence signals of GhMYB4 and GhbHLH105 co-injected with pGhLTP4 were stronger than those of GhMYB4 co-injected with pGhLTP4 (e.g., as shown in D). Figure 10 (As shown in D). These data indicate that GhbHLH105 can inhibit the negative regulatory effect of GhMYB4 on GhLTP4.

[0116] We further verified the binding site of GhMYB4 to the GhLTP4 promoter using the GUS reporter system and LUC experiments. In the LUC experiment, the six tandem repeat sequences of the TTTAGTG sequence fused with the upstream sequence of mini35S::LUC to form the reporter factor. GhMYB4 served as the effector factor. Reporter factor alone infected tobacco leaves showed a strong LUC fluorescence signal, while the fluorescence signal was weak after co-infection of tobacco leaves with both the effector and reporter factors (e.g., ...). Figure 11 As shown in A). The results from the GUS reporting system also consistently show that GhMYB4 directly binds to the MYB binding sites (MBS, TTTAGTG) on pGhLTP4 (as shown in A). Figure 11 (As shown in B). The above experimental results indicate that GhMYB4 directly binds to the MYB binding sites (MBS, TTTAGTG) on the GhLTP4 promoter, negatively regulating GhLTP4 expression.

[0117] Example 17: Lipidome analysis of fibers in GhMYB4-silenced plants and control plants.

[0118] Lipidome analysis was performed on six biological replicates of cotton fibers from CLCrV-A and CLCrV-GhMYB4 developed for 20 dpa. Fresh cotton bolls were used, and fibers were carefully detached from the ovules using tweezers. The fibers were ground into powder using liquid nitrogen, and 0.1 g was weighed into a 2 mL centrifuge tube. 750 μL of a chloroform-methanol mixture (2:1, v:v) was added, along with steel beads. The tube was placed in a tissue homogenizer and homogenized at 60 Hz for 60 s. The mixture was then incubated on ice for 10 min and centrifuged at 12000 rpm at room temperature for 5 min. 300 μL of the supernatant was transferred to a new 2 mL centrifuge tube. 500 μL of a chloroform-methanol mixture (2:1, -20℃) was added, and the mixture was vortexed for 30 s. The sample was concentrated using a vacuum centrifuge. 200 μL of isopropanol was added to dissolve the sample, and the mixture was filtered through a 0.22 μm membrane. The samples were then analyzed by LC-MS (Thermo, USA). VIP greater than 1, p value less than 0.05, and fold difference greater than 1 were used as the screening thresholds for differential lipids.

[0119] Lipidomics data analysis showed that, compared with the control, inhibiting GhMYB4 expression revealed 194 differentially expressed lipids, of which 138 lipids were increased and 55 lipids were decreased (e.g., ...). Figure 12 As shown in A). Based on different functional groups and carbon chain lengths, these differentially expressed lipids were divided into 33 categories (e.g., ...). Figure 12 As shown in B), among them, the lipid that most significantly increased GhMYB4 expression compared to the control was Cers (as shown in B). Figure 12 As shown in C), functional enrichment analysis of these differentially expressed lipids was performed using the R package ggplot, and the main enriched pathway was the ceramide Cers synthesis pathway (e.g., Figure 12 (As shown in D). Therefore, the experimental results indicate that GhMYB4 negatively regulates the expression of GhLTP4, thereby affecting the content of Ceres in the fiber.

[0120] Example 18: Expression level analysis of key genes in lipid synthesis

[0121] Further analysis of the expression levels of key rate-limiting enzymes in the synthesis of very long-chain fatty acids in the fibers of GhMYB4 silenced plants and control plants revealed that, compared with control plants, the expression levels of the rate-limiting enzymes for the synthesis of very long-chain fatty acids, GhKCSs, and the key enzymes for the synthesis of sphingolipids, GhSPTs, were significantly increased in the fibers of GhMYB4 silenced plants (e.g., ...). Figure 13 (As shown).

[0122] Example 19 Phenotypic analysis of ovule in vitro culture in BT medium treated with Ceres and empty control

[0123] To further verify the regulatory relationship between GhMYB4 and GhLTP4, ovules from GhLTP4-silenced plants and control plants that had developed for 2 days were cultured in BT medium supplemented with 10 μM Cers and empty BT medium, respectively. After 3 weeks of culture, it was found that Cers promoted cotton fiber elongation, and compared with the control, the promoting effect of inhibiting GhLTP4 expression on fiber elongation was more significant (e.g., ...). Figure 14 A and B). The expression levels of auxin-responsive genes GhSAUR32, GhARF18, and GhARF19 were further analyzed in GhLTP4-silenced plants and control plants. Compared with the control, the expression levels of auxin-responsive genes GhSAUR32, GhARF18, and GhARF19 were significantly increased after Cers application. Figure 14 C). These experimental results also confirm that IAA plays a role downstream of Cers during fiber elongation.

[0124]

[0125]

Claims

1. Inhibition of a cotton GhMYB transcription factor as shown in SEQ ID NO. 1 GhMYB4 Use of gene expression in (al) or (a2) below: (a1) increasing cotton fiber length; (a2) breeding new germplasm with increased cotton fiber length.

2. Reducing the amount of cotton GhMYB transcription factor as described in claim 1 GhMYB4 The activity or content of the gene-encoded protein GhMYB4 is used in the following (a1) or (a2): (a1) increasing cotton fiber length; (a2) breeding new germplasm with increased cotton fiber length.

3. A biological material for use in inhibiting the cotton GhMYB transcription factor as claimed in claim 1 GhMYB4 application of a biological material for gene expression in (al) or (a2) below: (a1) increasing cotton fiber length; (a2) breeding new germplasm with increased cotton fiber length. The biological material for inhibiting cotton GhMYB transcription factor GhMYB4 The biological material for inhibiting cotton GhMYB transcription factor The biological material for inhibiting cotton GhMYB transcription factor (c1) the cotton GhMYB transcription factor GhMYB4 interfering or silencing fragment of a gene; (c2) a GhMYB transcription factor for use in amplifying (c1) GhMYB4 primers for a gene interference fragment or a silencing fragment; (c3) the cotton GhMYB transcription factor GhMYB4 interference expression vector or silencing vector of a gene; (c4) a recombinant microorganism containing the interference expression vector or the silencing vector as described in (c3); the recombinant microorganism is a recombinant Agrobacterium.

4. Use according to claim 1 or 3, characterized in that, By inhibiting the cotton GhMYB transcription factor GhMYB4 The expression of the gene is increased, and the cotton fiber length is increased; the cotton GhMYB transcription factor is inhibited GhMYB4 The process for increasing the expression of the gene is as follows: constructing the cotton GhMYB transcription factor GhMYB4 The interference expression vector or the silencing vector of the gene is constructed, the interference expression vector or the silencing vector is transformed into cotton through an agrobacterium-mediated method, and a cotton material GhMYB4 The cotton material with significantly reduced gene expression is obtained.

5. A method of increasing the length of cotton fibers, characterized by, By inhibiting the cotton GhMYB transcription factor in claim 1 GhMYB4 The expression amount or decrease of the gene is caused by the cotton GhMYB transcription factor GhMYB4 GhMYB4 The activity or content of the protein GhMYB4 encoded by the gene is increased to increase the cotton fiber length.