Recombinant human type I collagen, preparation method and application in preparing medical cosmetic filler

Abstract

The present invention discloses a recombinant human type I collagen, a preparation method and an application thereof in the preparation of medical aesthetic fillers. The recombinant human type I collagen with a high content of isopeptide and nanocellulose are prepared into a composite hydrogel, which has high stability, low swelling, high weight retention rate, strong adhesion and hemostasis, and has the potential to be a skin tissue repair material. In addition, the composite hydrogel can be used to repair burned skin, significantly reduce the inflammatory response of burned skin, and promote wound healing. In addition, the composite hydrogel can also be used as a filler or inhibitor to be filled in mice, has a lower inflammatory response, and can promote collagen synthesis in mice, promote angiogenesis and bone cell generation in the long term, and then promote tissue regeneration, providing a technical basis for it as a medical aesthetic filling material.

Description

Technical Field

[0001] The present invention relates to the technical field of type I human collagen, and in particular to recombinant type I human collagen, a preparation method and application in the preparation of medical aesthetic fillers. Background Art

[0002] Type I collagen is the only component of collagen fibers in the dermis, accounting for more than 80% of the skin; it is the most abundant component in the dermal connective tissue. Type I collagen is a heterotrimeric molecule, each chain is composed of more than 1,000 amino acids, the length of type I collagen molecules is about 300nm, the width is about 1-5nm, and the collagen trimer has a high tensile strength. In most cases, it is composed of two α1 chains and one α2 chain, while the α1 homotrimer exists in a minor form.

[0003] Type I collagen provides a mechanical support for organisms, maintains the integrity of organs and tissues, and ensures their normal functions, which is very important for solid organs. Type I collagen is the main component of the basement membrane of solid organs. More than 80% of the organic matter in bones is type I collagen. The main way that type I collagen plays a role in bones and connective tissues is to form and maintain the integrity of the skeleton; in addition, type I collagen also plays a major role in forming specific extracellular microenvironments, and these microenvironments are critical for maintaining cell integrity and transmitting extracellular signals.

[0004] The initial application of type I collagen in medicine can be traced back to 175 AD, when Dr. Galen first used collagen as an absorbable enteric suture. With the development of process improvement and modification technology, collagen is made into hemostatic powder, burn dressings, drug carriers, cardiac membranes, blood vessels, tubes and trachea, and other alternative materials, surgical sutures, etc., and used in conjunction with various purposes, showing good application prospects in clinical medicine. Type I collagen also has a wide range of uses in the pharmaceutical, cosmetic, food and other industries. Summary of the invention

[0005] In view of this, the present invention provides a recombinant type I human collagen, a preparation method and an application in the preparation of medical aesthetic fillers.

[0006] One of the purposes of the present invention is to provide a method for preparing recombinant human type I collagen, comprising:

[0007] A solution of human type I procollagen amino terminal peptide and a solution of cross-linked peptide of the same concentration are prepared, wherein the human type I procollagen amino terminal peptide is as shown in SEQ ID NO.1, and the cross-linked peptide is as shown in SEQ ID NO.2;

[0008] Mixing the solution of the human type I procollagen amino terminal peptide and the solution of the cross-linked peptide in a volume ratio of (1-2):(1-4);

[0009] Add glutaminase 5-40 U / g protein;

[0010] After thorough mixing, place at 50℃ for 0.5~6 h;

[0011] After the reaction, the sample was taken out, placed in a boiling water bath to inactivate the enzyme, and cooled to room temperature;

[0012] The solution pH was adjusted to 4.6 to precipitate the modified product and remove the unmixed cross-linked peptides, and the mixture was centrifuged at 10,000 × g for 15 min, and the supernatant was discarded;

[0013] The precipitate was washed with water at pH 4.6, and the obtained precipitate was recombinant type I human collagen.

[0014] Specifically, the solution of the human type I procollagen amino-terminal peptide and the solution of the cross-linked peptide are mixed in a volume ratio of 1:1, 1:2, 1:3, 1:4 or 2:1.

[0015] Specifically, the added amount of glutaminase is 5 U / g, 10 U / g, 20 U / g, 30 U / g or 40 U / g protein.

[0016] Specifically, the reaction time is 0.5h, 1h, 2h, 4h or 6h.

[0017] One of the purposes of the present invention is to provide a method for preparing a composite hydrogel, comprising:

[0018] In an ice bath at 0 °C, an ionic liquid containing 50 g / L 1,5-diazabicyclo[4.3.0]-5-nonene and 50 g / L levulinic acid was prepared;

[0019] Under mechanical stirring in an oil bath at 100° C., nanocellulose and recombinant human type I collagen prepared by the above preparation method are added to the ionic liquid at the same time, and the mixture is stirred quickly to fully dissolve;

[0020] The reactants were placed in a culture dish, left to stand at room temperature for 1 day, and then washed repeatedly with anhydrous ethanol.

[0021] Specifically, the final concentration of the nanocellulose is 1.25 g / L, and the final concentration of the recombinant type I human collagen is 1.25 g / L.

[0022] Specifically, the diameter of the nanocellulose is 4-10 nm and the length is 200 nm.

[0023] One of the purposes of the present invention is to provide recombinant type I collagen prepared by the method described above.

[0024] One of the purposes of the present invention is to provide the use of the recombinant type I collagen prepared by the method described above in the preparation of skin tissue repair materials.

[0025] One of the purposes of the present invention is to provide the use of the recombinant type I collagen prepared by the method described above in the preparation of biological filling materials.

[0026] Beneficial Effects

[0027] A recombinant type I human collagen with a high content of isopeptide is prepared by the method provided by the present invention. By preparing a composite hydrogel with this high content of isopeptide and nanocellulose, it has a high stability, low swelling, high weight retention rate, and strong adhesion and hemostasis, and has the potential to be a skin tissue repair material. And this composite hydrogel can be used to repair burned skin, significantly reduce the inflammatory response of burned skin, and promote wound healing. In addition, this composite hydrogel can also be used as a filler or inhibitor to be filled in mice, has a lower inflammatory response, and can promote collagen synthesis in mice, and promotes angiogenesis and bone cell generation in the long term, thereby promoting tissue regeneration, providing a technical basis for it as a medical beauty filling material. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 These are pictures of the experimental group, control group 1, control group 2 and control group 3 in the inversion test experiment on the 1st day, 20th day, 40th day and 60th day.

[0029] Figure 2 These are the results of the experimental group, control group 1, control group 2 and control group 3 in the in vitro swelling and degradation experiment.

[0030] Figure 3 These are the results of the experimental group, control group 1, control group 2 and control group 3 in the in vitro adhesion experiment.

[0031] Figure 4 These are the results of the experimental group, control group 1, control group 2 and control group 3 in the cell experiment.

[0032] Figure 5 These are the levels of white blood cells (WBC), neutrophils (Neu), and lymphocytes in mice in the model group, test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) on day 14 in the skin burn experiment.

[0033] Figure 6These are the burn area results of mice in the model group, test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) at 7 days, 14 days, and 21 days in the skin burn experiment.

[0034] Figure 7 These are the results of the relative content of collagen fibers in mice in the model group, test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) at 7 days, 14 days, and 21 days in the skin burn experiment.

[0035] Figure 8 These are the relative expression results of TNF-α in the blank group (Blank), test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) of mice in the injection experiment.

[0036] Fig. 9 These are the relative expression results of IL-6 in the blank group (Blank), test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) in the injection experiment.

[0037] Fig.10 These are the relative expression results of type I collagen in mice in the blank group (Blank), test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) in the injection experiment.

[0038] Fig.11 These are the relative expression results of type III collagen in mice in the blank group (Blank), test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) in the injection experiment.

[0039] Fig.12 These are the relative expression results of VEGF in the blank group (Blank), test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) of mice in the injection experiment.

[0040] Fig.13 These are the relative expression results of AKP in the blank group (Blank), test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) of mice in the injection experiment. DETAILED DESCRIPTION

[0041] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The reagents not described separately in detail in the present invention are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0042] 1. Preparation of recombinant human type I collagen

[0043] The amino-terminal peptide of human type I procollagen (MSST0034, Sigma-Aldrich, shown in SEQ ID NO.1) and the cross-linking peptide (SEQ ID NO.2) were cross-linked by catalysis using transglutaminase (MTG, CAS No. 80146-85-6, solubility in water is 1.0 g / L, Beijing Solebow Technology Co., Ltd.) to obtain a recombinant type I human collagen. The specific steps include:

[0044] Effect of reaction conditions

[0045] Crosslinking ratio

[0046] A solution of 50 g / L of the amino-terminal peptide of human type I procollagen (shown in SEQ ID NO.1) and a solution of a cross-linked peptide (SEQ ID NO.2) were prepared respectively, and the pH was adjusted to 7.5 respectively. The amino-terminal peptide solution of human type I procollagen and the cross-linked peptide solution were mixed at a volume ratio of 1:1, 1:2, 1:3, 1:4 and 2:1 respectively. Glutaminase was added at an amount of 30 U / g protein. After the reaction system was fully mixed, it was placed in a 50℃ constant temperature incubator for 4 h on a horizontal shaker for oscillation reaction. Each sample was made in parallel 3 times. After the reaction was completed, the sample was taken out, placed in a boiling water bath for 15 min to inactivate the enzyme, and cooled to room temperature. The pH of the solution was adjusted to 4.6 to precipitate the modified product and remove the unmixed cross-linked peptide. The solution was centrifuged at 10000×g for 15 min, and the supernatant was discarded. The precipitate was washed with water at pH 4.6, and the supernatant was discarded by centrifugation again. This water washing process was repeated twice. The resulting precipitate was recombinant type I human collagen, which was freeze-dried.

[0047] 2) Enzyme addition amount

[0048] A solution of human type I procollagen amino terminal peptide (shown in SEQ ID NO.1) and a cross-linked peptide (SEQ ID NO.2) with a protein mass concentration of 50 g / L were prepared respectively, and the pH was adjusted to 7.5 respectively. The human type I procollagen amino terminal peptide solution and the cross-linked peptide solution were mixed at a volume ratio of 1:3. The addition amount of glutaminase was 5 U / g, 10 U / g, 20 U / g, 30 U / g and 40 U / g protein, respectively. After the reaction system was fully mixed, it was placed in a 50℃ constant temperature incubator and shaken for 4 h. Each sample was made in parallel 3 times. After the reaction was completed, the sample was taken out, placed in a boiling water bath to inactivate the enzyme for 15 min, and cooled to room temperature. The pH of the solution was adjusted to 4.6 to precipitate the modified product and remove the unmixed cross-linked peptide. The solution was centrifuged at 10000×g for 15 min, and the supernatant was discarded. The precipitate was washed with water with pH 4.6, and the supernatant was discarded by centrifugation again. This water washing process was repeated twice, and the precipitate was freeze-dried. The obtained precipitate was recombinant type I human collagen.

[0049] 3) Response time

[0050] Prepare the amino-terminal peptide of human type I procollagen and the cross-linked peptide solution with a protein concentration of 50 g / L, adjust the pH to 7.5, and mix the amino-terminal peptide solution of human type I procollagen and the cross-linked peptide solution at a volume ratio of 1:3. Add 30 U / g protein of transglutaminase, and after the reaction system is fully mixed, place it in a 50°C constant temperature incubator and shake it on a horizontal shaker. The reaction time is 0.5, 1, 2, 4, and 6 h, respectively, and each sample is made in parallel 3 times. After the reaction is completed, take out the sample and treat it as above.

[0051] 2. Determination of the content of isopeptide bonds in recombinant human type I collagen

[0052] The SilGreen ODS C18 column was used to detect the content of ε-(γ-Glu)Lys (isopeptide bond). The cross-linked group (recombinant human type I collagen) and the blank control group (human type I procollagen amino-terminal peptide and cross-linked peptide) were hydrolyzed with trypsin, and 8000 U / g of protein substrate was added. The enzyme was dissolved in 0.01 mol / L PBS at pH 7.0, and digested in a water bath at 37℃ for 48 hours, and then in a boiling water bath for 5 minutes to inactivate the enzyme. The digested sample was centrifuged at 10000 r / min for 20 minutes, and the supernatant was freeze-dried for later use. The freeze-dried sample was deproteinized by adding 100% methanol, and the supernatant was centrifuged and dried at 60℃ using a nitrogen blower, and finally redissolved in 0.5 mL of mobile phase. The sample dissolved in the mobile phase was added to the Amicon○R Ultra 3K ultrafiltration centrifuge tube and centrifuged at 4000×g for 30 minutes to collect the filtrate. The treated sample filtrate was derivatized to detect the isopeptide bond content. Prepare an OPA derivatization reagent consisting of 22.4mmol / L OPA (o-phthalaldehyde, CAS: 643-79-8, Shanghai Aladdin), 0.4 mol / L Na2CO3, and 50% methanol containing 2% β-mercaptoethanol, and use it immediately. 80 μL of the sample was quickly mixed with 320 μL of OPA derivatization reagent, vortexed for 70 seconds, and then allowed to stand for 2 minutes. 10 μL was injected into the liquid chromatography for fluorescence detection. Mobile phase A: 20 mmol / L potassium acetate (pH 5.5) containing 1% tetrahydrofuran (THF); mobile phase B: 1% THF dissolved in pure methanol. 0-55min mobile phase B 20%-95%; 55-60 min mobile phase B 95%-20%. The column temperature was 40℃, the flow rate was 1.0mL / min, the excitation wavelength (EX) was 334 nm, and the emission wavelength (EM) was 440 nm. The standard substance ε-(γ-Glu)Lys was dissolved in the mobile phase, and a concentration gradient of 0.005, 0.01, 0.05, 0.1, 0.5, 1.0, and 2.0 mmol / L was prepared to prepare a standard curve.

[0053] As shown in the results in Table 1, when the cross-linking ratio was 1:3 or 1:4, the enzyme addition amount was 30U / g, and the reaction time was 4h, a higher content of ε-(γ-Glu)Lys isopeptide bonds could be obtained, indicating that highly cross-linked recombinant type I human collagen was successfully prepared.

[0054] Table 1 ε-(γ-Glu)Lys (isopeptide bond) content (μmol / 100g)

[0055]

[0056] 2. Preparation of hydrogel

[0057] The composite hydrogel of nanocellulose / recombinant human type I collagen is prepared using levulinic acid-based ionic liquid as solvent. The specific steps include:

[0058] In an ice bath at 0°C, 1,5-diazabicyclo[4.3.0]-5-nonene and levulinic acid were added successively in a two-necked bottle in a weight ratio of 1:1 and stirred for 5 min to form a yellow transparent ionic liquid (both with a concentration of 50 g / L). Under mechanical stirring in an oil bath at 100 °C, nanocellulose (final concentration of 1.25 g / L, purity: ≥99%, diameter (nm): 4-10, length: 200 nm, YXL0026, Yingxin Laboratory) and recombinant type I human collagen (final concentration of 1.25 g / L, isopeptide bond content 98.36 ± 0.72 μmol / 100 g) obtained in the above steps were added to the ionic liquid at the same time. The mixture was stirred rapidly for about 30 minutes, and nanocellulose and recombinant type I human collagen were fully dissolved. The reactants were placed in a culture dish and allowed to stand at room temperature for 1 day, and then repeatedly washed with anhydrous ethanol. The four composite gels formed were punched with a puncher to make hydrogel columns with a diameter of 30 mm and a height of 3 mm. Then they were soaked in pure water for 12 hours, during which pure water was replaced.

[0059] The recombinant human type I collagen was replaced with ordinary human type I collagen (5008, Advanced Biomatrix) in the same way as control group 1. In addition, no protein was added, and only nanocellulose was used to prepare the hydrogel, which was used as control group 2. Among them, the recombinant human type I collagen was replaced with the above-mentioned human type I procollagen amino-terminal peptide in the same way to prepare the hydrogel, which was used as control group 3. The recombinant human type I collagen was replaced with a cross-linked peptide in the same way to prepare the hydrogel, which was used as control group 3.

[0060] 3. Physical performance test

[0061] 1. Inversion test

[0062] The hydrogel cylinders prepared in each experimental group were subjected to gel inversion test. The prepared hydrogels were placed in a vial and inverted, and observed on the 1st day, 20th day, 40th day, and 60th day. Figure 1 As shown, control group 4 did not form a hydrogel, control group 2 and control group 3 liquefied on the 20th day, while neither the experimental group nor the control group 1 liquefied.

[0063] 2. In vitro swelling and degradation test

[0064] The hydrogel to be tested was placed in a 9 cm culture dish filled with phosphate buffer solution (PBS, 20 mM). The hydrogel was taken out of the culture dish at regular intervals and the excess water remaining on the surface was removed with filter paper. The hydrogel was weighed using an analytical balance. Swelling rate = (Wt-W0) / W0×100%; Weight retention rate = (W0-Wt) / W0×100%; where Wt is the weight of the hydrogel taken out of the culture dish at different times, and W0 is the initial weight of the wet hydrogel. Figure 2 As shown, the hydrogels in the experimental group had superior swelling after 2 h, while the swelling of the control groups 2 and 3 was obvious; the hydrogels in the experimental group had the highest weight retention rate within 60 days.

[0065] 3. In vitro adhesion test

[0066] The hydrogel adhesion test to tissue was simulated and measured using fresh pig skin. The pig skin tissue was cut into 20 mm × 40 mm rectangles and soaked in PBS (20 mM). The prepolymerized hydrogel solution (100 μL) was applied to the surface of the pig skin, and another pig skin was used to buckle and press the bonding surface tightly. The bonding area was 20 mm × 10 mm. The pig skin was placed at room temperature for 2 minutes or 2 hours, and then the short-term and long-term tissue adhesion of the hydrogel was measured by a universal tensile tester.

[0067] like Figure 3 As shown, the adhesion strength of the hydrogel in the experimental group was about 35 kPa, which was significantly higher than that in the control groups 1, 2 and 3. The skin repair hydrogel needs to have excellent adhesion and hemostasis to the skin tissue, which indicates that the hydrogel provided by the experimental group has the potential to be used as a skin tissue repair material.

[0068] IV. Cell Experiment

[0069] L929 cell line (Shine Biotechnology), human cardiomyocytes (AC16, 1×10 6 , BC-C-HU-038, Biochannel), rat liver parenchymal cells (CP-R033, Punosai), rat kidney cells (NRK, CL-0173, Punosai) (50,000 cells per well), the hydrogels obtained from the above experimental group, control group 1, control group 2, control group 3 and control group 4 (all at a concentration of 5 mg / mL) were added to the culture medium and cultured at 37 °C for 24 hours, 48 ​​hours and 72 hours. At the set time point, 10 μL of cell counting kit (Invigentech) was added to each well, incubated at 37 °C for 2 hours, and the absorbance value at 590 nm was measured by microplate reader. The blank group was without hydrogel. The cell viability is the percentage of the absorbance after culture to the absorbance of the blank group.

[0070] The results are as follows Figure 4 As shown, each group of hydrogels had no obvious toxicity to L929 cell lines, human cardiomyocytes, rat liver parenchymal cells and rat kidney cells, and had the potential to be used as skin tissue repair on the surface of the body and as filling materials in the body.

[0071] 5. Animal Experiments

[0072] 1. Skin burn test

[0073] ICR mice (female, weight: 20-30 g, Wuhan Animal Experiment Center) were randomly divided into blank group (Blank), model group (Mod), test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5).

[0074] The test sample of test group 1 is the hydrogel prepared by the above experimental group. The test sample of test group 2 adopts the same method as the above experimental group, replacing the recombinant type I human collagen with the recombinant type I human collagen with an isopeptide bond content of 88.18±0.56μmol / 100g in Table 1 to prepare the hydrogel. The test sample of test group 3 is the hydrogel provided by the above control group 1. The test sample of test group 4 is the hydrogel provided by the above control group 2. Test group 5 is the hydrogel provided by the above control group 3.

[0075] The treatment plan for burns mainly focuses on stabilizing the body's metabolism, preventing infection, and accelerating its functional recovery. The deeper the burn, the higher the risk of complications such as infection, which will undoubtedly increase the difficulty of clinical treatment. The burn wound is mainly divided into three areas, namely the coagulation (necrosis) area, the congestion (ischemia) area, and the outermost inflammatory area. In the ischemic area, the tissue may show progressive ischemia and tissue necrosis within 24-48 hours, but the cells in this area are still alive at this time. If intervention treatment is performed within 24 hours, the progression of necrosis can be hindered, and the surviving skin around the burn wound area can be retained to the maximum extent.

[0076] In this experiment, a mouse model of deep second-degree burns was constructed to evaluate its therapeutic effect. Deep burns can cause immunosuppression in mice. The model construction process includes: the mice were weighed and anesthetized with chloral hydrate (4% w / v, 0.1 mL / 10 g). After the anesthesia took effect, the hair on the back of the mice was removed, the excess water on the back was wiped off, and a circular burn with a diameter of 1.5 cm was prepared by attaching a heated metal rod to the skin surface. The mice with deep second-degree burns were divided into model group, test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5). The corresponding hydrogel was applied to the burn site of the mouse skin in test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5), respectively, and the model group and blank group were not treated.

[0077] The mice were killed on the 7th, 14th, and 21st days after surgery, and the surface area of ​​the damaged area was measured using Image J. The ruler was placed to calibrate the magnification of the wound area photo. The calculation formula of collagen fiber in the wound surface was: collagen fiber (%) = A0 [type I collagen area] / A1 [total tissue area] × 100%. Blood routine tests were performed to detect the levels of white blood cells (WBC), neutrophils (Neu), and lymphocytes (Lym) in the serum of mice in each group on day 21.

[0078] like Figure 5 As shown, blood routine tests for 14 days showed that the levels of white blood cells (WBC), neutrophils (Neu) and lymphocytes in the model group mice were significantly reduced, their immunity was suppressed, and the deep II degree burn model mice were successfully established. In the figure, the white blood cell levels of mice in test groups 1 and 2 were significantly higher than those in the model group (**, p<0.01), and the white blood cell levels of mice in test groups 3, 4 and 5 were not significantly different from those in the model group (ns). The neutrophil levels of mice in test groups 1 and 2 were significantly higher than those in the model group (**, p<0.01), and the neutrophil levels of mice in test groups 3, 4 and 5 were not significantly different from those in the model group (ns). The lymphocyte levels of mice in test groups 1 and 2 were significantly higher than those in the model group (*, p<0.05), and the lymphocyte levels of mice in test groups 3, 4 and 5 were not significantly different from those in the model group (ns). This indicates that after the hydrogel provided by test groups 1 and 2 was used to treat the skin burns, the mouse white blood cell (WBC), neutrophil (Neu) and lymphocyte levels of mice were restored on the 14th day, while test groups 3 to 5 showed no obvious signs of recovery.

[0079] Figure 6As shown, the burn area of ​​mice in test groups 1 and 2 was significantly lower than that in the model group on day 7 (*, p<0.05), and the burn area of ​​mice in test groups 3, 4 and 5 was not significantly different from that in the model group (ns). The burn area of ​​mice in test groups 1 and 2 was significantly lower than that in the model group on day 14 (**, p<0.01), the burn area of ​​mice in test group 3 was significantly lower than that in the model group on day 14 (*, p<0.05), and the burn area of ​​mice in test groups 4 and 5 was not significantly different from that in the model group (ns). The burn area of ​​mice in test groups 1 and 2 was significantly lower than that in the model group on day 21 (**, p<0.01), the burn area of ​​mice in test group 3 was significantly lower than that in the model group on day 21 (*, p<0.05), and the burn area of ​​mice in test groups 4 and 5 was not significantly different from that in the model group (ns). This shows that the hydrogel provided by test groups 1 and 2 can quickly promote wound healing in mice and rapidly reduce the burn area, while the burn sites of mice in the model group and test groups 3 to 5 had obvious coagulative necrosis and epidermal ulceration resulting in exposure of the dorsal muscles, while the surface scabs of mice in test groups 4 and 5 were intact, the wounds remained moist, without cracking, and were difficult to heal when inverted.

[0080] Figure 7 As shown, the relative content of collagen fibers in test groups 1 and 2 was significantly higher than that in the model group on the 7th day (**, p<0.01), and there was no significant difference between the relative content of collagen fibers in test groups 3, 4 and 5 and the model group (ns). The relative content of collagen fibers in test groups 1 and 2 was significantly higher than that in the model group on the 14th day (**, p<0.01), and there was no significant difference between the relative content of collagen fibers in test groups 3, 4 and 5 and the model group (ns). This shows that the hydrogel provided by test groups 1 and 2 can quickly promote wound healing in mice, quickly reduce the burn area, and promote the growth of mouse skin tissue fibers, while the burned skin of mice in the model group and the control group may undergo irreversible degeneration and coagulative necrosis, resulting in the inability of their collagen fibers to recover quickly.

[0081] 2. Injection experiment

[0082] ICR mice were randomly divided into blank group (Blank), test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5).

[0083] The test sample of test group 1 is the hydrogel prepared by the above experimental group. The test sample of test group 2 adopts the same method as the above experimental group, replacing the recombinant type I human collagen with the recombinant type I human collagen with an isopeptide bond content of 88.18±0.56μmol / 100g in Table 1 to prepare the hydrogel. The test sample of test group 3 is the hydrogel provided by the above control group 1. The test sample of test group 4 is the hydrogel provided by the above control group 2. Test group 5 is the hydrogel provided by the above control group 3. The blank group was not injected.

[0084] After ICR mice were adapted to the IVC environment for one week, the experiment was conducted. Each mouse was weighed and anesthetized with 0.5% sodium pentobarbital solution injected at 50 mg / kg body weight on the back. The back was depilated, and 0.1 mL of freshly prepared test products of each group were injected clockwise at the depilated area. Each mouse had four injection sites in a square shape in the depilated area. After the injection, the injection site (including the injection, surrounding capsule and full-thickness skin) was surgically removed at the 1st, 4th and 16th week for relevant detection and analysis.

[0085] 1) RT-PCR of transplanted tissue

[0086] Extraction of total RNA from transplanted tissues. Specifically, 100 mg of transplanted tissues were precooled, ground at 4°C, centrifuged at 4°C, 12,000 rpm for 10 min, supernatant was taken, 400 μL of chloroform was added, mixed and allowed to stand for 3 min, centrifuged at 4°C, 12,000 rpm for 10 min, supernatant was taken, 550 μL of isopropanol was added, mixed and allowed to stand for 15 min, centrifuged at 4°C, 12,000 rpm for 10 min to obtain precipitate, 1.5 mL of 75% ethanol was added to wash thoroughly twice, centrifuged at 4°C, 12,000 rpm for 5 min, ethanol was removed, and the precipitate was dried on a clean bench for 5-10 min to make it transparent, dissolved with 15 μL of double-distilled nuclease-free water, and its purity was measured at 1.8-2.0, and diluted to 100-500 ng / μL with double-distilled sterile water.

[0087] The extracted total RNA was reverse transcribed. The reverse transcription reaction system was 4 μL 5× Reaction Buffer, 0.5 μL Oligo (dT)18 Primer (100 μM), 0.5 μL Random Hexamer primer (100 μM), 1 μL Servicebio®RT Enzyme Mix, 2 μg total RNA, double distilled water was added to 20 μL, mixed and centrifuged, reverse transcription was performed on a PCR instrument at 25°C for 5 minutes, 45°C for 30 minutes, and 85°C for 5 seconds, and the obtained cDNA was stored at -20°C for later use.

[0088] Fluorescence PCR. Prepare the fluorescence PCR reaction system, 7.5μL 2×SYBR Green qPCR Master Mix, 1.5μL upstream primer (2.5μM), 1.5μL downstream primer (2.5μM), 2μL cDNA, 4μL nuclease-free water. PCR reaction program, pre-denaturation: 95℃30s; denaturation 95℃15s\annealing extension 60℃30s; 95℃10s, 65℃1min, rise to 95℃. According to the Ct value obtained by the instrument, the relative expression of each gene was calculated using ΔΔCT, and each sample was repeated 3 times.

[0089] GAPDH-F: cctcgtcccgtagacaaaatg, SEQ ID NO.3; GAPDH-R: tgaggtcaatgaaggggtcgt, SEQ ID NO.4;

[0090] TNF-α-F: ccctcacactcacaaaccacc, SEQ ID NO.5; TNF-α-R: ctttgagatccatgccgttg, SEQ ID NO.6

[0091] IL-6-F: catagctacctggagtacatgaagaa, SEQ ID NO.7; IL-6-R: gactccagcttatctcttggttga, SEQ ID NO.8

[0092] Colla1-F: gagaggtgaacaaggtcccg, SEQ ID NO.9; Colla1-R: aaacctctctcgcctcttgc, SEQ ID NO.10

[0093] Col3a1-F: tttcttctcacccttcttcatcc, SEQ ID NO.11; Col3a1-R: catatttgacatggttctggcttc, SEQ ID NO.12

[0094] VEGF-F: aggagtaccccgacgagataga, SEQ ID NO.13; VEGF-R: cacatctgctgtgctgtaggaa, SEQ ID NO.14

[0095] AKP-F: gagatggacaagttcccttacg, SEQ ID NO. 15; AKP-R: tcgtggtggtcacaatgc, SEQ ID NO. 16.

[0096] 2) Results

[0097] like Figure 8 As shown, the relative expression of TNF-α in mice of test groups 1 and 2 was not significantly different from that of the blank group at week 1 (ns), and the relative expression of TNF-α in mice of test groups 3, 4 and 5 was significantly higher than that of the blank group at week 1 (*, p<0.05; **, p<0.01). The relative expression of TNF-α in mice of test groups 1 and 2 was not significantly different from that of the blank group at week 4 (ns), and the relative expression of TNF-α in mice of test groups 3, 4 and 5 was significantly higher than that of the blank group at week 4 (*, p<0.05; **, p<0.01). The relative expression of TNF-α in mice of test groups 1 and 2 was not significantly different from that of the blank group at week 16 (ns), and the relative expression of TNF-α in mice of test groups 3, 4 and 5 was significantly higher than that of the blank group at week 16 (*, p<0.05; **, p<0.01).

[0098] like Fig. 9 As shown, the relative expression of IL-6 in test groups 1 and 2 was not significantly different from that in the blank group at week 1 (ns), and the relative expression of IL-6 in test groups 3, 4 and 5 was significantly higher than that in the blank group at week 1 (*, p<0.05; **, p<0.01). The relative expression of IL-6 in test groups 1 and 2 was not significantly different from that in the blank group at week 4 (ns), and the relative expression of IL-6 in test groups 3, 4 and 5 was significantly higher than that in the blank group at week 4 (*, p<0.05; **, p<0.01). The relative expression of IL-6 in test groups 1 and 2 was not significantly different from that in the blank group at week 16 (ns), and the relative expression of IL-6 in test groups 3, 4 and 5 was significantly higher than that in the blank group at week 16 (*, p<0.05; **, p<0.01).

[0099] This shows that although the expression levels of TNF-α and IL-6 in each group of mice increased within one week after transplantation, resulting in a significant inflammatory response, the expression levels of TNF-α and IL-6 in the mice in test groups 1 and 2 gradually decreased 16 weeks after injection and were always no significantly different from the blank group, indicating that the hydrogels in test groups 1 and 2 as fillers or transplants would not produce significant inflammatory responses in mice.

[0100] like Fig.10As shown, the relative expression of type I collagen in test group 2 was significantly higher than that in the blank group at week 1 (*, p<0.05), and there was no significant difference between the relative expression of type I collagen in test groups 1, 3, 4 and 5 and the blank group at week 1 (ns). The relative expression of type I collagen in test groups 1, 2, 3 and 4 was significantly higher than that in the blank group at week 4 (*, p<0.05; **, p<0.01), and there was no significant difference between the relative expression of type I collagen in test group 5 and the blank group at week 4 (ns). The relative expression of type I collagen in test groups 1 to 5 was significantly higher than that in the blank group at week 16 (*, p<0.05; **, p<0.01).

[0101] like Fig.11 As shown, the relative expression of type III collagen in test group 2 was significantly higher than that in the blank group at week 1 (*, p<0.05), and the relative expression of type III collagen in test groups 1, 3, 4 and 5 was not significantly different from that in the blank group at week 1 (ns). The relative expression of type III collagen in test groups 1 and 2 was significantly higher than that in the blank group at week 4 (**, p<0.01), and the relative expression of type III collagen in test groups 3, 4 and 5 was not significantly different from that in the blank group at week 4 (ns). The relative expression of type III collagen in test groups 1 to 4 was significantly higher than that in the blank group at week 16 (*, p<0.05; **, p<0.01), and the relative expression of type III collagen in test groups 1 and 5 was not significantly different from that in the blank group at week 16 (ns).

[0102] This shows that after 1 week of injection of hydrogels in each group of mice, only the relative expression of type I collagen and type III collagen in test group 2 mice increased. In addition, although the relative expression of type I collagen and type III collagen in each group of mice increased to varying degrees at the 16th week of injection, the relative expression of type I collagen and type III collagen in test groups 1 and 2 mice increased significantly. This shows that the hydrogels used as fillers or transplants in test groups 1 and 2 can promote collagen expression in mice.

[0103] like Fig.12 As shown, the relative expression of VEGF in mice of test groups 1 to 5 was not significantly different from that in the blank group at week 1 (ns). The relative expression of VEGF in mice of test groups 1 and 2 was significantly higher than that in the blank group at week 4 (*, p<0.05), and the relative expression of VEGF in mice of test groups 3, 4 and 5 was not significantly different from that in the blank group at week 4 (ns). The relative expression of VEGF in mice of test groups 1 and 2 was significantly higher than that in the blank group at week 16 (**, p<0.01), and the relative expression of VEGF in mice of test groups 3, 4 and 5 was not significantly different from that in the blank group at week 16 (ns). VEGF is a vascular endothelial growth factor, which is essential for angiogenesis. It can specifically act on vascular endothelial cells, promote mitosis and cell migration, and increase vascular permeability. Fig.12 The results showed that the hydrogels in test groups 1 and 2 as fillers or grafts were able to promote VEGF expression and angiogenesis in mice.

[0104] like Fig.13 As shown, the relative expression of AKP in test groups 1 to 5 was not significantly different from that in the blank group at week 1 (ns). The relative expression of AKP in test groups 1 to 5 was not significantly different from that in the blank group at week 4 (ns). The relative expression of AKP in test groups 1 and 2 was significantly higher than that in the blank group at week 16 (*, p<0.05), and the relative expression of AKP in test groups 3, 4 and 5 was not significantly different from that in the blank group at week 16 (ns). AKP (alkaline phosphatase) is a specific marker for bone cell synthesis, and its expression level or whether it is expressed often determines whether it has the markers for bone formation. Fig.13 As shown, the hydrogels of test groups 1 and 2 as test products as fillers or transplants can promote AKP expression in mice and promote bone cell formation.

[0105] In summary, a recombinant type I human collagen with a high content of isopeptide is obtained by the method provided by the present invention. By preparing a composite hydrogel with this high content of isopeptide and nanocellulose, it has a high stability, low swelling, high weight retention rate, and strong adhesion and hemostasis, and has the potential to be used as a skin tissue repair material. And this composite hydrogel can be used to repair burned skin, significantly reduce the inflammatory response of burned skin, and promote wound healing. In addition, this composite hydrogel can also be used as a filler or inhibitor filled in mice, has a lower inflammatory response, and can promote collagen synthesis in mice, and promotes angiogenesis and bone cell generation in the long term, thereby promoting tissue regeneration, providing a technical basis for it as a medical beauty filling material.

[0106] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. A method for preparing recombinant human type I collagen, characterized in that: include: A solution of human type I procollagen amino terminal peptide and a solution of cross-linked peptide of the same concentration are prepared, wherein the human type I procollagen amino terminal peptide is as shown in SEQ ID NO.1, and the cross-linked peptide is as shown in SEQ ID NO.2; Mixing the solution of the human type I procollagen amino terminal peptide and the solution of the cross-linked peptide in a volume ratio of (1-2):(1-4); Add glutaminase 5-40 U / g protein; After thorough mixing, place at 50℃ for 0.5~6 h; After the reaction, the sample was taken out, placed in a boiling water bath to inactivate the enzyme, and cooled to room temperature; The solution pH was adjusted to 4.6 to precipitate the modified product and remove the unmixed cross-linked peptides, and the mixture was centrifuged at 10,000 × g for 15 min, and the supernatant was discarded; The precipitate was washed with water at pH 4.6, and the obtained precipitate was recombinant type I human collagen.

2. The preparation method according to claim 1, characterized in that: The solution of the human type I procollagen amino terminal peptide is mixed with the solution of the cross-linked peptide in a volume ratio of 1:1, 1:2, 1:3, 1:4 or 2:

1.

3. The preparation method according to claim 1, characterized in that: The added amount of the glutaminase is 5 U / g, 10 U / g, 20 U / g, 30 U / g or 40 U / g protein.

4. The preparation method according to claim 1, characterized in that: The reaction time is 0.5h, 1h, 2h, 4h or 6h.

5. A method for preparing a composite hydrogel, characterized in that: include: In an ice bath at 0 °C, an ionic liquid containing 50 g / L 1,5-diazabicyclo[4.3.0]-5-nonene and 50 g / L levulinic acid was prepared; Under mechanical stirring in an oil bath at 100° C., nanocellulose and recombinant human type I collagen prepared by the preparation method of claim 1 are simultaneously added to the ionic liquid, and the mixture is rapidly stirred to fully dissolve; The reactants were placed in a culture dish, left to stand at room temperature for 1 day, and then washed repeatedly with anhydrous ethanol.

6. The preparation method according to claim 5, characterized in that: The final concentration of the nanocellulose is 1.25 g / L, and the final concentration of the recombinant type I human collagen is 1.25 g / L.

7. The preparation method according to claim 5, characterized in that: The diameter of the nanocellulose is 4-10 nm and the length is 200 nm.

8. Recombinant human type I collagen obtained by the method according to claim 1.

9. Use of the recombinant human type I collagen obtained by the method according to claim 1 in preparing skin tissue repair materials.

10. Use of the recombinant human type I collagen prepared by the method according to claim 1 in preparing biological filling materials.

Images