A strain of Bacillus amyloliquefaciens BZWQ833, a bacterial agent and its application

Abstract

The present invention relates to the field of microorganisms, and particularly to a Bacillus amyloliquefaciens BZWQ833, a microbial agent and its application. A Bacillus amyloliquefaciens was screened from the rhizosphere soil of a potato common scab field with continuous cropping for many years, named Bacillus amyloliquefaciens BZWQ833 and subjected to biological preservation. This bacterium is a Gram-positive bacterium that can produce spores and can produce protease, cellulase and pectinase. The present invention first discovers that Bacillus amyloliquefaciens BZWQ833 can inhibit the growth and incidence of Streptomyces scabies, Rhizoctonia solani, Fusarium oxysporum and Fusarium solani, and the antibacterial effect is stable. Moreover, through greenhouse pot experiments and field control experiments, it is verified that Bacillus amyloliquefaciens BZWQ833 has a significant control effect on various plant soil-borne diseases (common scab, powdery scab and fruit rot), providing a new biological control resource for the biological control of plant soil-borne diseases.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and particularly to a Bacillus amyloliquefaciens BZWQ833, a bacterial agent and their applications. Background Art

[0002] At present, soil-borne diseases have become one of the important factors affecting plant production and quality. Soil-borne diseases refer to diseases caused by pathogens such as fungi, bacteria, nematodes and viruses overwintering in the soil or plant residues and infecting the roots or stems of plants under suitable conditions. Due to the characteristics of concealment, lag, accumulation and destructiveness of the occurrence of soil-borne diseases, they are generally difficult to detect in the early stage, and a large number of them occur only after one or several years, and the prevention and control are relatively difficult, which will cause devastating harm to plants. At present, the commonly used prevention and control measures are chemical agent control. However, using chemical agents to prevent and control soil-borne diseases will cause a series of adverse consequences such as soil pollution, pesticide residues, drug resistance and ecological balance destruction.

[0003] At present stage, using beneficial microorganisms for biological control of plant diseases is a research hotspot and also a development trend. Because of its strong stress resistance and extracellular activity and other biological characteristics, Bacillus has been widely used in industrial and agricultural production, especially becoming more prominent in the biological control of plant diseases.

[0004] Bacillus is a common Gram-positive bacterium that is strictly aerobic or facultatively anaerobic in the microbial environment. Its sources are extensive, including being able to be isolated from air, water, the intestines of humans and animals, or from the soil near the roots of plants, the root surface, and the surfaces of plant stems and leaves. At present, many Bacillus strains with biocontrol effects have been reported, including Bacillus subtilis and Bacillus velezensis, etc. Bacillus subtilis has characteristics such as a broad antibacterial spectrum and strong adaptability. It can successfully colonize the rhizosphere, surface or inside of plants, compete with pathogenic microorganisms for nutrients around the plants, and can secrete some antibacterial substances to inhibit the growth of surrounding pathogenic bacteria; at the same time, it can induce systemic resistance of plants and improve the resistance of plants, so as to achieve the purpose of resisting the invasion of pathogenic microorganisms. Bacillus velezensis is a newly discovered Bacillus genus bacterium in recent years. It is widely distributed in nature, harmless to humans and animals, pollution-free to the environment, has good antibacterial activity, has inhibitory effects on many pathogenic microorganisms, and has the effects of promoting plant growth and inducing systemic disease resistance. Many Bacillus velezensis strains play an important role in biological control and as grain yield increasing agents. At present, although Bacillus has been widely used in the prevention and control of various plant diseases in biological control, such as bacterial wilt, root rot, phytophthora blight, anthracnose, gray mold and nematode diseases of plants, etc. However, the control effect is still not good, and the controlled pathogenic bacteria are single. Summary of the Invention

[0005] The object of the present invention is to provide a Bacillus amyloliquefaciens BZWQ833, a microbial agent and its application, so as to solve the problems existing in the above-mentioned prior art. The strain - Bacillus amyloliquefaciens BZWQ833 provided by the present invention has good control effect and has control effects on a variety of pathogenic bacteria, showing broad-spectrum property.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a Bacillus amyloliquefaciens BZWQ833, and the preservation number of the Bacillus amyloliquefaciens BZWQ833 is CGMCC No. 30576.

[0008] The present invention provides the application of the above-mentioned Bacillus amyloliquefaciens BZWQ833 in the preparation of a microbial agent for promoting plant growth and controlling soil-borne diseases.

[0009] Preferably, the soil-borne diseases include scab, powdery scab and fruit rot;

[0010] The plants include potato, peanut, cucumber, radish, Chinese cabbage, tomato, pea or wheat.

[0011] The present invention provides a microbial agent for promoting plant growth and controlling soil-borne diseases, and the active ingredient of the microbial agent includes the above-mentioned Bacillus amyloliquefaciens BZWQ833.

[0012] Preferably, the soil-borne diseases include scab, powdery scab and fruit rot;

[0013] The plants include potato, peanut, cucumber, radish, Chinese cabbage, tomato, pea or wheat.

[0014] The present invention provides a preparation method of the above-mentioned microbial agent, including the following steps:

[0015] Inoculate the Bacillus amyloliquefaciens BZWQ833 into a fermentation medium, and perform fermentation culture to obtain the microbial agent.

[0016] Preferably, the fermentation medium includes components with the following concentrations: 1 wt.% peanut cake powder, 2 wt.% soybean powder, 1 wt.% wheat bran powder, 1.5 wt.% glucose, 0.5 wt.% ammonium sulfate, 0.5 wt.% magnesium sulfate, 0.5 wt.% sodium chloride, 0.1 wt.% calcium carbonate, 0.1 wt.% potassium nitrate, 0.1 wt.% sodium glutamate and the balance of water.

[0017] Preferably, the fermentation culture time is 18 - 192 h.

[0018] The present invention provides the application of the above-mentioned Bacillus amyloliquefaciens BZWQ833 or the above-mentioned microbial agent in preventing and controlling soil-borne diseases.

[0019] Preferably, the soil-borne diseases include scab, powdery scab and fruit rot.

[0020] The plants include potato, peanut, cucumber, radish, Chinese cabbage, tomato, pea or wheat.

[0021] The present invention discloses the following technical effects:

[0022] In the rhizosphere soil of a potato scab field with continuous cropping for many years, a strain of Bacillus amyloliquefaciens was screened out, named Bacillus amyloliquefaciens BZWQ833 and subjected to biological preservation. This bacterium is a Gram-positive bacterium, capable of producing spores, and can produce protease, cellulase and pectinase. The present invention first discovered that Bacillus amyloliquefaciens BZWQ833 can inhibit the growth and pathogenesis of Streptomyces scabies, Rhizoctonia solani, Fusarium oxysporum and Fusarium solani, and the antibacterial effect is stable. Moreover, through greenhouse pot experiments and field control experiments, it was verified that Bacillus amyloliquefaciens BZWQ833 has significant control effects on various plant soil-borne diseases (scab, powdery scab and fruit rot) and promotes plant growth, providing a new biological control resource for the biological control of plant soil-borne diseases and promoting plant growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0024] Figure 1 It is the colony morphology diagram of Bacillus amyloliquefaciens BZWQ833;

[0025] Figure 2 It is the Gram staining diagram of Bacillus amyloliquefaciens BZWQ833; among them, A is the Gram staining diagram of strain BZWQ833; B is the Gram staining diagram of Escherichia coli;

[0026] Figure 3 Partial physiological and biochemical function test results of strain BZWQ833; among them, A is the test result of protease production ability; B is the test result of cellulase production ability; C is the test result of amylase production ability; D is the test result of inorganic phosphorus solubilization ability; E is the test result of siderophore production ability; F is the test result of pectinase production ability;

[0027] Figure 4Phylogenetic tree of strain BZWQ833 constructed based on 16S rRNA, purH gene, and rpoB gene;

[0028] Figure 5 Antibacterial effects of Bacillus amyloliquefaciens BZWQ833 against 6 kinds of pathogenic bacteria; among them, A is the inhibitory effect of Bacillus amyloliquefaciens BZWQ833 on Streptomyces scabies MZ-4; B is the inhibitory effect of Bacillus amyloliquefaciens BZWQ833 on Rhizoctonia solani AG-3 RS-5; C is the inhibitory effect of Bacillus amyloliquefaciens BZWQ833 on Alternaria solani AS-8; D is the inhibitory effect of Bacillus amyloliquefaciens BZWQ833 on Fusarium oxysporum f. sp. solani FS-1; E is the inhibitory effect of Bacillus amyloliquefaciens BZWQ833 on Aspergillus tubingensis GF-1 (the causative agent of peanut fruit rot); F is the inhibitory effect of Bacillus amyloliquefaciens BZWQ833 on Fusarium oxysporum GF-2 (the causative agent of peanut fruit rot);

[0029] Figure 6 Growth promotion effects of the fermentation broth of Bacillus amyloliquefaciens BZWQ833 on plants; among them, A is the growth promotion effect on cucumber seedlings 10 days after treatment; B is the growth promotion effect on pea seedlings 10 days after treatment; on the left side of A and B are the plants treated with the fermentation broth of Bacillus amyloliquefaciens BZWQ833, and on the right side are the plants treated with the control;

[0030] Figure 7 Control test results of the agent of Bacillus amyloliquefaciens BZWQ833 against potato common scab; among them, A is conventional management; B is treatment with the agent of Bacillus amyloliquefaciens BZWQ833; C is the growth vigor of plants under conventional management in the middle growth stage; D is the growth vigor of plants after treatment in the middle growth stage;

[0031] Figure 8 Control test results of the agent of Bacillus amyloliquefaciens BZWQ833 against potato powdery scab; among them, A is conventional management; B is treatment with the agent of Bacillus amyloliquefaciens BZWQ833;

[0032] Figure 9 Control test results of the agent of Bacillus amyloliquefaciens BZWQ833 against peanut fruit rot; among them, on the left side of the picture is the treatment group, that is, treatment with the agent of Bacillus amyloliquefaciens BZWQ833; on the right side of the picture is the control group, that is, conventional management; the meanings from top to bottom on the white paper in the middle of the picture are grade 0, grade 1, grade 2, grade 3, and grade 4.

[0033] Biological deposit certificate:

[0034] Bacillus amyloliquefaciens BZWQ833 was deposited with the China General Microbiological Culture Collection Center (CGMCC) on May 10, 2024. The address of the depository is No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; the postal code is 100101, and the deposit number is CGMCC NO. 30576. Detailed Embodiments

[0035] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0036] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0037] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0038] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are merely exemplary.

[0039] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0040] Example 1 Isolation, Screening and Identification of Bacillus amyloliquefaciens BZWQ833

[0041] 1. Isolation and Screening of Strain BZWQ833

[0042] Soil samples were taken from around the roots of diseased plants in a potato scab disease field with continuous cropping for many years and put through a 200-mesh sieve. The soil was sifted into a PDA petri dish coated with the potato scab pathogen Streptomyces scabies CPS-1 and cultured in an incubator at 30 °C for 48 h. The central colonies showing an inhibition zone were picked, purified by streaking, preserved on a PDA slant, cultured for 24 h, and then stored in a refrigerator at 4 °C for later use.

[0043] After the isolated bacteria were propagated in LB liquid medium, 5 μL of each was evenly inoculated onto filter paper on a culture medium plate coated with different soil-borne pathogens and cultured at 28 °C for 72 h. Each treatment was replicated 3 times, and the strains with antibacterial effects against different soil-borne pathogens were selected and designated as strain BZWQ833.

[0044] 2. Identification of Strain BZWQ833

[0045] 2.1 Morphological Observation of Strain BZWQ833

[0046] Strain BZWQ833 was streaked onto a PDA culture medium plate, and then the plate was inverted and cultured at 30 °C for 24 h. The growth of the colonies was observed and recorded. The colony morphology on the plate was as Figure 1 shown. The colony morphology was circular, with a circular raised middle part. The color was milky white and opaque in the early stage and turned yellowish brown in the later stage.

[0047] The strain BZWQ833 was Gram-stained using a kit, and the strain was observed and photographed under a 400-fold microscope. The Gram-staining of this strain was as Figure 2 shown. As can be seen from Figure 2 A in it, after Gram-staining, strain BZWQ833 was rod-shaped and showed a blue-violet color, being a Gram-positive bacterium; while as can be seen from Figure 2 B in it, the staining result of Escherichia coli was purple-red, being a Gram-negative bacterium.

[0048] 2.2 Physiological and Biochemical Functional Determination of Strain BZWQ833

[0049] Inorganic phosphorus medium: Glucose 10.0 g, (NH4)2SO4 0.5 g, MgSO4·7H2O 0.3 g, NaC1 0.3 g, KCl 0.3 g, FeSO4·7H2O 0.03 g, MnSO4·7H2O 0.03 g, Ca3(PO4)2 5.0 g, agar 17.0 g. Add distilled water to make up to 1.0 L, control the pH between 7.0 - 7.4, and autoclave at 121 °C for 20 min.

[0050] Nitrogen-fixing medium: 0.2 g of KH2PO4, 0.2 g of MnSO4, 0.2 g of NaCl, 5.0 g of CaCO3, 10.0 g of mannitol, 0.1 g of CaSO4, 18.0 g of agar, made up to 1.0 L with distilled water, pH 7.0, autoclaved at 121 °C for 30 min.

[0051] Potassium-solubilizing medium: 2.0 g of Na2HPO4, 0.005 g of FeCl3, 0.5 g of MgSO4·7H2O, 0.1 g of CaCO3, 5.0 g of sucrose, 1.0 g of potassium feldspar powder (washed 5 times with deionized water), 0.1 g of bromothymol blue, 20.0 g of agar, made up to 1.0 L with distilled water, pH 7.0, autoclaved at 121 °C for 20 min.

[0052] Chitinase medium: 1.5 g of NaCl, 0.3 g of KH2PO4, 0.7 g of K2HPO4, 0.02 g of FeSO4·7H2O, 0.5 g of MgSO4, 20.0 g of agar, 250 mL of 2% chitin colloid, made up to 1.0 L with distilled water, pH 7.0, autoclaved at 121 °C for 20 min.

[0053] Protease medium: 15.0 g of skim milk powder, 15.0 g of agar, made up to 1.0 L with distilled water, natural pH, autoclaved at 110 °C for 15 min.

[0054] Starch hydrolase medium: 2.0 g of soluble starch, 3.0 g of beef extract, 5.0 g of peptone, 2.5 g of glucose, 18.0 g of agar, made up to 1.0 L with distilled water, pH 7.0, autoclaved at 121 °C for 20 min.

[0055] IAA medium: Add 0.1 g of L-tryptophan to LB medium, autoclaved at 121 °C for 20 min.

[0056] Cellulase medium: 10.0 g of peptone, 10.0 g of carboxymethyl cellulose sodium (CMC-Na), 5.0 g of yeast powder, 5.0 g of NaCl, 0.2 g of MgSO4, 1.0 g of KH2PO4, 20.0 g of agar, made up to 1.0 L with distilled water, autoclaved at 115 °C for 30 min.

[0057] Pectinase medium: 0.5 g of MgSO4·7H2O, 1.0 g of KH2PO4·3H2O, 0.01 g of FeSO4·7H2O, 2.0 g of pectin, 0.2 g of congo red, 20.0 g of agar, made up to 1.0 L with distilled water, natural pH, autoclaved at 121 °C for 20 min.

[0058] Laccase medium: Add 0.04% guaiacol to LB medium and autoclave at 121 °C for 20 min.

[0059] Siderophore medium (CAS): 0.0605 g of CAS, 0.0729 g of HDTMA, 0.002645 g of FeCl3·6H2O, 0.29525 g of NaH2PO4·2H2O, 1.2135 g of Na2HPO4·12H2O, 0.125 g of NH4Cl, 0.0375 g of KH2PO4, 0.0625 g of NaCl, 9.0 g of agar. Add distilled water to make up to 1.0 L and autoclave at 116 °C for 30 min. Purchased from Haibo Biotech Co., Ltd.

[0060] Salkowski color reagent: 15 mL of 0.5 mol / L FeCl3 solution, 300 mL of H2SO4, 500 mL of distilled water. Mix well before use and store in the dark.

[0061] Colloidal chitin: Slowly pour 300 mL of pre-cooled concentrated hydrochloric acid into a beaker containing 20.0 g of chitin powder, add 100 mL of distilled water, stir with a glass rod to form a paste, place in a 4 °C refrigerator for 24 h to swell, and then add distilled water to stir evenly. Centrifuge at 5000 r / min for 10 min, discard the supernatant, wash the precipitate with water repeatedly until neutral, and add distilled water to make up to 1.0 L.

[0062] Inoculate strain BZWQ833 onto protease, pectinase, cellulase, chitinase, and laccase media respectively, and culture in a constant temperature incubator at 28 °C for 4 d.

[0063] Observe whether there is a clear zone around the strain on protease, pectinase, and chitinase media. If there is a clear zone, it indicates that the strain has the corresponding antibiotic properties; otherwise, it does not.

[0064] Start observing every day from the 2nd day whether there is a red-brown oxidation zone around the strain on the laccase medium. If there is an oxidation zone, it indicates that the strain can produce laccase; otherwise, it cannot.

[0065] After strain BZWQ833 is cultured on cellulase medium for 5 d, pour an appropriate amount of Congo red solution (1 mg / mL) into the medium, let it stand for 1 h to stain, then pour out the Congo red solution, wash repeatedly with distilled water, and finally soak and elute with an appropriate amount of NaCl solution (1 mol / L) for 30 min. Pour out the NaCl eluate. If there is a clear zone around the strain, it indicates that it can produce cellulase; otherwise, it cannot.

[0066] The test results are shown in Table 1 and Figure 3 as follows.

[0067] Statistical Results of Functional Tests of Strain BZWQ833 in Table 1

[0068] Related characteristics Strain BZWQ833 Produces protease + Produces cellulase + Produces pectinase + Produces chitinase - Produces laccase - Produces amylase + Produces siderophore + Produces IAA - Phosphate solubilization + Potassium solubilization - Nitrogen fixation -

[0069] Note: \"+\" indicates positive, and \"-\" indicates negative.

[0070] As can be seen from Table 1 and Figure 3 the records show that this strain produces protease, cellulase, pectinase and siderophore, and at the same time has the function of phosphorus solubilization.

[0071] 3. Multi-gene Molecular Identification by Combining 16S rRNA, purH, and rpoB Gene Sequences

[0072] Extract the DNA of strain BZWQ833 using the Bacterial Genomic DNA Extraction Kit of Tiangen Biochemical Technology Co., Ltd. Perform PCR amplification using the bacterial primers 27F / 1492R, purH-70F / purH-1013R, and rpoB-F / rpoB-R. The primer sequences are shown in Table 2. The PCR products are detected by electrophoresis using 1% agarose gel electrophoresis and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. After sequencing is completed, the obtained sequences are submitted to the GenBank nucleic acid database for BLAST alignment. Select the strain sequences with higher similarity for analysis, and construct a phylogenetic tree for different genes of strain BZWQ833 using the neighbor-joining method in Mega 5.0 software.

[0073] Table 2 Sequencing Primers for Molecular Biology Identification

[0074]

[0075] The obtained PCR products were sequenced by Tianjin Qingke Biotechnology Co., Ltd. The nucleotide sequences of different genes of strain BZWQ833 are as follows:

[0076]

[0077] The nucleotide sequence of the purH gene is shown in SEQ ID NO.8, specifically: AGTCATTTCGACCGGAGGAACAAAAAAACTTCTTCAGGAAAACGGTGTGGATGTCATCGGCATTTCAGAAGTGACCGGATTTCCTGAAATTATGGACGGACGGTTAAAAACGCTCCATCCTAATATTCACGGCGGACTGCTTGCCGTAAGAGACAATGAAGAGCATATGGCGCAGATCAATGAGCATGGCATTGCCCCCATTGACCTTGTGGTCGTCAACCTTTACCCGTTTAAAGAAACGATTTCGAAAGAAGACGTAACATACGATGAAGCGATAGAAAACATTGATATCGGCGGTCCCGGCATGCTGCGCGCCGCATCGAAAAACCATCAGGATGTGACGGTCATCACAGATCCGGCCGATTACAGCTCCGTGCTCAATGAGATGAAAGAACACGGCGGCGTTTCGCTTAAAAGAAAACGCGAGCTTGCGGCCAAAGTATTCCGCCATACCGCGGCATACGACGCATTAATCGCTGATTACTTAACACGCGAGGCCGGTGAGAAAGACCCTGAGCAATTCACCGTTACATTTGAGAAAAAACAATCGCTCCGCTATGGTGAAAACCCTCACCAAGAGGCTGTTTTCTATCAAAGCGCACTTCCCGTCTCCGGTTCCATCGCGGCGGCAAAACAGCTTCACGGCAAAGAGCTTTCTTACAACAATATTAAGGACGCAGATGCGGCCGTTCAAATCGTCCGGGAATTTACAGAACCCGCAGCTGTTGCCGTTAAACATATGAACCCGTGCGGAGTCGGTACGGGAGCTTCAATTGAGGAAGCATTCAATAAAGCGTATGAAGCTGATAAAACCTCCATTTTCGGCGGCATCATCGCGCTGAACCGTGAAGTTGATCAGGCAACGGCTGAAGCCCTTCACGGCATCTTTTTAGAAATCATTATCGCCCCT;

[0078] The nucleotide sequence of the rpoB gene is shown in SEQ ID NO.9, specifically: ATTCCGTATCGGTTTAAGCCGGATGGAACGTGTCGTACGTGAAAGAATGTCTATTCAAGACACAAATACAATTACGCCGCAGCAGCTGATTAACATCAGACCTGTTATTGCGTCTATTAAAGAGTTCTTCGGAAGCTCACAGCTTTCTCAATTCATGGATCAGACGAACCCGCTTGCTGAATTGACGCACAAACGCCGTCTGTCAGCTCTCGGACCGGGCGGTTTGACACGTGAGCGTGCAGGTATGGAAGTACGTGACGTTCACTACTCTCACTATGGCCGTATGTGTCCGATTGAAACGCCTGAGGGCCCGAACATCGGTTTGATCAACTCATTGTCATCATTTGCGAAAGTAAACCGCTTTGGTTTCATTGAGACGCCATACCGCCGCGTTGATCCTGAAACAGGAAAAGTAACGCCTAGAATCGACTACCTGACTGCTGATGAAGAGGATAACTATGTCGTAGCCCAAGCGAATGCTAAGCTGAGCGATGACGGTTCTTTCTTGGATGACAGCATCGTAGCGCGTTTCAGAGGGGAAAACACCGTTGTAGCCCGCAACCGCGTGGATTACATGGACGTATCTCCTAAACAGGTTGTATCTGCTGCGACAGCATGTATTCCGTTCTTGGAAAACGATGACTCGAACCGCGCCCTCATGGGAGCGAACATGCAGCGTCAGGCTGTGCCTTTGATGCAGCCGGAAGCTCCGATCGTCGGAACGGGTATGGAATACGTATCCGGTAAAGACTCCGGTGCAGCCGTTATTTGTAAACACCCTGGTATCGTTGAACGGGTGGAAGCGAAAAACGTATGGGTGCGCCGCTATGAAGAAATTGACGGCCAAAAAGTAAAAGGCAACCTGGATAAGTACAGCTTGCTGAAATTTGTCCGCTCCAACCAAGGTACGTGCTACAACCAGCGTCCGATCGTCAGTGTCGGCGATGAAGTAGTCAAAGGAGAAATCCTTGCTGACGGACCTTCAATGGAGCTTGGTGAACTTGCTCTCGGCCGCAACGTAATGGTCGGCTTCATGACATGGGATGGTTACAACTATGAGGATGCCATCATCATGAGTGAACGCCTTGTGAAAGATGATGTATACACATCTATTCACATTGAAGAATATGAATCAGAAGCACGTGATACAAAGCTTGGGCCGGAAGAGATCACCCGCGATATTCCAAACGTAGGGGAAGACGCGCTTCGCAATCTTGATGACCGCGGAATTATCCGTATCGGTGCGGAAGTCAACGACGGAGACCTTCTCGTAGGTAAAGTAACGCCTAAAGGTGTAACTGAGCTTACGGCTGAAGAACGCCTTCTTCATGCGATCTTTGGAGAAAAAGCGCGTGAATTCCAGT。

[0079] The obtained nucleotide sequence was subjected to BLAST homology sequence alignment analysis through the NCBI database to obtain sequences with relatively high similarity. The phylogenetic tree was constructed using MEGA6.0 software ( Figure 4 ), and the homology of the 16S rDNA sequence of the strain prepared in this example with the 16S rRNA, purH gene, and rpoB gene of Bacillus amyloliquefaciens reached 99.93%, 99.89%, and 99.78%, respectively.

[0080] Based on the above results of morphological observation, physiological and biochemical characteristics, and multi-gene sequence identification, it was possible to determine that the strain screened in this example was Bacillus amyloliquefaciens, which was named Bacillus amyloliquefaciens BZWQ833.

[0081] The Bacillus amyloliquefaciens BZWQ833 screened in the embodiments of the present invention was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms (abbreviation: CGMCC, address of the depository unit: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; postal code: 100101) on May 10, 2024, and the deposit number is CGMCC No. 30576.

[0082] Example 2 In-vitro antibacterial test of Bacillus amyloliquefaciens BZWQ833 against soil-borne pathogens

[0083] Tested pathogens: Streptomyces scabies CPS-1 (abbreviation: CPS-1), Alternaria solani AS-8 (abbreviation: AS-8), Rhizoctonia solani RS-5 (abbreviation: RS-5), Fusarium solani FS-1 (abbreviation: FS-1), Neocosmospora vasinfecta GF-1 (abbreviation: GF-1), Fusarium oxysporum GF-2 (abbreviation: GF-2).

[0084] The plate confrontation method was used for detection. Taking each soil-borne pathogen as the indicator bacterium, the antibacterial activity of Bacillus amyloliquefaciens BZWQ833 was tested. The specific steps were as follows: Use a punch with a diameter of 6 mm to punch out bacterial cakes on the pathogen plate, invert and inoculate the bacterial cakes in the center of the PDA medium, and incubate them in an inverted position in a constant temperature incubator at 28 °C for 2 d. When the diameter of the pathogen was about 2 cm, inoculate Bacillus amyloliquefaciens BZWQ833. Use sterile forceps to pick up a filter paper with a diameter of 6 mm and place it 2 cm away from the edge of the pathogen. Each PDA plate was inoculated at 4 points. Use a micropipette to aspirate 2 μL of the bacterial suspension of Bacillus amyloliquefaciens BZWQ833 (the effective viable count was 3.40×10 8 CFU / mL) and add it to the filter paper. Use the plate without inoculating Bacillus amyloliquefaciens BZWQ833 as the control, with three replicates. Place the petri dishes in an incubator at 28 °C and incubate for 4 d. Measure the radii of the pathogens in the control group and the treatment group (the distance from the edge of the pathogen at the time of inoculation to the edge of the colony at the time of measurement), calculate the antibacterial rate, and measure the width of the antibacterial zone. The calculation formula for the antibacterial rate is as follows:

[0085] Antibacterial rate (%) = (radius of the control pathogen - radius of the pathogen in the confrontation group) / radius of the control pathogen × 100.

[0086] The antibacterial test results are shown in Table 3 and Figure 5 as follows. Bacillus amyloliquefaciens BZWQ833 has good antibacterial activity against the 6 tested soil-borne pathogens. Obvious antibacterial zones can be formed against each tested soil-borne pathogen, and the growth of the pathogens can be significantly inhibited, with the highest inhibition rate being 84.6%. Thus, it can be seen that Bacillus amyloliquefaciens BZWQ833 has good antibacterial activity against different soil-borne pathogens.

[0087] Table 3 Antibacterial test results of strain BZWQ833 against 6 soil-borne pathogens

[0088]

[0089] Example 3 Preparation of Bacillus amyloliquefaciens BZWQ833 bactericide

[0090] 1. Preparation of Bacillus amyloliquefaciens BZWQ833 liquid bactericide

[0091] Inoculate Bacillus amyloliquefaciens BZWQ833 into LB medium and activate it at 28 °C for 48 h. Use a 500 mL Erlenmeyer flask to expand the activated strain to obtain a fermentation seed liquid; inoculate the seed liquid into medium No. 8 at an inoculation amount of 5%, and perform continuous fermentation using a 500 mL shaking flask and a 50 L fermenter. The fermentation time is 19 - 22 h, and samples are taken in a timely manner after each fermentation is completed. Use the plate dilution method for gradient dilution counting to detect the bacterial count of the fermentation broth.

[0092] The liquid volume in the 500 mL shaking flask is 50 mL, the initial inoculation amount is 5%, the shaking speed is 200 r / min, the culture temperature is 37 °C, and the culture time is 18 h to obtain Bacillus amyloliquefaciens BZWQ833 liquid bactericide, with the effective viable count being 3.40×10 8 CFU / mL.

[0093] The liquid volume in the 50 L fermenter is 30 L, the initial inoculation amount is 5%, the rotation speed is 200 r / min, the culture temperature is 31 °C, and the culture time is 24 h to obtain Bacillus amyloliquefaciens BZWQ833 liquid bactericide, with the effective viable count being 1.30×10 9 CFU / mL.

[0094] The formula of medium No. 8 is as follows: 1 wt.% peanut cake powder, 2 wt.% soybean powder, 1 wt.% wheat bran powder, 1.5 wt.% glucose, 0.5 wt.% ammonium sulfate, 0.5 wt.% magnesium sulfate, 0.5 wt.% sodium chloride, 0.1 wt.% calcium carbonate, 0.1 wt.% potassium nitrate, 0.1% wt.% sodium glutamate. Make up the volume to 1000 mL with distilled water, mix well, and sterilize at 121 °C under high pressure steam for 20 min.

[0095] 2. Preparation of Bacillus amyloliquefaciens BZWQ833 Solid Bacterial Agent

[0096] The liquid fermentation broth obtained from Bacillus amyloliquefaciens BZWQ833 (the effective viable count is 3.40×10 8 CFU / mL) was inoculated into the solid fermentation substrate at an inoculation amount of 0.5 mL / g, and medium No. 8 was added according to the initial ratio of liquid to solid of 5 mL﹕1 g. Fermentation was carried out at room temperature of 25 °C for 8 d (192 h) to obtain the solid preparation of Bacillus amyloliquefaciens BZWQ833, and the viable count was 2.79×10 8 CFU / g.

[0097] The formula of the solid fermentation substrate was mushroom bran, peanut meal powder and wheat bran, and the mass ratio of mushroom bran, peanut meal powder and wheat bran was 8:1:1.

[0098] Example 4 Determination of the Safety of Bacillus amyloliquefaciens BZWQ833 to Seedlings

[0099] The liquid bacterial agent of Bacillus amyloliquefaciens BZWQ833 (3.40×10 8 CFU / mL) was used to test the safety of cucumber, Chinese cabbage, radish, pea, peanut and wheat seedlings. One week after sowing, the fermentation broth was diluted 8 times and then used for root irrigation. At the same time, water was used as a control, and the growth of different plants was observed. After 15 d of the experiment, various growth indexes of the plants were investigated and counted. The results are shown in Table 4 and Figure 6 .

[0100] Table 4 Investigation and Statistics of Growth Indexes of Vegetable Seedlings Treated with the Fermentation Broth of Bacillus amyloliquefaciens BZWQ833

[0101]

[0102] From Table 4 and Figure 6 it can be seen that the application of the fermentation broth of Bacillus amyloliquefaciens BZWQ833 has a more obvious promoting effect on the root length, plant height and leaf width of cucumber seedlings, and has an obvious promoting effect on the leaf length and leaf width of radish and Chinese cabbage seedlings, and has a promoting effect on the plant height of pea, peanut and wheat seedlings to varying degrees. At the same time, the statistical results of various indexes of the seedlings show that Bacillus amyloliquefaciens BZWQ833 is safe for different plant seedlings and has a certain growth-promoting effect.

[0103] Example 5 Control Effect of Bacillus amyloliquefaciens BZWQ833 on Potato Scab

[0104] The microbial agent made from Bacillus amyloliquefaciens BZWQ833 was applied to control potato common scab in the micro-tuber seedbed. The tested potato variety was Favorita, the sowing material was the first-generation small tubers propagated from test-tube seedlings, and the substrate used was the old vermiculite that had been used twice and had scab disease to ensure that scab disease would definitely occur. The area of each treatment in the experiment was 2.0 m 2 , with three replicates for each treatment. At the same time, a conventional management control was set up. The specific methods are as follows:

[0105] Adopt the application mode of "one solid and two liquids". Before sowing, the solid preparation of Bacillus amyloliquefaciens BZWQ833 (the viable bacteria count was 2.79×10 8 CFU / g) was thoroughly mixed with the old vermiculite at a mass ratio of 1:8, and planted according to a row spacing of 6.0 cm, a plant spacing of 5.0 cm, and a sowing depth of 8.0 cm; after emergence, when the seedling height reached 10 cm, the first liquid bacterium agent of Bacillus amyloliquefaciens BZWQ833 (the viable bacteria count was 3.40×10 8 CFU / g) was applied, and the second liquid bacterium agent of Bacillus amyloliquefaciens BZWQ833 (the viable bacteria count was 3.40×10 8 CFU / g) was applied during the tuber bulking period. The dosage for each time was 0.5 L / m 2 , and the dilution was 20 times, with conventional management as the control. During the period, tracking and observation were carried out. It was found that the plants grew vigorously in the middle stage, the leaves were darker green than the control, and the stems of the plants were thicker than the control. The results of the investigation after harvest showed that 343 tubers were harvested in the control group and 418 in the treatment group, with a 27.11% increase in production compared to the control. The disease index of the control group was 26.53, and that of the treatment group was 2.95. The control effect on potato common scab was 88.88% (Table 5, Figure 7 ).

[0106] Table 5 Statistical results of the investigation data on the control test of Bacillus amyloliquefaciens BZWQ833 bacterium agent against micro-tuber common scab

[0107]

[0108] Example 6 Control effect of Bacillus amyloliquefaciens BZWQ833 on potato powdery scab

[0109] In 2024, a potato powdery scab control test was carried out in Yichengcun, Guyuan County, Zhangjiakou City. The test plot was a potato powdery scab disease field with continuous cropping for many years. The area of each treatment was 133 m 2 , and the tested potato variety was Wotu No. 5. The specific steps were as follows:

[0110] When sowing on May 6, 2024, the solid preparation of Bacillus amyloliquefaciens BZWQ833 (the viable bacteria count was 2.79×10 8 CFU / g) was applied by ditch application, and the dosage was 0.15 kg / m2 During the growth period of the plants, the Bacillus amyloliquefaciens BZWQ833 liquid bactericide (with a viable count of 1.30×10 9 CFU / mL) was drip-irrigated twice. The first application was during the tuber formation period of the potato plants on July 25, 2024, and the second application was during the tuber bulking period on August 10, 2024. The dosage for each application was 0.2 L / m 2 , and the dilution was 20 times. Conventional management was used as the control. Before potato harvest, five-point sampling was carried out using the diagonal method to count the number of tubers at each level. The incidence rate, disease index, and control efficacy were calculated using the same method as in Example 4. The test results showed that the incidence rate of potato powdery scab in the control group of the Wotu 5 variety was 92.93%, and the disease index was 71.38. The incidence rate in the treatment group with the Bacillus amyloliquefaciens BZWQ833 bactericide was 70.76%, and the disease index was 27.97. The control efficacy of the Bacillus amyloliquefaciens BZWQ833 bactericide against potato powdery scab was 60.82% (Table 6, Figure 8 ).

[0111] Table 6 Investigation and statistics of the control test of biocontrol bactericides against potato powdery scab

[0112]

[0113] Example 7 Control efficacy of Bacillus amyloliquefaciens BZWQ833 against peanut fruit rot

[0114] The test plot was a peanut fruit rot disease field with continuous cropping for many years. The test variety was Yunnan Colorful Peanut, and the treatment area was 320 m 2 . The specific steps were as follows: During the growth period of the peanut plants, the Bacillus amyloliquefaciens BZWQ833 liquid bactericide (with a viable count of 1.30×10 9 CFU / mL) was drip-irrigated three times. The first application was during the flowering and pegging period on July 7, 2022, the second application was on July 22, 2022, with an interval of 15 days, and the third application was on August 16, 2022, with an interval of 25 days. The dosage for each application was 0.2 L / m 2 , and it was applied after dilution 20 times. Local conventional management was used as the control. Before peanut harvest, all pods in the treatment group and the control group were investigated for seed setting, and the number of pods at each level was counted. The incidence rate, disease index, and control efficacy of each treatment were calculated. The results showed that the incidence rate in the control plot was 80.91%, and the disease index was 50.26; after treatment with the Bacillus amyloliquefaciens BZWQ833 bactericide, the incidence rate was 59.53%, the disease index was 28.15, and the control efficacy was 43.98%, with a significant control efficacy. The disease fruit loss rate in the control group was 13.33%, and after treatment with the Bacillus amyloliquefaciens BZWQ833 bactericide, the disease fruit loss rate was 5.21%. The loss rate in the treatment group was significantly lower than that in the control group (Table 7, Figure 9 ).

[0115] Investigation and statistics on the control test of 7BZWQ833 bacterial agent against peanut fruit rot

[0116]

[0117] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A strain of Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens ) BZWQ833, characterized in that, The deposit number of the Bacillus amyloliquefaciens BZWQ833 is CGMCC No.30576.

2. The use of the Bacillus amyloliquefaciens BZWQ833 according to claim 1 in the preparation of a microbial preparation for promoting plant growth and preventing and controlling soil-borne diseases, characterized in that: The soil-borne diseases include potato scab, potato powdery scab and peanut fruit rot; and the plants include potato, peanut, cucumber, radish, cabbage, tomato, pea or wheat.

3. A microbial preparation for promoting plant growth and preventing and controlling soil-borne diseases, characterized in that: The active ingredients of the microbial preparation include the Bacillus amyloliquefaciens BZWQ833 described in claim 1.

4. The microbial preparation according to claim 3, characterized in that The soil-borne diseases include potato scab, potato powdery scab and peanut fruit rot; The plants include potato, peanut, cucumber, radish, cabbage, tomato, pea or wheat.

5. The method for preparing the microbial preparation according to claim 3 or 4, characterized in that: The following steps are involved: The Bacillus amyloliquefaciens BZWQ833 is inoculated into a fermentation medium for fermentation culture to obtain the microbial preparation.

6. The preparation method according to claim 5, characterized in that: The fermentation culture time is 18-192h.

7. Use of the Bacillus amyloliquefaciens BZWQ833 according to claim 1 or the microbial preparation according to claim 3 or 4 in promoting plant growth and / or preventing and controlling soil-borne diseases, characterized in that: The soil-borne diseases include potato scab, potato powdery scab and peanut fruit rot; and the plants include potato, peanut, cucumber, radish, cabbage, tomato, pea or wheat.

Images