Application of lna1 protein and related biological materials in regulating leaf number on corn ear and yield

By regulating the expression and activity of LNA1 protein, and utilizing LNA1 protein and related biological materials, the problem of controlling the number of leaves on maize ears and yield was solved, thereby increasing or decreasing maize biomass and yield to meet breeding needs.

CN119061051BActive Publication Date: 2026-06-26CHINA AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2024-10-15
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate the number of leaves on maize ears and yield, thus affecting the improvement of maize biomass and yield.

Method used

By regulating the expression or activity of the LNA1 protein, and utilizing LNA1 protein and related biological materials, including nucleic acid molecules, recombinant vectors, and recombinant microorganisms, the number of plant leaves, yield, and plant height can be controlled. The LNA1 protein gene can be knocked out or overexpressed using the CRISPR/Cas9 gene editing system.

Benefits of technology

Significantly increase or decrease the number of leaves on the corn ear and plant height, thereby increasing or decreasing corn yield and achieving efficient corn breeding improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses the application of LNA1 protein and related biological materials in regulating the number of leaves on the ear and yield of maize. The invention first involves overexpression of LNA1 protein in wild-type maize. lna1 , received lna1 Gene-modified maize and statistical analysis of its leaf number revealed that overexpression... lna1 It can increase the number of leaves on the corn ear and the total number of leaves. To further verify the function of LNA1, this invention knocked out LNA1 in wild-type corn. lna1, get lna1 Knockout corn and statistical analysis of its leaf number and plant height revealed that: lna1 It can reduce the number of leaves on the corn ear and the plant height. Furthermore, this invention has demonstrated improved efficiency by constructing NIL-Popcorn and NIL-MS71. lna1 Gene expression levels can increase maize yield. These results indicate that the LNA1 protein and related biological materials can regulate leaf number, yield, and plant height, and will play an important role in breeding high-yielding maize varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of LNA1 protein and related biomaterials in regulating the number of leaves on maize ears and yield. Background Technology

[0002] The number of leaves in maize is a crucial determinant of plant architecture, directly impacting biomass, a vital indicator for maize as a forage crop. In recent years, many scholars and breeders have focused on improving maize plant architecture and increasing planting density to enhance grain yield. An increased number of leaves signifies an expansion of the biomass source and a rise in canopy photosynthetic intensity. Therefore, identifying favorable loci controlling maize leaf number and elucidating their molecular genetic mechanisms is beneficial for practical production.

[0003] The world's population is growing faster than food production. To address this food security issue, how to increase food yields on limited arable land has become a core problem for breeders. Strategies to address this challenge include enhancing photosynthetic efficiency and increasing crop planting density. Unlike other crops, maize's monoecious, separate-flowering nature creates unique agronomic traits. Based on the position of the ear, the total leaf number (TLN) of maize consists of the number of leaves above the primary ear (LNA) and the number of leaves below the primary ear (LNB). Maize's photosynthetic efficiency mainly depends on leaf area and leaf tenderness. Leaf area is determined by both the area of ​​individual leaves and the total number of leaves, while tenderness depends primarily on the leaf development stage. Generally, maize leaves above the ear receive stronger light and are more tender, resulting in higher photosynthetic activity, while leaves below the ear tend to shade each other more and are more prone to premature senescence. Studies have shown that, as the primary source organs, the leaves above the ear contain significantly more carbohydrates than the leaves below the ear. During the grain-filling stage, the carbohydrates in maize kernels are mainly provided by the leaves above the ear, while the leaves below the ear primarily supply the nodes and underground parts. Therefore, appropriately increasing the number of leaves above the ear can increase the source capacity, i.e., the photosynthetic efficiency of the maize population in densely planted maize, thereby increasing maize yield. Summary of the Invention

[0004] One object of the present invention is to provide new uses for the LNA1 protein.

[0005] This invention provides the use of LNA1 protein in any of the following (A1)-A5):

[0006] A1) Regulating the number of plant leaves;

[0007] A2) Regulating plant yield;

[0008] A3) Regulating plant height;

[0009] A4) Cultivating transgenic plants with increased leaf number and / or increased yield and / or increased plant height;

[0010] A5) Plant breeding;

[0011] The LNA1 protein is any one of the proteins described in (a1)-(a4) below:

[0012] (a1) The protein shown in sequence 3;

[0013] (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0014] (a3) Proteins obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1) that are related to the number of plant leaves and / or yield and / or plant height.

[0015] (a4) is a protein derived from maize and has more than 98% identity with (a1) and is associated with the number of plant leaves and / or yield and / or plant height.

[0016] In the protein described in (a2) above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0017] In the protein described in (a3) ​​above, the substitution and / or deletion and / or addition of one or more amino acid residues is as follows: substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0018] In the protein described in (a4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can be obtained.

[0019] Another object of the present invention is to provide new uses for biomaterials related to the LNA1 protein.

[0020] This invention provides the use of LNA1 protein-related biomaterials in any of the following A1)-A5):

[0021] A1) Regulating the number of plant leaves;

[0022] A2) Regulating plant yield;

[0023] A3) Regulating plant height;

[0024] A4) Cultivating transgenic plants with increased leaf number and / or increased yield and / or increased plant height;

[0025] A5) Plant breeding;

[0026] The biomaterials related to the LNA1 protein are nucleic acid molecules encoding the LNA1 protein or expression cassettes, recombinant vectors, or recombinant microorganisms containing the nucleic acid molecules.

[0027] The nucleic acid molecule is any one of the DNA molecules described in (b1)-(b2) below:

[0028] (b1) The DNA molecule shown in sequence 1 or sequence 2;

[0029] (b2) A DNA molecule derived from corn that has more than 75% identity with (b1) and encodes the LNA1 protein mentioned above.

[0030] Those skilled in the art can readily mutate the nucleotide sequence encoding the LNA1 protein of this invention using known methods, such as directed evolution and point mutation. Those artificially modified sequences, having characteristics isolated from the present invention... lna1Nucleotides with 75% or higher nucleotide sequence identity, as long as they encode the LNA1 protein and have the same function, are derived from and are equivalent to the nucleotide sequences of this invention.

[0031] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein constituting the amino acid sequence shown in Sequence 3 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0032] The expression cassette refers to DNA capable of expressing the LNA1 protein in host cells, and this DNA may include, but is not limited to, promoters. lna1 The promoter of transcription may also include a terminator. lna1 A transcription terminator. Furthermore, the expression cassette may also include an enhancer sequence.

[0033] The vector can be a plasmid, granule, bacteriophage, or viral vector. The recombinant vector can be a vector for expressing a DNA molecule containing the LNA1 protein. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS gene, luciferase gene, etc.), antibiotic resistance markers (gentamicin marker, kanamycin marker, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes).

[0034] The recombinant microorganism may be yeast, bacteria, algae, or fungi containing the above-mentioned nucleic acid molecules, expression cassettes, or recombinant vectors. Specifically, the bacteria may be Agrobacterium.

[0035] In the above applications, the regulation is referred to as "enhancement," specifically manifested as: when the LNA1 protein content in corn increases, or lna1 When gene expression levels are increased, the number of leaves, yield, and plant height of maize increase.

[0036] Another object of the present invention is to provide the use of a substance that inhibits LNA1 in any of the following B1)-B5):

[0037] B1) Reduce the number of plant leaves;

[0038] B2) Reduced plant yield;

[0039] B3) Reduce plant height;

[0040] B4) Breeding transgenic plants with reduced leaf number and / or reduced yield and / or reduced plant height;

[0041] B5) Plant breeding;

[0042] The substance that inhibits LNA1 may be a substance that reduces the activity and / or content of LNA1 protein in plants, or inhibits the activity of LNA1 in plants. lna1 The substance expressed by the gene, or the knockout of the gene in the plant lna1 Genetic material.

[0043] Furthermore, the substance that reduces LNA1 protein activity may be a protein, polypeptide, or small molecule compound that inhibits LNA1 protein function.

[0044] The substance that reduces LNA1 protein content may be a substance that inhibits LNA1 protein synthesis, promotes LNA1 protein degradation, or knocks down (reduces) or eliminates the LNA1 protein encoding gene.

[0045] The inhibiting plant lna1 The substance that expresses the gene can be any substance that can inhibit or interfere with the expression of the LNA1 protein-coding gene, such as gRNA (e.g., sgRNA), mRNA, siRNA, dsRNA, shRNA, miRNA, antisense RNA, etc.

[0046] Among the knockout plants lna1 Genetic material can be produced in any way that prevents the host cell from producing it. lna1 Gene knockout is the production of functional protein products. Specific methods include removing all or part of the coding gene sequence, introducing mutations to prevent the production of functional proteins, removing or altering regulatory components (e.g., promoter editing) to prevent transcription of the coding gene sequence, and blocking translation through binding to mRNA. Typically, knockout occurs at the genomic DNA level, resulting in the cell's offspring permanently carrying the knockout.

[0047] Furthermore, in the knockout plants lna1 The gene material can be a CRISPR / Cas9 gene editing system. This CRISPR / Cas9 gene editing system expresses Cas9 protein and sgRNA.

[0048] In some implementations, the target sequence of the sgRNA is shown in Sequence 4.

[0049] Another object of the present invention is to provide a method for cultivating transgenic plants with increased leaf number and / or increased yield and / or increased plant height.

[0050] The method for cultivating transgenic plants with increased leaf number and / or increased yield and / or increased plant height provided by the present invention includes the step of increasing the content and / or activity of LNA1 protein in the recipient plant to obtain transgenic plants; wherein the number of leaves and / or yield and / or plant height of the transgenic plants are higher than those of the recipient plants.

[0051] Furthermore, the method for increasing the content and / or activity of LNA1 protein in the recipient plant is to overexpress the gene encoding LNA1 protein in the recipient plant.

[0052] The overexpression method involves introducing the gene encoding the LNA1 protein into a recipient plant.

[0053] Furthermore, the gene encoding the LNA1 protein was introduced into the recipient plant via a recombinant expression vector. The recombinant expression vector consisted of replacing the fragment between the two XcmI restriction sites in the pBECXUN-myc vector with the sequence shown in sequence 2. lna1 The vector was obtained by extracting the gene CDS fragment and keeping the other sequences of the pBECXUN-myc vector unchanged.

[0054] Another object of the present invention is to provide a method for cultivating transgenic plants with reduced leaf number and / or reduced yield and / or reduced plant height.

[0055] The method for cultivating transgenic plants with reduced leaf number and / or reduced yield and / or reduced plant height provided by the present invention includes the step of reducing the content and / or activity of LNA1 protein in the recipient plant to obtain transgenic plants; wherein the number of leaves and / or yield and / or plant height of the transgenic plants are lower than those of the recipient plants.

[0056] Furthermore, the method for reducing the content and / or activity of LNA1 protein in the recipient plant is to introduce the aforementioned LNA1-inhibiting substance into the recipient plant.

[0057] Furthermore, the substance that inhibits LNA1 is a vector obtained by inserting the DNA molecule shown in sequence 4 into the BsaI restriction site of the pXUE411C vector while keeping the other sequences of the pXUE411C vector unchanged.

[0058] The final objective of this invention is to provide a method for preparing transgenic plants.

[0059] The method for preparing the transgenic plant provided by this invention is any one of the following 1)-3):

[0060] 1) Replace the maize genome with the DNA molecule shown in sequence 5. lna1 The DNA molecule shown in sequence 4 on the gene was used to obtain a transgenic plant;

[0061] 2) Replace the maize genome with the DNA molecule shown in sequence 6. lna1 The DNA molecule shown in sequence 4 on the gene was used to obtain a transgenic plant;

[0062] 3) Replace the maize genome with the DNA molecule shown in sequence 7. lna1 The DNA molecule shown in sequence 4 on the gene was used to obtain a transgenic plant;

[0063] The number of leaves and / or yield and / or plant height of the transgenic plant are lower than those of the recipient plant.

[0064] Furthermore, the substitutions in 1)-3) are all homozygous substitutions, that is, the same substitutions occur in homologous chromosomes.

[0065] In any of the above applications or methods, the number of leaves may be the number of leaves on the ear and / or the total number of leaves.

[0066] In any of the above applications or methods, the plant can be a monocotyledonous plant or a dicotyledonous plant. The monocotyledonous plant can be maize. Specifically, the maize can be the maize inbred line LH244.

[0067] This invention first overexpresses [the gene] in wild-type maize. lna1 , received lna1 Gene-modified maize and statistical analysis of its leaf number revealed that overexpression... lna1 It can increase the number of leaves on the corn ear and the total number of leaves. To further verify the function of LNA1, this invention knocked out LNA1 in wild-type corn. lna1, get lna1 Knockout corn and statistical analysis of its leaf number and plant height revealed that: lna1 It can reduce the number of leaves on the corn ear and the plant height. Furthermore, this invention has demonstrated improved efficiency by constructing NIL-Popcorn and NIL-MS71. lna1 Gene expression levels can increase maize yield. These results indicate that the LNA1 protein and related biological materials can regulate leaf number, yield, and plant height, and will play an important role in breeding high-yielding maize varieties. Attached Figure Description

[0068] Figure 1 For the transfer lna1 Genetically modified corn lna1 Gene expression levels and leaf number statistics. Where A represents... lna1 Gene expression level; B is the statistical result of the number of leaves on the ear; C is the statistical result of the total number of leaves.

[0069] Figure 2 For the transfer lna1 Phenotype of genetically modified maize. Among them, A represents the three transgenic genes. lna1The overall plant architecture of the genetically modified maize line and the background material LH244 (WT); B represents the combination of three transgenic lines. lna1 Overall plant architecture of genetically modified maize lines and background material LH244 (WT) after removal of lower ear leaves and ear leaves.

[0070] Figure 3 for lna1 Phenotypic, sequence analysis, and leaf number statistics of knockout maize. In this study, A represents the background material LH244 (WT) and three... lna1 The overall plant architecture of knockout maize lines; B represents the combination of background material LH244 (WT) and three... lna1 The overall plant architecture of the knockout maize line after removing the ear leaf and the lower ear leaf; C represents the CRISPR-Cas9 single-target editing, resulting in... lna1 Transformation events involving exon deletions of 2bp, 1bp, and 4bp; red bases represent start codons, blue bases represent target sequence locations, and green bases represent PAM sequences; D represents background material LH244 (WT) and three lna1 Statistical results of the number of ears-top leaves in knockout maize lines; E represents the background material LH244 (WT) and three lna1 Statistical results of plant height of knockout maize lines; in the bar chart, blue represents the background material LH244, and green represents the transformation event material; This indicates that p < 0.001 under the t-test.

[0071] Figure 4 For NIL series lna1 Gene expression pattern analysis.

[0072] Figure 5 This section describes yield determination for the NIL line. AC represents the results of single-ear weight, single-ear grain weight, and 100-grain weight under conventional planting density conditions; DF represents the results of single-ear weight, single-ear grain weight, and 100-grain weight under doubled planting density conditions; G represents the estimated increase in total yield based on yield prediction; and H represents the female ear phenotype of the NIL line. (Student) t The test, ns, indicates that it is not significant. This indicates that P < 0.05. This indicates that P < 0.005. This indicates that P < 0.001. Detailed Implementation

[0073] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0074] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0075] The pBECXUN-myc vector used in the following examples is described in the literature "Convergent selection of aWD40 protein that enhances grain yield in maize and rice, Science, March 2022".

[0076] The pXUE411C vector in the following examples is described in the literature "A CRISPR / Cas9 toolkit for multiple genome editing in plants, BMC Plant Biology, 2014".

[0077] The maize inbred line LH244 in the following examples is described in the literature " ZmEREB46 , a maize ortholog of Arabidopsis WAX INDUCER1 / SHINE1, is involved in the biosynthesis of leafepicuticular very-long-chain waxes and drought tolerance."

[0078] The local Popcorn species described in the following examples is described in the literature “Baskin, TI, J. McGuffin and B.S. Sonderman (1999) On the weak phototropic response of the maize variety, strawberry popcorn. Maydica, 44: 119–125.”.

[0079] The maize inbred line MS71 in the following examples is described in the literature “Matthew B. Hufford et al., Denovo assembly, annotation, and comparative analysis of 26 diverse maizegenomes. Science 373, 655-662 (2021). DOI: 10.1126 / science.abg5289”.

[0080] Example 1, Transfer lna1 Construction and phenotypic analysis of genetically modified maize

[0081] I. Transfer lna1 Construction of genetically modified corn

[0082] 1. lna1 Construction of overexpression vectors

[0083] Replace the fragment between the two XcmI restriction sites in the pBECXUN-myc vector with the sequence shown in sequence 2. lna1 The gene CDS sequence was obtained, while keeping other sequences of the pBECXUN-myc vector unchanged. lna1 Overexpression vector pBECXUN-myc- lna1 .

[0084] 2. Construction of recombinant bacteria

[0085] The construction in step 1 lna1 Overexpression vector pBECXUN-myc- lna1 Introducing Agrobacterium EHA105, and after identification, it was found to contain... lna1 Agrobacterium EHA105 overexpressing the vector pBECXUN-myc-lna1.

[0086] 3. Preparation of genetically modified corn

[0087] Agrobacterium-mediated genetic transformation utilizes... lna1 Agrobacterium EHA105 overexpressing the pBECXUN-myc-lna1 gene was used to genetically transform the immature embryos of the maize inbred line LH244, resulting in T0 generation transgenic maize plants. Specific steps can be found in the literature "Agrobacterium-mediated transformation of maize, Nature Protocols, 2007".

[0088] 4. Turn lna1 Identification of genetically modified corn

[0089] Positive transgenic maize plants from the T0 generation were identified using PCR. lna1 Genetically modified maize plants. The primer sequences for PCR identification are as follows (transgenic maize plants amplifying a fragment of 873 bp are considered positive). lna1 Genetically modified maize plants): TACTGTTTCTTTTGTCGATGCTCAC and AGACCGGCAACAGGATTCAATC.

[0090] 5. Real-time quantitative PCR detection lna1 Gene expression level

[0091] Extraction of maize inbred line LH244 and positive transgenic lna1 RNA from maize plants was reverse transcribed to obtain cDNA. Then, using the cDNA as a template, qRT-PCR was performed with primers AGATCAGCGACCTCGAACAA and GCAACTGATTGCTTGCCAAC. The Cq value of each reaction was calculated by averaging the values ​​from the three replicates as the Cq for that sample. The relative expression level for each sample was calculated using the ΔΔct method.

[0092] The results are as follows Figure 1 As shown in Figure A, the result indicates: [Redirection] lna1 In the genetically modified maize lines OE-LNA1#1, OE-LNA1#2 and OE-LNA1#3 lna1 The relative expression level was significantly higher than that of the maize inbred line LH244.

[0093] Select T1 for transfer lna1 The maize genes OE-LNA1#1, OE-LNA1#2, and OE-LNA1#3 were used for the following trait analysis experiments.

[0094] II. Transfer lna1 Trait analysis of genetically modified maize

[0095] Test materials: maize inbred lines LH244 and T1 variants lna1 Genetically modified maize varieties OE-LNA1#1, OE-LNA1#2, and OE-LNA1#3.

[0096] Experimental methods: The test materials were planted in Sanya City, Hainan Province in November 2020. After the female ears were fully developed and pollen was shed, the plant phenotype was observed, and the number of leaves above the ear and the total number of leaves (including the number of leaves above the ear and the number of leaves below the ear) were counted. For each event, more than 20 negative control plants and more than 30 positive control plants were selected for phenotype observation.

[0097] The results are as follows Figure 1 and Figure 2 As shown. The results indicate that compared with wild-type maize, the three transformed varieties... lna1The number of leaves on the ear of genetically modified maize increased significantly from an average of about 6.4 leaves to about 7.0 leaves (P<10). -5 At the same time, the total number of leaves also increased significantly (P<10). -5 Among them, the average number of leaves per ear for the maize inbred line LH244 was 6.36. lna1 The average number of leaves per ear in the genetically modified maize OE-LNA1#1 is 7.02. lna1 The average number of leaves per ear in the genetically modified maize OE-LNA1#2 is 6.92. lna1 The average number of leaves per ear in the genetically modified maize OE-LNA1#3 was 6.97; the average total number of leaves in the maize inbred line LH244 was 20.30. lna1 The average total number of leaves in the genetically modified maize OE-LNA1#1 is 21.98. lna1 The average total number of leaves in the genetically modified maize OE-LNA1#2 is 22.14. lna1 The average total number of leaves in the genetically modified maize OE-LNA1#3 is 22.36.

[0098] Example 2 lna1 Construction and trait analysis of knockout maize

[0099] one, lna1 Construction of corn knockout

[0100] 1. lna1 Construction of knockout vector

[0101] 1) lna1 Design of knockout targets

[0102] according to lna1 The gene CDS sequence was used to design suitable target sites on the CRISPR-P v2.0 website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR). The final target sequence obtained was as follows: GGAGCGTCGGGAGATAAAG (Sequence 4).

[0103] 2) lna1 Construction of knockout vector

[0104] The 19bp sequence shown in sequence 4 lna1 The gene target sequence (GGAGCGTCGGGAGATAAAG) was ligated into the BsaI restriction site of the pXUE411C vector, while keeping the other sequences of the pXUE411C vector unchanged, to obtain... lna1 Knock out the carrier.

[0105] 2. Obtaining recombinant bacteria

[0106] Willlna1 The knockout vector was introduced into Agrobacterium EHA105, and after identification, it was found to contain... lna1 Agrobacterium EHA105 with knockout vector.

[0107] 3. Obtaining genetically modified corn

[0108] Agrobacterium-mediated genetic transformation utilizes... lna1 Agrobacterium EHA105 with the knockout vector was used to genetically transform the immature embryos of the maize inbred line LH244 to obtain T0 generation transgenic maize plants. Specific steps can be found in the literature "Agrobacterium-mediated transformation of maize, Nature Protocols, 2007".

[0109] 4. lna1 Identification of knockout corn

[0110] DNA analysis of T0 generation transgenic maize plants was performed using primers CACCCGCCCTCTCTTG and CCTCCAAACGCAATTAACTCTA to determine the editing mode. T1 generation seeds were obtained and sown in a greenhouse. The T1 generation transgenic plants were then amplified and sequenced again to determine the stable inheritance of the editing mode and the homozygosity of the editing sites. Finally, three [genomes / sequences] were obtained. lna1 Knockout homozygous edited maize lines (i.e., those with identical mutations on both chromosomes) were named as follows: lna1-CR1 , lna1- CR2 , lna1-CR3 .

[0111] Compared with the genome sequence of wild-type maize inbred line LH244, lna1-CR1 The only difference is the deletion of two bases (AT) in the gene encoding the LAN1 protein (Sequence 2), which are located in the sequence shown in Sequence 1. lna1 Positions 22-23 of the gene cause a frameshift, leading to premature termination of protein translation and loss of LAN1 protein function.

[0112] Compared to the wild-type maize inbred line LH244, lna1-CR2 The only difference is the deletion of one base (A) in the gene encoding the LAN1 protein (Sequence 2), which is located in the sequence shown in Sequence 1. lna1 The 24th position of the gene causes a frameshift, leading to premature termination of protein translation and loss of LAN1 protein function.

[0113] Compared to the wild-type maize inbred line LH244, lna1-CR3The only difference is the deletion of four bases (AAAG) in the gene encoding the LAN1 protein (Sequence 2), which is located in the sequence shown in Sequence 1. lna1 Positions 24-27 of the gene cause a frameshift, leading to premature termination of protein translation and loss of LAN1 protein function.

[0114] Wild-type maize inbred line LH244 and lna1 Knockout homozygous maize editing lines lna1-CR1 , lna1-CR2 , lna1-CR3 The sequence alignment diagram is as follows: Figure 3 As shown in C.

[0115] two, lna1 Trait analysis of knockout maize

[0116] Test materials: maize inbred lines LH244 and T2 generation lna1 Knockout homozygous maize editing lines lna1-CR1 , lna1- CR2 , lna1-CR3 .

[0117] Experimental methods: The test materials were planted at the Shangzhuang Experimental Station of China Agricultural University in Beijing in May 2022. The plant phenotype was observed after pollen shedding, and the number of leaves on the spike and plant height were counted. More than 30 plants were selected from each line.

[0118] The results are as follows Figure 3 As shown in the figure. The results indicate that, compared with wild-type maize, three LNA1 proteins lost function. lna1 Knockout homozygous maize editing lines lna1 -CR1、 lna1 -CR2、 lna1 -CR3 had significantly fewer spikelet leaves, down to about 4 (P<10). -10 In addition, plant height was also significantly reduced. Specifically, the average number of leaves per ear for the maize inbred line LH244 was 6.51. lna1 Knockout homozygous maize editing lines lna1-CR1 The average number of leaves per ear was 4.66. lna1 Knockout homozygous maize editing lines lna1-CR2 The average number of leaves on the ear was 3.89. lna1 Knockout homozygous maize editing lines lna1-CR3 The average number of leaves per ear was 3.82; the average plant height of the maize inbred line LH244 was 265.06 cm. lna1 Knockout homozygous maize editing lines lna1-CR1 The average plant height is 201.1 cm. lna1 Knockout homozygous maize editing lines lna1-CR2The average plant height is 170.38 cm. lna1 Knockout homozygous maize editing lines lna1-CR3 The average plant height is 158.92cm.

[0119] Example 3: Preparation and Yield Determination of NIL System

[0120] I. Preparation of NIL series

[0121] 1. Preparation of NIL-Popcorn and NIL-MS71

[0122] Sequencing of the genome sequences of the maize inbred line MS71 and the local species Popcorn revealed that the maize inbred line MS71 and the local species Popcorn... lna1 The coding region differs by only two bases (the positions and differences of these two bases are as follows: in the maize inbred line MS71, the base at position 181860098 on chromosome 4 of the maize genome reference sequence (version v4) is C, while in the local species Popcorn, the base at this position is G; and in the maize inbred line MS71, the base at position 181858282 on chromosome 4 of the maize genome reference sequence (version v4) is G, while in the local species Popcorn, the base at this position is A). Furthermore, Popcorn... lna1 A 5bp (AGAAG) base insertion exists approximately 190kb upstream of the coding region (specifically, the insertion location is as follows: AGAAG is inserted between positions 182055381 and 182055382 on chromosome 4 of the maize genome reference sequence in version v4). This insertion results in [the presence of AGAAG in Popcorn]. lna1 Gene expression levels were significantly higher than those of MS71.

[0123] A biparental population was constructed using the maize inbred line MS71 and the local species Popcorn as parents. In the F7 generation, the remaining heterozygous lines were screened using molecular markers M9 (M9_F: ACTAGATAAATGGCATTCCTAGC and M9_R: GCGATATTCACTCATCAGAAGTA) and M11 (M11_F: GTCGTCGAGCATGGAAAACTTAG and M11_R: AAAGGCAGCAATTTCCGCAAAA). After segregation in the F8 generation, offspring with genotypes (location interval of position 181861347-182056761 on chromosome 4 of the maize genome reference sequence v4) consistent with parent MS71 were selected as NIL-MS71, and offspring with genotypes (location interval of position 181861347-182056761 on chromosome 4 of the maize genome reference sequence v4) consistent with Popcorn were selected as NIL-Popcorn.

[0124] 2. lna1 Detection of gene expression levels

[0125] For NIL-Popcorn and NIL-MS71 lna1 Gene expression patterns were analyzed using the following steps: buds, young female ears of different sizes, leaves, internode roots, and shoot tip meristems at different developmental stages (V3, V4, and V5) of NIL-Popcorn and NIL-MS71 were collected. RNA was extracted and reverse transcribed to obtain cDNA. Real-time quantitative PCR was then performed using the cDNA as a template, with GADPH as an internal reference gene. lna1 Relative gene expression levels.

[0126] The results are as follows Figure 4 As shown. The results indicate that in stages V3, V4, and V5, the shoot apical meristem of NIL-Popcorn contains... lna1 The expression levels were significantly higher than those of NIL-MS71.

[0127] II. Yield determination of NIL series

[0128] Test materials: NIL-Popcorn and NIL-MS71.

[0129] Experimental methods: The test materials were planted and yield measured under conventional planting density (8000 plants / hectare) and doubled planting density (16000 plants / hectare) conditions, respectively, using conventional methods. Each material was replicated three times.

[0130] The results are as follows Figure 5As shown in the figure. The results showed that under conventional planting density conditions, the single ear weight, single ear grain weight, and 100-grain weight of NIL-Popcorn increased by 10.2%, 11.4%, and 2.6%, respectively, compared with NIL-MS71. After doubling the planting density, the single ear weight, single ear grain weight, and 100-grain weight of NIL-Popcorn increased by 10.8%, 9.5%, and 5.5%, respectively, compared with NIL-MS71.

[0131] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of substances that inhibit LNA1 protein in the following B1) or B2): B1) Reduce plant height; B2) Cultivating transgenic plants with reduced plant height; The LNA1 protein is the protein described in (a1) or (a2) below: (a1) The protein shown in sequence 3; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); The substance that inhibits LNA1 protein is a substance used to knock out nucleic acid molecules encoding LNA1 protein in plants; The plant in question is corn.

2. The application according to claim 1, characterized in that: The nucleic acid molecule is the DNA molecule shown in Sequence 1 or Sequence 2.

3. A method for cultivating a transgenic plant with reduced plant height, comprising the step of reducing the content of the LNA1 protein as described in claim 1 in a recipient plant to obtain the transgenic plant; wherein the plant height of the transgenic plant is lower than that of the recipient plant; and wherein the plant is corn.

4. A method for preparing a transgenic plant, comprising any one of the following 1)-3): 1) Replace the maize genome with the DNA molecule shown in sequence 5. lna1 The DNA molecule shown in sequence 4 on the gene was used to obtain a transgenic plant; 2) Replace the maize genome with the DNA molecule shown in sequence 6. lna1 The DNA molecule shown in sequence 4 on the gene was used to obtain a transgenic plant; 3) Replace the maize genome with the DNA molecule shown in sequence 7. lna1 The DNA molecule shown in sequence 4 on the gene was used to obtain a transgenic plant; The genetically modified plant is shorter than the recipient plant; the plant is corn.

Citation Information

Patent Citations

  • Compositions and methods for improving crop yields through trait stacking

    CN111727257A