HinK inhibitor as well as preparation method and application thereof

Abstract

The invention discloses a compound as shown in a formula (I), or a prodrug, a deuterated compound and a pharmaceutically acceptable salt thereof, and in the formula (I), X and Y are independently selected from nitrogen, oxygen and sulfur or do not exist; r1 is substituted or unobtained phenyl, quinolyl, benzothienyl, benzofuryl, indolyl, 1, 3-dihydro-indole-2-ketone or carbazolyl, and R2 is substituted or unobtained phenyl, quinolyl, benzothienyl, benzofuryl, indolyl, 1, 3-dihydro-indole-2-ketone or carbazolyl; r1 is-linker-R ', R2 is-linker-R'; the linker is an alkyl chain which has the length of 0-12 atoms and contains or does not contain nitrogen, oxygen and sulfur atoms, or does not exist; r'is substituted or unsubstituted imidazolyl, azacycloalkyl, azoxacycloalkyl, or does not exist; r3 is one or more hydrogen, halogen or alkyl substituent; the compound as shown in the formula (I) is not EHop-016. The invention also discloses application of the EHop-016, the compound as shown in the formula (I) or the prodrug, the deuterated substance and the medicinal salt thereof in preparation of a drug for resisting pseudomonas aeruginosa infection by taking HinK as a target spot, and further discloses application of the EHop-016, the compound as shown in the formula (I) or the prodrug, the deuterated substance and the medicinal salt thereof. # imgabs0 #

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to a HinK inhibitor and a preparation method and application thereof. Background Art

[0002] The name of EHop-016 is N4-(9-ethyl-9H-carbazol-3-yl)-N2-[3-(4-morpholinyl)propyl]-2,4-pyrimidinediamine, and its chemical formula is C 25 H 30 N 6 O, molecular weight is 430.55, and its structural formula is as follows:

[0003]

[0004] EHop-016 is a selective inhibitor of Rac1 and Rac3 in the Rac-GTPase family, which can effectively reduce tumor growth and metastasis in mice. Studies have shown that EHop-016 can improve the resistance of various cancer cells to the anticancer drug cisplatin. This in vitro and in vivo combination therapy with chemotherapy drugs provides a promising targeted therapy strategy for treating tumors in clinical practice.

[0005] Pseudomonas aeruginosa is an important human pathogen that is naturally or acquiredly resistant to multiple antibiotics, making clinical treatment very difficult. It is estimated that more than 10% of hospital infections are caused by Pseudomonas aeruginosa. In February 2017, the World Health Organization released a list of "12 pathogens" that the world urgently needs to fight, and listed the need for drugs to treat drug-resistant Pseudomonas aeruginosa infections as the highest level of "critical".

[0006] In my country, Pseudomonas aeruginosa is also a common pathogen of hospital-acquired infections, posing a serious threat to the health and life safety of the people. Traditional antibiotics, due to their inherent mechanism of action (direct bactericidal or direct inhibition of bacterial growth), exert strong selection pressure on bacteria while exerting their efficacy, thereby promoting the emergence and enrichment of drug-resistant strains. Therefore, it is urgent to develop new antibiotic alternative therapies to alleviate the increasingly serious problem of antibiotic resistance.

[0007] In recent years, anti-bacterial virulence therapy has received great attention because it can reduce bacterial virulence while bringing less selection pressure on bacterial growth and alleviate the development of drug resistance. Current research (reference: Wang, Yaya, Cao, Qiao, Cao, Qin, Gan, Jianhua, Sun, Ning, Yang, Cai Guang, Bae, Taeok, Wu, Min, Lan, Lefu. Histamine activates HinK to promote the virulence of Pseudomonas aeruginosa. SCIENCE BULLETIN [J]. 2021, 66 (11): 1101-1118.) shows that HinK, a transcriptional regulator of the LysR family, plays a key role in the process of Pseudomonas aeruginosa infecting the host. The loss of HinK almost makes Pseudomonas aeruginosa lose its pathogenicity to mice. This suggests that HinK is a potential target for anti-pathogenicity of Pseudomonas aeruginosa.

[0008] At present, there is still a blank in the research on targeted HinK inhibitors. Therefore, the development of targeted HinK inhibitors is not only innovative, but also has important practical significance and scientific value. Summary of the invention

[0009] The present invention provides a compound as shown in formula (I), which can effectively inhibit the transcriptional regulatory activity of HinK protein and effectively reduce the thermal stability of HinK protein, and provides a new lead compound for developing a new strategy for resisting Pseudomonas aeruginosa infection with HinK protein as the target.

[0010] The technical solution of the present invention is as follows:

[0011] A compound as shown in formula (I), or a prodrug, deuterated substance, or pharmaceutically acceptable salt thereof,

[0012]

[0013] Wherein, X and Y are independently selected from nitrogen, oxygen, sulfur, or are absent;

[0014] R 1 is selected from substituted or unsubstituted phenyl, quinolyl, benzothiophenyl, benzofuranyl, indolyl, 1,3-dihydro-indol-2-one, and carbazolyl;

[0015] R 2 -linker-R'; linker is an alkyl chain of 0-12 atoms with or without nitrogen, oxygen, or sulfur atoms, or does not exist; R' is a substituted or unsubstituted imidazolyl, azacycloalkyl, azacycloalkyl, or does not exist;

[0016] R 3 is one or more hydrogen, halogen or alkyl substituents;

[0017] The compound represented by formula (I) is not

[0018] The compound represented by formula (I) of the present invention can effectively inhibit the transcriptional regulatory activity of HinK protein, and can effectively reduce the thermal stability of HinK protein, and can fight against the infection caused by Pseudomonas aeruginosa by reducing the pathogenicity of Pseudomonas aeruginosa.

[0019] Preferably, R 1 In the above, the substituent on the phenyl, quinolyl, benzothienyl, benzofuranyl, indolyl, 1,3-dihydro-indol-2-one or carbazolyl group is a C1-C5 alkyl group.

[0020] Preferably, X and Y are nitrogen; R 1 is an N-alkyl-substituted carbazolyl or an N-alkyl-substituted indolyl; R 2 is -linker-R', linker is a C1-C5 alkyl chain, R' is a substituted or unsubstituted imidazole group; R 3 For hydrogen.

[0021] Preferably, the compound represented by formula (I) is selected from:

[0022]

[0023] Further preferably, the compound represented by formula (I) is selected from:

[0024]

[0025] The present invention also provides a pharmaceutical composition comprising a compound as shown in formula (I) or a prodrug, deuterated substance, pharmaceutically acceptable salt thereof, and pharmaceutically acceptable excipients.

[0026] The present invention also provides a HinK inhibitor, comprising a compound as shown in formula (I) or a prodrug, deuterated substance, or pharmaceutically acceptable salt thereof.

[0027] The present invention also provides a use of a compound as shown in formula (I) or a prodrug, a deuterated product, or a pharmaceutically acceptable salt thereof in the preparation of an anti-Pseudomonas aeruginosa infection drug with HinK as a target.

[0028] The present invention also provides an application of EHop-016 in the preparation of an anti-Pseudomonas aeruginosa infection drug with HinK as a target.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention not only provides a new use for EHop-016, but also provides a new lead compound for developing a new strategy for resisting Pseudomonas aeruginosa infection with HinK as a target.

[0031] EHop-016 and the compound represented by formula (I) or its prodrug, deuterated product, or pharmaceutically acceptable salt can effectively inhibit the transcriptional regulatory activity of HinK protein, can bind to HinK protein and effectively reduce the thermal stability of HinK protein, and can effectively fight against infection caused by Pseudomonas aeruginosa by reducing the pathogenicity of Pseudomonas aeruginosa. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is a diagram showing the activation effect of ImAA signaling molecules on HinK transcriptional regulation function detected by the reporter gene system;

[0033] Figure 2 This is a diagram showing the inhibitory effect of EHop-016 on HinK transcriptional regulation function detected by the reporter gene system;

[0034] Figure 3 This is the dose-effect diagram of compound EHop-016 inhibiting HinK transcriptional regulation function;

[0035] Figure 4 This is a dose-effect diagram of compound C-1-3 inhibiting the transcriptional regulatory function of HinK;

[0036] Figure 5 This is a dose-effect diagram of compound C-1-13 inhibiting the transcriptional regulatory function of HinK;

[0037] Figure 6 This is a dose-effect diagram of compound C-1-24 inhibiting the transcriptional regulatory function of HinK;

[0038] Figure 7 The effect of compound EHop-016 on the thermal stability of HinK protein;

[0039] Figure 8 The effect of compound C-1-3 on the thermal stability of HinK protein;

[0040] Fig. 9 The effect of compound C-1-13 on the thermal stability of HinK protein;

[0041] Fig.10 The effect of compound C-1-24 on the thermal stability of HinK protein;

[0042] Fig.11 This is the kinetic curve of the binding of compound EHop-016 to HinK protein;

[0043] Fig.12is the kinetic curve of the binding of compound C-1-13 to HinK protein;

[0044] Fig.13 is the kinetic curve of the binding of compound C-1-24 to HinK protein;

[0045] Fig.14 This is a diagram showing that EHop-016 and its derivatives extend the survival time of zebrafish in intraperitoneal infection experiments;

[0046] Fig.15 This is the dose-effect diagram of compound C-1-24 against Pseudomonas aeruginosa PAO1 infection in the intraperitoneal infection experiment. DETAILED DESCRIPTION

[0047] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be pointed out that the embodiments described below are intended to facilitate the understanding of the present invention and do not have any limiting effect on the present invention.

[0048] In the present invention, we first invented a screening method, and screened the compound library that has been marketed and in the preclinical and clinical stages through a fluorescent reporter gene system, and found that a RAC inhibitor EHop-016 in the second phase of clinical trials can effectively inhibit the transcriptional regulatory activity of HinK. Subsequently, we optimized and modified the structure of EHop-016, and obtained a total of 26 derivatives of EHop-016. The activity of the derivatives was detected using a fluorescent reporter gene system, and it was found that the modified compounds C-1-3, C-1-13, and C-1-24 can effectively inhibit the transcriptional regulatory activity of HinK. Further, we used protein thermal stability analysis (Thermal-shift) to show that the derivatives of EHop-016 C-1-3, C-1-13, and C-1-24 can effectively reduce the thermal stability of HinK protein, indicating that the above compounds can directly interact with HinK protein. We then used surface plasmon resonance to detect the binding kinetics of EHop-016, C-1-13, and C-1-24 to HinK protein. D ) were: 15.6μM, 71.4μM, 15.1μM. EHop-016 itself has no antibacterial activity. Animal models show that EHop-016 and its derivatives can significantly reduce the mortality rate of zebrafish infected with Pseudomonas aeruginosa. The present invention not only provides a new use for EHop-016, but also provides a new lead compound for developing a new strategy for anti-Pseudomonas aeruginosa infection with HinK as the target. The present invention mainly includes the following four aspects: establishment of a screening method for HinK inhibitors; new uses of EHop-016; optimization and modification of the EHop-016 structure; and detection of the anti-infection activity of the compound.

[0049] HinK, as a transcriptional regulator of the histamine metabolic pathway, can sense the histamine metabolite imidazole-4-acetic acid (ImAA) to activate its own transcriptional regulatory function, thereby directly binding to the promoter of the operon hinDAC-pa0222 involved in histamine transport and metabolism, thereby directly positively regulating their expression. Therefore, the applicant used a reporter gene fused to the hinD promoter to screen HinK inhibitors. The hinD promoter region (-713 to +20, A of the ATG start codon is +1), and its nucleotide sequence is as follows (SEQ ID No. 1):

[0050] accagttcctgctgctctccgtcgcgtatgcggatctccacccccggataggcctggcgaaagccggcgatcaggcctggcaggtagagcggg gcgaccgtctcgaagcagccgatgtcgatctgcccggcgatcacgtcgttgtcggccagggcgttctgctcgaactcgtgggccatccgcagc agttcctgggccttgcggtagaagcgcgcgccggcgggggtcagcgacacgccctgggcgtggtggcggatgaacagctgcacgccgaagctt tcctccagacccttcaccgccgtggagatcgacggctgggcgatgtacagcttgcgcgaggcctcggccacgctgccgcattccacggtggtca cgaaatacttgagttgccgcaaggtataggacgccactgcaagacctcatcggcgcatcatcctccccgggccgggcgtgcgcgcctcgattg ttgtgtccgccgcgctgcaagcaagttgcaggccgctgccgggcgtcgcggcgctggccgcgacgacgattgcccgcctgcacgataacccagc acgacgcactttgccggggcacgcctggccagctttttcttatgtcccgaggacatttttaataattttccttcgccgcggcttgcgcgacca tccttccccatcgaccccatggacagcggtccgcctcccggcggtccgggccatgcgtgcagaaccacgaccggcgcagaccggcgagataaca

[0051] 1. Construction of reporter gene system and screening method

[0052] (1) Construction of hinD-lux

[0053] The hinD promoter sequence was amplified by PCR using the genome of Pseudomonas aeruginosa strain PAO1 as a template.

[0054] The primer sequences are:

[0055] Upstream primer 5'CCG CTCGAG ACCAGTTCCTGCTGCTCTCC3' (the underlined sequence is the XhoI restriction site),

[0056] Downstream primer 5'CGC GGATCC TGTTATCTCGCCGGTCTGCG' (the underlined sequence is the BamHI restriction site).

[0057] PCR reaction system:

[0058]

[0059]

[0060] The recovered and purified PCR product and plasmid mini-CTX-lux were double-digested with XhoI and BamHI, and then ligated with T4 DNA ligase at 16°C for 12 hours.

[0061] The ligation product was transformed into Escherichia coli DH5a, spread on LB plates containing 5 μg / ml tetracycline, and cultured at 37°C for 16 hours before screening positive colonies using PCR. The positive colonies were selected for culture, extraction, and plasmid sequencing.

[0062] (2) Construction of PAO1 / hinD-lux and ΔhinK / hinD-lux

[0063] The hinD-lux plasmid confirmed by sequencing was transformed into the S17-1 strain to obtain S17-1 / hinD-lux, and then S17-1 / hinD-lux was used as the donor bacteria to introduce hinD-lux into the PAO1 and ΔhinK strains respectively by conjugation.

[0064] Steps of joining:

[0065] The donor bacteria S17-1 / hinD-lux and the recipient bacteria PAO1 or ΔhinK were inoculated on LB plates containing tetracycline (5 μg / mL) and without antibiotics, respectively, and cultured overnight. The cultures were suspended in 0.01 mol / L PBS buffer and washed twice, and then the cells were suspended in 100 μL PBS to make the concentration of the donor bacteria OD 600 The value is 20, and the concentration of the infected bacteria is OD 600 The value is 10. 25 μL of donor bacterial suspension and recipient bacterial suspension were mixed and spotted on LB plates and cultured at 37°C for 4 hours. The cultured mixture was scraped and suspended in 1 mL of PBS, and then 100 μL was spread on Pseudomonas isolation agar (PIA) plates containing tetracycline (150 μg / mL) and cultured overnight at 37°C. The plates were then placed in a gel imaging system to detect visible light. The luminescent colonies were PAO1::hinD-lux or ΔhinK::hinD-lux reporter gene systems.

[0066] (3) Screening method

[0067] Use modified M9 minimal medium (MM) to culture PAO1::hinD-lux and ΔhinK::hinD-lux overnight, then dilute the bacterial solution into MM at a ratio of 1:50, and divide the diluted bacterial solution into 5 2ml centrifuge tubes, adding 495μL of bacterial solution to each tube. Prepare imidazole-4-acetic acid (ImAA) into a 1M stock solution and adjust the pH to 7.0, then dilute it into different concentration gradients, namely: 10μM, 100μM, 1mM, 10mM. Add 5μL of the above-diluted ImAA to the centrifuge tubes containing the bacterial solution. The final concentrations of ImAA are: 100nM, 1μM, 10μM, 100μM, respectively. Add 5μL of sterile ddH 2 O. After mixing, add 100 μL of bacterial solution to a 96-well ELISA plate with a black bottom and transparent bottom. Repeat 3 times for each sample, and then cover each well with 60 μL of filtered and sterilized liquid paraffin to prevent the evaporation of the bacterial solution. Then place the ELISA plate in an ELISA reader and set the temperature to 37°C. Detect lux fluorescence and OD every 1 hour. 600 Different concentrations of ImAA can induce the expression of the PAO1 / hinD-lux reporter system, and the fluorescence intensity is proportional to the ImAA concentration (see Appendix Figure 1 ) indicates that the reporter gene system can work normally.

[0068] Modified M9 minimal medium: Na 2 HPO 4 ,6.8g / L; KH 2 PO 4 ,3g / L;NaCl,0.5g / L;KNO3 ,1.88g / L; 0.4% Glucose (w / v), 2μM ferric citrate, 1mM MgSO 4 ,0.1 mM CaCl 2 ; pH 7.4.

[0069] 2. Screening and identification of HinK inhibitors

[0070] (1) Screening of compound libraries

[0071] PAO1 / hinD-lux was cultured overnight in MM, and then the bacterial solution was diluted 1:50 into MM containing 50μMImAA, vortexed for 30s to mix, and the diluted bacterial solution was added to the 96-well plate with a transparent bottom and black edges using a pistol, and 98μL of bacterial solution was added to each well. 2μL of compound with a concentration of 5mM was drawn from the 96-well plate storing the compound using a pistol, and added to the corresponding wells of the ELISA plate containing the bacterial solution according to the position of the compound in the 96-well plate, and marked. A control group without compound but with 2μL DMSO was set in each ELISA plate. After adding the compound, gently mix it with a pistol, and try to avoid bubbles. Then cover each well with 60μL of filtered and sterilized liquid paraffin with a pistol. Place it in a 37℃ incubator for static culture. According to previous experiments, the fluorescence intensity of the ImAA-induced reporter system reaches the highest value after static culture at 37℃ for 6 hours. Therefore, the ELISA plate was taken out from the incubator after 6 hours of static culture at 37°C, and the lux fluorescence value and OD were read simultaneously using an ELISA reader. 600 The lux fluorescence values ​​of the other wells in each ELISA plate were compared with those of the wells with DMSO, and the compounds with fluorescence ratio ≤ 0.5 but no effect on bacterial growth were selected for rescreening. Different concentration gradients were set for the compounds during rescreening to detect the effects of the compounds on the PAO1::hinD-lux reporter gene system. It was found that a new drug EHop-016 in the second phase of clinical trials can significantly inhibit the activity of PAO1::hinD-lux (see Appendix Figure 2 ). Then, we used the highest point of the reporter gene when only compound ImAA was added, that is, the fluorescence value of each group at 5 hours as the data to calculate IC 50 The calculation method is as follows: the average luminescence value of the three replicate wells of the group with ImAA is set as A, the average luminescence value of the group without any compound is set as C, and then the average luminescence value of the other groups with inhibitors is set as I. The calculation formula for the inhibition rate of the compound on HinK activity is: (AI) / (AC)×100%. Based on this formula, we obtained the inhibition rate of HinK transcription activity by different concentrations of EHop-016, and used GraphPad Prism software (San Diego, USA) to draw a graph and calculate the IC of EHop-016 on HinK. 50is 34.91 (with Figure 3 ).

[0072] 3. Optimization and transformation of EHop-016 structure

[0073] (1) Modification of EHop-016 compound

[0074]

[0075] X and Y are independently nitrogen, oxygen, sulfur or other heteroatoms;

[0076] R 1 , R 2 It is a fatty or aromatic structure;

[0077] R 3 is substituted by one or more halogen or alkyl

[0078] Solvent 1 and solvent 2 are selected from the following group:

[0079] Alcohols such as methanol, ethanol, isopropanol, n-butanol, isobutanol, tert-butanol, dimethyl sulfoxide, N,N-dimethylformamide, N,N-dimethylacetamide, tetrahydrofuran, 1,4-dioxane, etc., or combinations thereof.

[0080] The base is selected from the group consisting of:

[0081] N,N-diisopropylethylamine, triethylamine and other organic bases, sodium hydroxide, potassium hydroxide and other inorganic bases, or a combination thereof.

[0082] T 1 From room temperature to 100 degrees, T 2 It is 100 to 160 degrees.

[0083] In some embodiments, the molar ratio of substrate A to substrate B is 1:10 to 10:1, preferably 1:3.

[0084] In a specific embodiment, the compound of formula (I) is selected from:

[0085]

[0086]

[0087] The nucleophile is selected from:

[0088]

[0089]

[0090] Embodiment 1:

[0091]

[0092] 2,4-Dichloropyrimidine (1.0 equivalent), nucleophile N-1-1 (3.0 equivalent) and DIPEA (3.0 equivalent) were dissolved in isopropanol and incubated at 90 degrees. After the reaction was completed by high performance liquid chromatography, the product B was separated by column chromatography. Subsequently, B (1.0 equivalent) and nucleophile N-2-1 (1.5 equivalent) were dissolved in isobutanol and reacted at 125 degrees. After the reaction was completed by high performance liquid chromatography, the target product C-1-1 was separated by reverse phase preparative chromatography. The yield was 84%. 1 H NMR (400 MHz, DMSO-d 6 )δ10.82(s,1H),8.65(s,1H),8.45(s,1H),8.09(d,J=7.7Hz,1H),7.84(d,J=7.2Hz,1H),7.63(dd,J=11.7,8.2Hz,3H),7.47(t,J=7.7Hz,1 H),7.21(t,J=7.4Hz,1H),6.33(s,1H),4.44(q,J=7.0Hz,2H),3.80–3.43(m,12H),3.17(s,3H),1.31(t,J=7.1Hz,3H).ESI-MS:calcd.forC 25 H 31 N 5 O 3 m / z=449.2427,found 450.2508[M+H] + .

[0093] Embodiment 2:

[0094]

[0095] The nucleophile N-2-1 in Example 1 was replaced by N-2-2, and the remaining operations were the same to obtain the target product C-1-2 with a yield of 58%. 1 H NMR (400 MHz, DMSO-d 6)δ9.33(s,1H),8.56(s,1H),8.12(s,1H),7.82(d,J=5.9Hz,1H),7.56(q,J=6.3,5.6Hz,3H),7.4 4(t,J=7.6Hz,1H),7.19(t,J=7.4Hz,1H),6.88(s,1H),6.04(d,J=6.0Hz,1H),4.42(q,J=7.1Hz,2 H),4.16(d,J=7.3Hz,1H),3.90(dd,J=8.1,3.7Hz,1H),3.74–3.66(m,1H),3.64(d,J=3.1Hz,1H), 3.54(d,J=6.1Hz,4H),3.36–3.25(m,4H),2.55(s,2H),1.31(t,J=7.1Hz,3H).ESI-MS:calcd.for C 26 H 31 N 5 O 6 m / z=509.2274,found 510.2356[M+H] + .

[0096] Embodiment 3:

[0097]

[0098] The nucleophile N-2-1 in Example 1 was replaced by N-2-3, and the remaining operations were the same to obtain the target product C-1-3 with a yield of 56%. 1 H NMR (400 MHz, Methanol-d 4 )δ9.15(s,1H),8.71(s,1H),7.83(d,J=5.7Hz,1H),7.62–7.47(m,4H),7 .41(t,J=7.7Hz,1H),7.14(d,J=7.5Hz,1H),6.85(s,1H),6.77(d,J=4.8 Hz,1H),6.01(dd,J=5.7,2.3Hz,1H),4.39(q,J=7.1Hz,2H),3.68–3.56(m,2H),2.85(t,J=7.4Hz,2H),1.30(t,J=7.1Hz,3H).ESI-MS:calcd.for C 23 H 23 N 7 m / z=397.2015,found 398.2098[M+H] + .

[0099] Embodiment 4:

[0100]

[0101] The nucleophile N-2-1 in Example 1 was replaced by N-2-4, and the remaining operations were the same to obtain the target product C-1-4 with a yield of 78%. 1 H NMR (400 MHz, DMSO-d 6 )δ10.85(s,1H),9.33(s,2H),8.42(s,1H),8.10(d,J=7.8Hz,1H),7.97(d, J=7.0Hz,1H),7.65(dd,J=16.0,8.4Hz,3H),7.49(t,J=7.7Hz,1H),7.22(t for C 22 H 24 N 6 m / z=372.2062,found 372.2142[M+H] + .

[0102] Embodiment 5:

[0103]

[0104] The nucleophile N-2-1 in Example 1 was replaced by N-2-5, and the remaining operations were the same to obtain the target product C-1-5 with a yield of 82%. 1 H NMR (400 MHz, DMSO-d 6 )δ10.88(s,1H),8.67(s,1H),8.58(s,1H),8.28–7.99(m,1H),7.86(d,J=7.2Hz,1H),7.63(q,J=8.2,7.5Hz,3H),7.48(t,J=7.7Hz,1H),7.2 2(t,J=7.4Hz,1H),6.35(d,J=7.2Hz,1H),4.45(q,J=7.1Hz,2H),3.65–3.45(m,12H),3.18(s,1H),1.32(t,J=7.1Hz,3H).ESI-MS:calcd.for C 24 H 29 N 5 O 3 m / z=435.2270,found436.2342[M+H]+ .

[0105] Embodiment 6:

[0106]

[0107] The nucleophile N-2-1 in Example 1 was replaced by N-2-6, and the remaining operations were the same to obtain the target product C-1-6 with a yield of 80%. 1 H NMR (400 MHz, DMSO-d 6 )δ10.86(s,1H),8.61(s,1H),8.54(s,1H),8.24–7.92(m,1H),7.84(d,J=7.4Hz,1H),7.61(q,J=8.3,7.4Hz,3H),7.45(t,J=7.8Hz,1H),7.2 0(t,J=7.3Hz,1H),6.32(d,J=7.4Hz,1H),4.42(q,J=7.2Hz,2H),3.61–3.40(m,18H),3.16(s,1H),1.31(t,J=7.2Hz,3H).ESI-MS:calcd.for C 26 H 33 N 5 O 4 m / z=479.2533,found480.2605[M+H] + .

[0108] Embodiment 7:

[0109]

[0110] 3,6-dioxanoic acid (1.0 equivalent), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU, 2.0 equivalent), N,N-diisopropylethylamine (DIPEA, 3.0 equivalent) were dissolved in N,N-dimethylformamide (DMF), reacted at room temperature for 30 minutes, then C-1-4 (1.0 equivalent) was added, and the reaction was continued at room temperature for 1 hour. After the completion of the reaction monitored by HPLC, the target product C-1-7 was separated by reverse phase preparative chromatography. The yield was 46%. 1 H NMR (400 MHz, DMSO-d 6)δ10.88(s,1H),9.35(s,2H),8.45(s,1H),8.14(d,J=7.6Hz,1H),7.99(d,J=7.2Hz ,1H),7.72–7.64(m,3H),7.53(t,J=7.8Hz,1H),7.25(t,J=7.6Hz,1H),6.45(d,J=7 .2Hz,1H),4.46(q,J=7.1Hz,3H),4.18(s,3H),4.12(s,3H),3.97(t,J=5.2Hz,4H), 3.72–3.54(m,4H),3.36(t,J=5.4Hz,4H),1.33(t,J=7.1Hz,3H).ESI-MS:calcd.for C 28 H 32 N 6 O 5 m / z=532.2434,found 533.2506[M+H] + .

[0111] Embodiment 8:

[0112]

[0113] The target product C-1-8 was obtained by replacing 1.0 equivalent of C-1-4 in Example 7 with 3.0 equivalents and performing the other operations in the same manner. The yield was 35%. 1 H NMR (400 MHz, DMSO-d 6 )δ10.86(s,2H),9.32(s,4H),8.43(s,2H),8.13(d,J=7.6Hz,2H),7.96(d,J=7. 2Hz,2H),7.70–7.61(m,6H),7.51(t,J=7.8Hz,2H),7.22(t,J=7.6Hz,2H),6.42( d,J=7.2Hz,2H),4.46(q,J=7.1Hz,4H),4.16(s,4H),3.94(t,J=5.2Hz,8H),3.7 2–3.54(m,4H),3.34(t,J=5.4Hz,8H),1.34(t,J=7.1Hz,6H).ESI-MS:calcd.for C 24 H 29 N 5 O 3 m / z=886.4391,found 887.4476[M+H] + .

[0114] Embodiment 9:

[0115]

[0116] The nucleophile N-1-1 in Example 1 was replaced by N-1-2, and N-2-1 was replaced by N-2-3, and the remaining operations were the same to obtain the target product C-1-9 with a yield of 52%. 1 H NMR (500MHz, Methanol-d 4 )δ8.68(s,1H),7.88(d,J=2.0Hz,1H),7.69(d,J=7.3Hz,1H),7.52–7.49(m,1H),7.42(d,J=8.6Hz,1H),7.32(d,J=1.6Hz,1H),7 .25(dd,J=8.7,2.1Hz,1H),7.11(s,1H),6.30(d,J=7.2Hz,1H),3.72(t,J=6.8Hz,2H),3.02(t,J=6.8Hz,2H).ESI-MS:calcd.for C 17 H 17 N 7 m / z=319.1545,found320.1616[M+H] + .

[0117] Embodiment 10:

[0118]

[0119] The nucleophile N-1-1 in Example 1 was replaced by N-1-3, and N-2-1 was replaced by N-2-3, and the remaining operations were the same to obtain the target product C-1-10 with a yield of 44%. 1 H NMR (500MHz, Methanol-d 4 )δ8.69(s,1H),7.87(s,1H),7.69(d,J=7.3Hz,1H),7.41(d,J=8.7Hz,1H),7.33(dd,J=8.8,2.0Hz,1H),7.26–7.22(m, 1H),7.14(s,1H),6.30(d,J=7.2Hz,1H),3.84(s,3H),3.72(t,J=6.7Hz,2H),3.02(t,J=6.7Hz,2H).ESI-MS:calcd.for C 18 H 19 N 7 m / z=333.1702,found 334.1784[M+H] + .

[0120] Embodiment 11:

[0121]

[0122] The nucleophile N-1-1 in Example 1 was replaced by N-1-4, and N-2-1 was replaced by N-2-3, and the remaining operations were the same to obtain the target product C-1-11 with a yield of 51%. 1 H NMR (500MHz, Methanol-d 4 )δ9.09(dd,J=5.1,1.5Hz,1H),8.88(d,J=8.3Hz,1H),8.80(s,1H),8.65(s,1H),8.28(q,J=9.4Hz,2H),7.94(dt ,J=18.4,6.0Hz,2H),7.38(s,1H),6.49(d,J=7.2Hz,1H),3.91(s,2H),3.17(t,J=6.5Hz,2H).ESI-MS:calcd.for C 18 H 17 N 7 m / z=331.1545,found 332.1624[M+H] + .

[0123] Embodiment 12:

[0124]

[0125] The nucleophile N-2-1 in Example 1 was replaced by N-2-7, and the remaining operations were the same to obtain the target product C-1-12 with a yield of 63%. 1 H NMR (400 MHz, Methanol-d 4 )δ8.77(s,1H),8.41(s,1H),8.08(d,J=8.1Hz,1H),7.76(d,J=7.6Hz,1H),7.66–7.48(m,4H),7.25(t,J=8.1Hz,3H),6.38(d,J=7 .3Hz,1H),4.57–4.45((q,J=7.3Hz,2H),4.40(d,J=6.1Hz,2H),3.89(d,J=6.1Hz,2H),1.45(t,J=7.3Hz,3H).ESI-MS:calcd.for C 23 H 23 N 7 m / z=397.2015,found 398.2094[M+H] + .

[0126] Embodiment 13:

[0127]

[0128] The nucleophile N-2-1 in Example 1 was replaced by N-2-8, and the remaining operations were the same to obtain the target product C-1-13 with a yield of 79%. 1 H NMR (500MHz, Methanol-d 4 )δ8.74(s,1H),8.45(s,1H),8.03(s,1H),7.74–7.68(m,1H),7.62–7.48(m,4H),7.41–7.32(m,1H),7.22(t,J=7.5Hz,2H),6.33(dd,J=7 .6,3.4Hz,1H),4.50–4.43(m,3H),4.22–4.12(m,2H),3.50(d,J=7.0Hz,2H),2.25-2.15(m,2H),1.42(t,J=7.2,3H).ESI-MS:calcd.for C 24 H 25 N 7 m / z=411.2171,found 412.2252[M+H] + .

[0129] Embodiment 14:

[0130]

[0131] The nucleophile N-2-1 in Example 1 was replaced by N-2-9, and the remaining operations were the same to obtain the target product C-1-14 with a yield of 28%. 1 H NMR (400 MHz, Methanol-d 4 )δ8.90(s,1H),8.27(s,1H),8.23–8.14(m,1H),8.09(d,J=7.8Hz,1H),7.93( s,1H),7.64–7.42(m,4H),7.22(t,J=7.5Hz,1H),6.69(d,J=6.0Hz,1H),4.47( q,J=7.9Hz,2H),4.41(d,J=6.5Hz,1H),3.84(s,3H),3.38(d,J=5.7Hz,1H),3 .27(dd,J=15.5,7.2Hz,1H),1.44(dt,J=8.5,4.2Hz,3H).ESI-MS:calcd.forC 25 H 25 N 7 O 2 m / z=455.2070,found 456.2154[M+H]+ .

[0132] Embodiment 15:

[0133]

[0134] Dissolve C-1-14 in CH 3 OH:H 2 O (4:1), add 5.0 equivalents of lithium hydroxide, react at room temperature, monitor the reaction by HPLC, and separate by preparative liquid chromatography to obtain the target product C-1-15. The yield is 92%. 1 H NMR (400 MHz, Methanol-d 4 )δ8.96(s,1H),8.26(s,1H),8.17(d,J=6.0Hz,1H),8.08(d,J=7.7Hz,1H),7.98(s,1H),7.50(td,J=14.9,7.3Hz,4H),7.21(t,J=7.2Hz,1H) ,6.67(d,J=6.0Hz,1H),4.45(q,J=7.1Hz,2H),4.34(s,1H),3.44–3.35(m,1H),3.31–3.17(m,1H),1.43(t,J=7.1Hz,3H).ESI-MS:calcd.for C 24 H 23 N 7 O 2 m / z=441.1913,found 442.1992[M+H] + .

[0135] Embodiment 16:

[0136]

[0137] C-1-15 (1.0 equivalent), N-2-3 (2.0 equivalent), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU, 1.1 equivalent), N,N-diisopropylethylamine (DIPEA, 3.0 equivalent) were dissolved in N,N-dimethylformamide (DMF), reacted at room temperature for 2 hours, and after the completion of the reaction monitored by HPLC, the target product C-1-16 was separated by reverse phase preparative chromatography. The yield was 35%. 1 H NMR (400 MHz, Methanol-d 4)δ8.92(s,1H),δ8.78(s,1H),8.22(s,1H),8.12(d,J=6.0Hz,1H),8.03(d,J =7.7Hz,1H),7.92(s,1H),7.58–7.40(m,5H),7.15(t,J=7.3Hz,1H),6.62(d ,J=6.0Hz,1H),4.42(q,J=7.2Hz,2H),4.31(s,1H),3.92–3.83(m,2H),3.41 –3.32(m,1H),3.38–3.16(m,3H),1.44(t,J=7.1Hz,3H).ESI-MS:calcd.for C 29 H 30 N 10 Om / z=534.2604,found 535.2684[M+H] + .

[0138] Embodiment 17:

[0139]

[0140] The target product C-1-17 was obtained by replacing N-2-3 in Example 16 with N-2-5 and performing the other operations in the same manner. The yield was 42%. 1 H NMR (400 MHz, Methanol-d 4 )δ8.92(s,1H),8.21(s,1H),8.12(d,J=6.1Hz,1H),8.02(d,J=7.6Hz,1H),7.94(s,1H),7.46–7.32(m,4H),7.21(t,J=7.2Hz,1H),6.65 (d,J=6.0Hz,1H),4.43(q,J=7.1Hz,2H),4.29(s,1H),3.67–3.35(m,12H),3.30–3.17(m,1H),1.43(t,J=7.1Hz,3H).ESI-MS:calcd.for C 30 H 36 N 8 O 4 m / z=572.2860,found 573.2939[M+H] + .

[0141] Embodiment 18:

[0142]

[0143] The nucleophile N-1-1 in Example 1 was replaced by N-1-5, and N-2-1 was replaced by N-2-3, and the remaining operations were the same to obtain the target product C-1-18 with a yield of 68%. 1 H NMR (500MHz, Methanol-d 4 )δ8.74(s,1H),7.75(d,J=7.2Hz,1H),7.63(s,2H),7.42(t,J=7.7Hz,2H),7.32(s,1H),7.26(d,J=7 .6Hz,1H),6.31(d,J=7.2Hz,1H),3.78(t,J=6.7Hz,2H),3.08(t,J=6.5Hz,2H).ESI-MS:calcd.forC 15 H 16 N 6 m / z=280.1436,found 281.1518[M+H] + .

[0144] Embodiment 19:

[0145]

[0146] The nucleophile N-1-1 in Example 1 was replaced by N-1-6, and N-2-1 was replaced by N-2-3, and the remaining operations were the same to obtain the target product C-1-19 with a yield of 60%. 1 H NMR (500MHz, Methanol-d 4 )δ8.74(s,1H),7.92(s,1H),7.84(d,J=2.2Hz,1H),7.74(d,J=7.2Hz,1H),7.56(d,J=8.7Hz,1H),7.48( s,1H),7.24(s,1H),6.86(s,1H),6.31(s,1H),3.75(d,J=7.2Hz,2H),3.05(s,2H).ESI-MS:calcd.forC 17 H 16 N 6 O m / z=320.1386,found 321.1462[M+H] + .

[0147] Embodiment 20:

[0148]

[0149] The nucleophile N-1-1 in Example 1 was replaced by N-1-7, and N-2-1 was replaced by N-2-3, and the remaining operations were the same to obtain the target product C-1-20 with a yield of 65%.1 H NMR (500MHz, Methanol-d 4 )δ8.73(s,1H),8.22(s,1H),7.94(d,J=8.7Hz,1H),7.77(d,J=7.2Hz,1H),7.67(d,J=5.5Hz,1H),7.57(dd,J=8.6,2.1Hz,1H) ,7.34(d,J=5.5Hz,1H),7.22(s,1H),6.36(d,J=7.2Hz,1H),3.78(t,J=6.9Hz,2H),3.07(d,J=6.8Hz,2H).ESI-MS:calcd.for C 17 H 16 N 6 S m / z=336.1157,found337.1238[M+H] + .

[0150] Embodiment 21:

[0151]

[0152] The nucleophile N-1-1 in Example 1 was replaced by N-1-8, and N-2-1 was replaced by N-2-3, and the remaining operations were the same to obtain the target product C-1-21 with a yield of 43%. 1 H NMR (500MHz, Methanol-d 4 )δ8.78(s,1H),7.72(d,J=7.2Hz,1H),7.62(s,1H),7.48–7.40(m,1H),7.33(s,1H),6.93(d,J=8.3Hz,1 H),6.29(d,J=7.2Hz,1H),3.75(d,J=6.7Hz,2H),3.55(s,2H),3.07(t,J=6.5Hz,2H).ESI-MS:calcd.for C 17 H 17 N 7 O m / z=335.1495,found 336.1578[M+H] + .

[0153] Embodiment 22:

[0154]

[0155] The nucleophile N-1-1 in Example 1 was replaced by N-1-9, and N-2-1 was replaced by N-2-3, and the remaining operations were the same to obtain the target product C-1-22 with a yield of 56%. 1H NMR (500MHz, Methanol-d 4 )δ8.78(s,1H),8.52(s,1H),8.19(s,1H),7.77(d,J=7.2Hz,1H),7.46(d,J=3.5Hz,1H),7.27(s,1H),6.49( d,J=3.5Hz,1H),6.37(d,J=7.3Hz,1H),3.91(s,3H),3.69(t,J=6.9Hz,2H),3.02(s,2H).ESI-MS:calcd.for C 17 H 18 N 8 m / z=334.1654,found 335.1732[M+H] + .

[0156] Embodiment 23:

[0157]

[0158] The nucleophile N-1-1 in Example 1 was replaced by N-1-10, and N-2-1 was replaced by N-2-3, and the remaining operations were the same to obtain the target product C-1-23 with a yield of 41%. 1 H NMR (500MHz, Methanol-d 4 )δ8.62(s,1H),7.87(s,1H),7.52(d,J=7.3Hz,1H),7.41(d,J=8.7Hz,1H),7.36–7.24(m,2H),7.18(s,1H ),6.92(d,J=7.2Hz,1H),3.81(s,3H),3.72(t,J=6.7Hz,2H),3.02(t,J=6.7Hz,2H).ESI-MS:calcd.forC 18 H 18 N 6 O m / z=334.1542,found 335.1626[M+H] + .

[0159] Embodiment 24:

[0160]

[0161] The nucleophile N-1-1 in Example 1 was replaced by N-1-3, and N-2-1 was replaced by N-2-8, and the remaining operations were the same to obtain the target product C-1-24 with a yield of 84%. 1 H NMR (500MHz, Methanol-d 4)δ8.64(s,1H),7.78(s,1H),7.63(d,J=7.3Hz,1H),7.42(d,J=8.7Hz,1H),7.35(dd,J=8.8,2.0Hz,1H),7.28–7.20(m,1H),7.1 2(s,1H),6.34(d,J=7.2Hz,1H),4.22–4.12(m,2H),3.84(s,3H),3.54(t,J=6.8Hz,2H),2.28-2.14(m,2H).ESI-MS:calcd.for C 19 H 21 N 7 m / z=347.1858,found348.1942[M+H] + .

[0162] Embodiment 25:

[0163]

[0164] The nucleophile N-1-1 in Example 1 was replaced by N-1-11, and N-2-1 was replaced by N-2-8, and the remaining operations were the same to obtain the target product C-1-25 with a yield of 71%. 1 H NMR (500MHz, Methanol-d 4 )δ8.79(s,1H),8.48(s,1H),8.07(s,1H),7.74–7.68(m,1H),7.62–7.48(m,3H),7.42–7.30(m,1H),7.26(t,J=7.5Hz,2H),6.38(dd,J=7 .6,3.4Hz,1H),4.50–4.43(m,2H),4.22–4.12(m,2H),3.50(d,J=7.0Hz,2H),2.25-2.15(m,2H),1.43(t,J=7.2,3H).ESI-MS:calcd.for C 24 H 25 N 7 O 3 Sm / z=491.1740,found 492.1826[M+H] + .

[0165] Embodiment 26:

[0166]

[0167] The nucleophile N-1-1 in Example 1 was replaced by N-1-3, and N-2-1 was replaced by N-2-10, and the remaining operations were the same to obtain the target product C-1-26 with a yield of 56%. 1 H NMR (500MHz, Methanol-d 4 )δ7.86(s,1H),7.71(d,J=7.2Hz,1H),7.49(d,J=8.6Hz,1H),7.33(dd,J=8.6,2.0Hz,1H),7.30(d,J=3.1Hz,1H),6.52(s,1H),6.31(d, J=7.3Hz,1H),3.87(s,3H),3.62(s,3H),3.49(t,J=6.6Hz,2H),3.16(s,2H),2.93(s,2H),2.58(s,1H),1.96(s,2H).ESI-MS:calcd.for C 20 H 26 N 6 Om / z=366.2168,found 367.2248[M+H] + .

[0168] (2) Detection of the inhibitory activity of EHop-016 derivatives on HinK using a reporter gene system

[0169] The reporter gene system PAO1::hinD-lux constructed above was used to detect the inhibitory activity of 26 EHop-016 derivatives, including C-1-1 to C-1-26, on HinK transcriptional regulation. The results showed that C-1-1 to C-1-26 all had inhibitory activity on HinK transcriptional regulation. C-1-3, C-1-13, and C-1-24 with better inhibitory activity were selected, and Graphpad was used to calculate the IC 50 , thereby obtaining compound C-1-3 (attached Figure 4 ), C-1-13(Attached Figure 5 ), C-1-24 (with Figure 6 ) 50 They are 17.63μM, 7.415μM and 12.28μM respectively.

[0170] 4. Detection of the interaction between HinK protein and compounds

[0171] In order to test whether EHop-016 and its derivatives can directly act on HinK protein, we expressed the N-terminal domain of HinK protein in vitro. CTD .

[0172] (1) Construction of expression vector:

[0173] His 6 -HinK CTD To express, a DNA fragment encoding the C-terminal amino acid residues (residues 91-306) of HinK was amplified from the PAO1 genome using the primer pair HinK(CTD)-F(NdeI) / HinK(CTD)-R(XhoI). The amplified DNA fragment was digested with NdeI / XhoI and cloned into pET28a to generate pET28a-HinK CTD Plasmid.

[0174] (2) Protein expression and purification

[0175] The above expression vector pET28a-HinK CTD Transformed into E. coli BL 21 , cultured overnight in 10 mL LB, diluted 1:100 into 1 L fresh LB supplemented with antibiotics, and grown at 37 °C with shaking to OD 600 ≈0.6, and the cells were induced to express HinK protein by adding 0.5mmol / L isopropyl-1-thio-bd-galactopyranoside (IPTG) and culturing at 16℃ for 16 hours. The cells were collected by centrifugation and resuspended in 50ml buffer A (20mmol / L Tris (pH 7.5), 300mmol / L NaCl, 1mmol / L dithiothreitol (DTT) and 20mmol / L imidazole). The cells were lysed by high pressure at 4℃. The lysate was centrifuged at 12000rpm / min for 25 minutes at 4℃ to remove insoluble substances and membrane parts. The supernatant was loaded onto a HisTrap HP column (GE Healthcare Life Sciences China, Shanghai, China) using a flow pump, equilibrated with buffer A and gradient eluted with buffer B (20mmol / L Tris-HCl (pH 7.5), 300mmol / L NaCl, 1mmol / L DTT and 500mmol / L imidazole). Subsequently, the purified protein was collected and loaded onto HiTrap Desalting 5×5mL (Sephadex G-25S) (GE Healthcare Life Sciences China) and eluted with buffer C (50mmol / LTris (pH 7.5), 100mmol / L NaCl and 1mmol / L DTT) to remove imidazole. The purified protein was verified by 10% (w / v) SDS-PAGE and then stained with Coomassie blue. The protein concentration was determined by the BCA method using a protein quantification kit (the specific steps were performed according to the instructions).

[0176] HinK(CTD)-FTTTCATATGGACGTGATCG CCGGGCAGAT(NdeI)

[0177] HinK(CTD)-RTTTCTCGAGTCAGTGCCGGCGCTCGGCAA(XhoI)

[0178] (3) Fluorescence labeling thermal stability shift assay to detect the interaction between EHop-016 and HinK protein

[0179] The fluorescent labeling thermal shift experiment was performed according to the literature. Sypro orange is a sensitive and environmentally friendly fluorescent dye, so it is very suitable for monitoring the process of protein denaturation and unfolding. The principle of the fluorescence-based thermal shift experiment is that when the protein unfolds, Sypro orange binds to the hydrophobic environment, resulting in enhanced fluorescence. The BioRad real-time fluorescence quantitative PCR instrument was used for the study. The specific method was as follows: the reaction system was fixed at 20 μL, HinK or HinK CTD 2 μL of protein (final concentration of the reaction system is 5 μM), 1 μL of 20×Sypro orange (Invitrogen), 2 μL of compound, 15 μL of reaction buffer, all components were added to a 96-well RT-PCR plate, and the reaction temperature was increased from 25°C to 95°C (1°C / min). Each compound concentration was divided into 4 replicate wells, and the wells without compound and protein were used as controls. After the program was completed, the data were collected and plotted using GraphPad Prism software (San Diego, USA). EHop-016 (attached Figure 7 ) and C-1-3 (with Figure 8 ), C-1-13(Attached Fig. 9 ), C-1-24 (with Fig.10 ) can make HinK CTD The thermal stability of the protein decreased, indicating that EHop-016, C-1-3, C-1-13, C-1-24, and other compounds can directly act on HinK protein.

[0180] (4) Surface plasmon resonance experiment to detect the affinity of EHop-016 and HinK protein

[0181] The principle of surface plasmon resonance (SPR) is that when a beam of light passes through a prism and is directed to a metal surface, when the metal undergoes total reflection, an evanescent wave will be generated in the metal film. When the evanescent wave resonates with the surface plasmon wave, the detected reflected light intensity will be greatly weakened. At this time, the corresponding wavelength of the incident light is the resonance wavelength, and the corresponding angle of incidence is the resonance angle, i.e., the SPR angle. The SPR angle changes with the change in the refractive index of the metal surface, and the change in the refractive index is proportional to the molecular mass bound to the metal surface. Its core components consist of a microfluidic system, optical components, and a gold film chip. During the process of binding and dissociation between the protein on the gold film chip and the molecules in the flow path, the SPR angle will change accordingly. The detector detects this change, and based on the graphical analysis of this change curve, the binding constant Ka, dissociation constant Kd, or affinity constant K between the molecules can be obtained. D In this study, we mainly used SPR experiments to analyze the interaction between HinK protein and EHop-016 and its derivatives: HinK protein was fixed on the COOH sensor chip by coupling, the chamber was balanced with PBS, and then the compound was dissolved in PBS. A series of concentrations of the compound were slowly injected into the chamber at 25°C, with a binding time and a dissociation time of 240s and a flow rate of 20μL / min. TraceDrawer software (Ridgeview InstrumentsAB, Sweden) was used to retrieve and analyze the data and fit the data to a one-to-one model. EHop-016( Fig.11 )、C-1-13( Fig.12 )、C-1-24( Fig.13 ) and HinK protein affinity constant (K D ) were: 15.6μM, 71.4μM, 15.1μM respectively.

[0182] 5. Compound anti-infection detection

[0183] Zebrafish are vertebrates with a fully developed immune system, and zebrafish genes have a high homology with mammalian cell genomes, so they are a good animal infection model that can simulate the efficacy of human drugs. We purchased commercial experimental zebrafish (300±50mg) on ​​the market, placed the zebrafish in a 26℃ constant temperature water tank for adaptive culture before the experiment, and fed them regularly for at least three days. First, the safety of the compound in zebrafish was tested by intraperitoneal injection of the compound (25, 50 or 100mg / kg), and the compound was dissolved in 2% DMSO, 30% PEG300, 5% Tween 80 and ddH 2O solvent. Next, the appropriate amount of bacteria required for infection in the experiment was determined, and healthy zebrafish were randomly divided into groups (no less than 10 in each group). 4 μL of bacteria with different amounts were injected into the zebrafish's peritoneal cavity, followed by 3 μL of compounds or solvents of different concentrations for treatment. One group was intraperitoneally injected with sterile PBS to exclude the possibility of zebrafish death outside the infection. The survival rate of zebrafish was then monitored within 5 days. The abdomen of zebrafish that died after infection was red. The death of zebrafish was recorded every day, and the zebrafish survival curve was drawn using Graphpad software. Among them, compounds EHop-016, C-1-13, and C-1-24 can effectively improve the survival rate of zebrafish infected with Pseudomonas aeruginosa (see Appendix Fig.14 and attached Fig.15 ).

[0184] The embodiments described above provide a detailed description of the technical solutions and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, supplements and equivalent substitutions made within the scope of the principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A compound as represented by formula (I), or a prodrug, deuterated substance, or pharmaceutically acceptable salt thereof, characterized in that: Wherein, X and Y are independently selected from nitrogen, oxygen, sulfur, or are absent; R 1 is selected from substituted or unsubstituted phenyl, quinolyl, benzothiophenyl, benzofuranyl, indolyl, 1,3-dihydro-indol-2-one, and carbazolyl; R 2 -linker-R'; linker is an alkyl chain with a length of 0-12 atoms, containing or not containing nitrogen, oxygen, or sulfur atoms, or does not exist; R' is a substituted or unsubstituted imidazolyl, azacycloalkyl, azacycloalkyl, or does not exist; R 3 is one or more hydrogen, halogen or alkyl substituents; The compound represented by formula (I) is not 2. The compound of formula (I) according to claim 1, or its prodrug, deuterated substance, or pharmaceutically acceptable salt, characterized in that: R 1 In the above, the substituent on the phenyl, quinolyl, benzothienyl, benzofuranyl, indolyl, 1,3-dihydro-indol-2-one or carbazolyl group is a C1-C5 alkyl group.

3. The compound of formula (I) according to claim 1, or its prodrug, deuterated substance, or pharmaceutically acceptable salt, characterized in that: X, Y are nitrogen; R 1 is an N-alkyl-substituted carbazolyl or an N-alkyl-substituted indolyl; R 2 is -linker-R', linker is a C1-C5 alkyl chain, R' is a substituted or unsubstituted imidazole group; R 3 For hydrogen.

4. The compound of formula (I) according to claim 1, or its prodrug, deuterated substance, or pharmaceutically acceptable salt, characterized in that: The compound represented by formula (I) is selected from:

5. The compound of formula (I) according to claim 1, or its prodrug, deuterated substance, or pharmaceutically acceptable salt, characterized in that: The compound represented by formula (I) is selected from:

6. A pharmaceutical composition, characterized in that The invention comprises a compound as shown in formula (I) according to any one of claims 1 to 5, or a prodrug, deuterated substance, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

7. A HinK inhibitor, characterized in that It comprises a compound as shown in formula (I) as described in any one of claims 1 to 5, or a prodrug, deuterated substance, or pharmaceutically acceptable salt thereof.

8. Use of a compound of formula (I) as claimed in any one of claims 1 to 5 or a prodrug, deuterated substance or pharmaceutically acceptable salt thereof in the preparation of an anti-Pseudomonas aeruginosa infection drug targeting HinK.

9. Use of EHop-016 in the preparation of an anti-Pseudomonas aeruginosa infection drug targeting HinK.

Images