Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

27results about How to "High reusability" patented technology

Composite cable and method for manufacturing the same

The application belongs to the technical field of cable manufacturing, and specifically discloses a composite cable and a preparation method thereof, which comprises an inner sheath, the inner sheath is internally provided with connecting sleeves, the connecting sleeves are internally provided with connecting cores, the inner sheath is internally provided with first filling layers at the outer walls of the connecting sleeves, the outer wall of the inner sheath is circumferentially provided with control cores, the outer wall of the inner sheath is provided with an insulating layer, the control cores are located in the insulating layer, the gap between the control cores and the insulating layer is filled with a second filling layer, the second filling layer is connected with the outer wall of the inner sheath, the middle part of the outer wall of the insulating layer is provided with a reinforcing shielding layer, and the outer wall of the insulating layer is provided with a buffer sleeve. The application improves the mechanical reliability, anti-interference ability and service life of the cable in a poor environment.
Owner:WUXI SHUGUANG CABLE

Method for treating antibiotic wastewater by using graphite diacetylene / iron sulfide indium nanocomposite activated persulfate

The application discloses a method for treating antibiotic wastewater by using a graphdiyne / ferrous indium sulfide nanocomposite to activate persulfate, and the method is characterized by using the graphdiyne / ferrous indium sulfide nanocomposite as a catalyst to activate persulfate for degrading and treating antibiotic wastewater, wherein the graphdiyne / ferrous indium sulfide nanocomposite comprises ferrous indium sulfide nanoparticles, and the nanoparticles are loaded with graphdiyne nanosheets. The method for treating antibiotic wastewater by using the graphdiyne / ferrous indium sulfide nanocomposite to activate persulfate uses the graphdiyne / ferrous indium sulfide nanocomposite as a catalyst, wherein the nanocomposite has many reactive sites, high catalytic activity and good stability, can efficiently activate persulfate with a smaller amount of catalyst, can efficiently remove antibiotics in wastewater, and has the advantages of low cost, high treatment efficiency, good removal effect, green environmental protection and the like, and therefore, the method has important significance for effectively purifying antibiotic wastewater, has high use value and good application prospect.
Owner:ZHEJIANG NORMAL UNIV

Concrete wall steel bar formwork positioning and supporting frame

The utility model relates to the field of positioning supporting frames, and discloses a concrete wall steel bar formwork positioning supporting frame which comprises a bottom plate, a movable sliding plate with the adjustable position is arranged on the bottom plate, a rectangular installation frame is fixedly installed on the movable sliding plate, and a hinge supporting rod and a hinge rod are hinged to the two sides of the interior of the rectangular installation frame respectively. The hinge rod is supported at the bottom of the hinge supporting rod, a locking assembly is arranged on one side of the rectangular mounting frame and used for locking the inclination angle of the hinge supporting rod, an attaching plate is arranged at the tail end of the hinge supporting rod, and the position of the whole supporting device can be easily and transversely adjusted through a movable sliding plate capable of sliding on the bottom plate. And the requirements of templates at different positions can be met. Meanwhile, the inclination angle of the hinged supporting rod can be freely adjusted around the hinged point of the rectangular mounting frame, the hinged supporting rod slides in the strip-shaped groove in a matched mode, the supporting requirements of formworks of different heights and gradients can be accurately met, and the adaptability of the supporting system to various construction scenes is greatly improved.
Owner:INNER MONGOLIA URBAN CONSTRUCTION GROUP CO LTD

A polymer probe, its preparation method and application

The application discloses a polymer probe and a preparation method and application thereof, and belongs to the technical field of chemical probes.The structural formula of the polymer probe provided by the application is shown as formula (I): in the formula (I), x and y are each independently selected from any integer in 1-3000.The polymer probe has good water solubility, obvious visual color change for sulfur dioxide and derivatives thereof, and can be used for qualitative or quantitative detection of sulfur dioxide and derivatives thereof in water; meanwhile, the polymer probe has thermal response performance, can be recycled and reused by heating after a reaction of the polymer probe with sulfur dioxide and derivatives thereof in an aqueous solution is completed, is used for secondary analysis and identification of sulfur dioxide and derivatives thereof, has good reusability, is favorable for cost reduction, and has wide application in detection of sulfur dioxide and derivatives thereof.
Owner:GUANGDONG UNIV OF TECH

An acid pickling tank

An acid washing tank, comprising a tank body, a tank cover arranged on the tank body, a filtering channel arranged on one side of the tank body for filtering acid washing liquid, a filter screen arranged in the filtering channel and detachably connected with the filtering channel, the filter screen comprising a fixing portion arranged on one side, a fixing groove fixedly connected with the fixing portion arranged on one side of the filtering channel, an insertion groove arranged on the other side of the filter screen, a connecting block arranged on the filtering channel and matched with the insertion groove, a locking track arranged in the insertion groove, and a locking shaft arranged on the connecting block and used for being clamped with the locking track to form a fixed connection.
Owner:ZHEJIANG BAITONG ANTICORROSION EQUIP CO LTD

A capturing agent for separating propylene-propane mixed gas, a preparation method thereof, and a method for separating propylene-propane mixed gas

ActiveCN118663233Bshort equilibration timeFast desorption
The application provides a kind of propylene propane mixed gas separation trapping agent and its preparation method and propylene propane mixed gas separation method.The trapping agent includes solid adsorbent and organic solvent;The solid adsorbent is CALF-20;With the total mass of the trapping agent as 100%, the content of the solid adsorbent is 5wt%-45wt%, and the content of the organic solvent is 55wt%-95wt%.The MOF slurry trapping agent provided by the application has excellent effect on gas separation, with high propylene adsorption capacity, high propylene / propane selectivity, short equilibrium time, fast desorption speed, high regeneration performance and other advantages.
Owner:BEIJING YIMOLU MATERIAL TECH CO LTD +1

High-efficiency pier concrete curing device

The utility model discloses a kind of high-efficiency pier concrete health-cultivation devices, including the water storage tank being arranged at the top of pier and the health-cultivation coating being wrapped in the outside of pier, the water storage tank bottom is equipped with drip irrigation valve;The health-cultivation coating sequentially includes capillary wicking layer and waterproof water-locking film layer from inside to outside;The waterproof water-locking film layer is a cloth and film structure;The capillary wicking layer is composed of geotextile nonwoven fabric layer and superabsorbent resin particle layer, wherein superabsorbent resin particle is evenly distributed on the surface of geotextile nonwoven fabric layer side and is fixed on geotextile nonwoven fabric layer by adhesive, the geotextile nonwoven fabric layer periphery is fixed with the cloth layer periphery corresponding to waterproof water-locking film layer, and the superabsorbent resin particle layer is arranged towards waterproof water-locking film layer;Water distribution mechanism is connected with drip irrigation valve, and water is drained to the periphery of the top of pier. The utility model does not need external power, and only relies on gravity and capillary effect to realize uniform, long-acting, water-saving automatic health-cultivation.
Owner:CCCC SHEC FIRST HIGHWAY ENG

Gas sensitive membrane of a MEMS gas sensor and method for producing the same

PendingCN122588508Aquick responseshort recovery time
This invention relates to the field of gas sensor technology, and more particularly to a gas-sensitive film for a MEMS gas sensor and its preparation method. The gas-sensitive film comprises: a SnO2 substrate, an Ag first coating layer, and a Pd second coating layer. The substrate thickness is 300-500 nm, and the Ag and Pd coating layers are both less than 10 nm thick, with both layers exhibiting a dotted distribution. The gas-sensitive film is prepared by magnetron sputtering on a micro-heating plate substrate. The micro-heating plate substrate includes a micro-heating plate coated with a silicon nitride insulating protective layer and a base, with a cavity between the micro-heating plate layer and the base. This invention, through the combined modification of Pd and Ag, achieves a gas-sensitive material with faster response speed, shorter recovery time, and better stability. This method is simple to prepare and has low manufacturing costs. It not only significantly enhances the adhesion between the gas-sensitive film and the substrate but also significantly improves the response rate and stability of the gas-sensitive film, greatly enhancing the sensor's sensitivity and making it suitable for large-scale mass production.
Owner:CHANGZHOU RES INST OF CHINA COAL TECH & ENG GRP +1

A seawater-based anion exchange membrane water electrolysis hydrogen production system and method

The application discloses a seawater-based hydrogen production system for water electrolysis by an anion exchange membrane, comprising an anion exchange membrane electrolysis tank unit, a hydrogen gravity separation unit, a hydrogen washing unit, a hydrogen purification unit, an oxygen gravity separation unit, an oxygen washing unit, an oxygen gas-liquid separation unit, a weak alkali liquid circulation unit, a heat exchange unit, a flash evaporation unit, a seawater desalination unit, a vacuum pump unit, a seawater filtration and barge transportation unit and a fresh water storage and supply unit. The application can circulate fresh water between the flash evaporation unit and the heat exchange unit, realize the repeated use of fresh water, and heat the circulating fresh water by using the weak alkali liquid which needs to be cooled, and then flash evaporate the hot fresh water, generate steam as a heat source to heat seawater of the seawater desalination unit, and desalinate the seawater under a negative pressure environment to prepare fresh water which can be used as raw material fresh water of the anion exchange membrane electrolysis tank unit.
Owner:DALIAN INSTITUTE OF CHEMICAL PHYSICS CHINESE ACADEMY OF SCIENCES

Supporting device for steel-concrete composite beam wing plate

ActiveCN224716958USimplify the disassembly processHigh reusability
The utility model belongs to bridge floor construction technical field discloses a kind of support device suitable for steel concrete composite beam wing plate.The first support piece in support device is detachably arranged at the bottom of the second support piece, and the support assembly is low in dismounting difficulty and high in dismounting efficiency. The adjacent support assemblies in the same support structure are provided with elastic locks, and the first end of the elastic lock can abut against the inner wall surface of the first support piece when it is elastically deformed, and the second end can abut against the inner wall surface of the second support piece. A single elastic lock can lock the first support piece and the second support piece of the same support assembly, improving the connection strength of the first support piece and the second support piece. The adjacent support assemblies in a single support structure can be locked by the locking mechanism, and the adjacent support structures are connected to each other, ensuring the structural self-stability of the support device and improving the overall support effect of the support platform on the steel concrete composite beam wing plate, thereby ensuring the construction and construction quality of the steel concrete composite beam.
Owner:TENGDA CONSTR GROUP CORP

Biofilm catalyst with laccase displayed on surface as well as preparation method and application of biofilm catalyst

The invention discloses a genetically engineered bacterium for displaying laccase on the surface. The genetically engineered bacterium comprises a recombinant expression vector, the fusion protein expressed by the recombinant expression vector comprises a bacterial lipoprotein signal peptide, an outer membrane protein transmembrane anchoring structural domain and a laccase catalysis structural domain. The bacterial lipoprotein signal peptide and the outer membrane protein transmembrane anchoring structural domain are derived from Lpp-OmpA anchoring protein and are used for directionally transferring the laccase catalytic structural domain to periplasmic space and anchoring the laccase catalytic structural domain on the outer membrane surface of genetically engineered bacteria. The mycoderm catalyst disclosed by the invention has the characteristics of simplified preparation process, improved operation stability, reusability and the like, the treatment cost can be remarkably reduced, and the removal efficiency of endocrine disrupters in complex water bodies is improved.
Owner:JIANGSU UNIV OF TECH

A low dielectric constant filter membrane based on biological enzymes, its preparation method and application

The present invention discloses a low dielectric constant filter membrane based on biological enzymes. The preparation method includes drying the low dielectric constant filter membrane, dropping biological enzymes onto the surface of the dried filter membrane and then freeze-drying. After the moisture has completely evaporated, the low dielectric constant filter membrane based on biological enzymes is obtained. At the same time, the present invention also discloses the application of the low dielectric constant filter membrane based on biological enzymes in a waveguide gas sensor. After fixing the low dielectric constant filter membrane based on biological enzymes on the resonance window of the resonator in the waveguide gas sensor, the sensor is assembled and tested. By using a filter membrane with a small volume that is convenient for installation and disassembly, the present invention is conducive to repeatedly testing the same sample multiple times, has good reusability, and the low dielectric constant filter membrane based on biological enzymes has good air permeability, which can enable the enzymes to fully contact with the gas, further improving the sensitivity of the sensor.
Owner:JILIN UNIVERSITY

Preparation method of electrochemical uranium extraction electrode material and electrochemical uranium extraction device

This invention discloses a method for preparing an electrochemical uranium extraction electrode material and an electrochemical uranium extraction apparatus. The preparation method includes: continuously cleaning iron foil in an ultrasonic cleaner using acetone, ethanol, and deionized water, followed by vacuum drying; then annealing the dried iron foil in an alumina crucible in air to generate Fe. 3 O 4 foil; then Fe 3 O 4 Foil soaked in Co(NO) 3 ) 2 ·6H 2 After soaking in solution O, the Fe was dried in a vacuum dryer, and then the dried Fe was... 3 O 4 The foil was annealed in air to complete the first cobalt loading, yielding Co. 3 O 4 @Fe 3 O 4 -1, repeated loading, yielding Co 3 O 4 @Fe 3 O 4 Nanosheet array; this invention is applied to the working electrode of a three-electrode electrochemical workstation for uranium removal. This invention has the following advantages: it can greatly accelerate the capture and reduction of uranium in electrochemical uranium removal, improve the uranium extraction rate, and has excellent uranium extraction capabilities. At the same time, the manufacturing process is simple and the cost is low.
Owner:SOUTHWEAT UNIV OF SCI & TECH +1

Purline mounting structure for steel structure wall surface

The utility model discloses a steel structure wall purline installation structure which comprises a plurality of steel columns, the top of each steel column is fixedly connected with a roof beam, the bottom of each steel column is fixedly connected with a ground foundation, purlin supports are arranged on the lower portions of the steel columns, a fixed support is installed at the bottom of each steel column, and a synchronous lifting motor is installed on each fixed support. A bracket is fixed at the top of the steel column; a fixed pulley is fixed on the bracket; the synchronous lifting motors at the two left-right adjacent steel columns form a lifting structure, rotating shafts of the two synchronous lifting motors of the lifting structure are each fixedly connected with one end of a steel wire rope, and the other end of each steel wire rope is led out upwards and bypasses the fixed pulley on the corresponding steel column. The left steel wire rope and the right steel wire rope are fixed to the left end and the right end of the to-be-installed purline correspondingly; and a sliding rope is tied on the purline. By adopting the structure, quick installation can be realized, and the construction efficiency is improved.
Owner:CHINA CONSTR SIXTH ENG BUREAU CIVILENG +1

Board-to-board connector and board-to-board connection structure

A board-to-board connector and a board-to-board connecting structure, the connector comprising a connecting seat and a connecting piece connected to each other, the connecting seat comprising a seat body with a mounting cavity, a locking piece and a pressing piece; the locking piece is arranged on the inner wall of the mounting cavity and extends towards the central axis of the mounting cavity, the locking piece divides the mounting cavity into a first cavity and a second cavity which are in communication along the axial direction, and the locking piece has elasticity; the pressing piece extends into and is clamped in the first cavity, and the pressing piece has a communication hole, and the connecting piece can extend into or exit the communication hole. The pressing piece can move towards the second cavity under the action of external force and prop open the locking piece, at this time the connecting piece can extend into the second cavity through the communication hole; the pressing piece can also automatically reset after the external force is removed, at this time the locking piece clamps the connecting piece to lock and electrically connect the connecting piece. The connector of the application can realize board-to-board interconnection, such a quick plug-in connector is simple and fast to assemble, convenient to maintain and replace, low in detection cost, more environmentally adaptable, and reusable.
Owner:HONGQISHENG PRECISION ELECTRONICS (QINHUANGDAO) CO LTD +1

A linear electronic fence calculation method based on path planning

This invention provides a linear electronic fence calculation method based on path planning, comprising: obtaining the vehicle's navigation path; setting the basic radius R0 of the electronic fence according to the navigation path; determining each road segment in the journey based on neighboring nodes on the navigation path; and obtaining the positioning accuracy R at each node on the navigation path. x Positioning accuracy R x This represents the positioning error distance of the vehicle's positioning system at the current node due to the influence of the surrounding environment; two circles with radius R are drawn, centered on the two nodes of each road segment. The radius R is the base radius R0 and the positioning accuracy R... x The method involves drawing two common external tangents to two circles on the same road segment. These two tangents, combined with the two circles, form a smooth, pocket-shaped region. Connecting these smooth, pocket-shaped regions end-to-end across all road segments creates a linear electronic fence. This method can quickly generate high-precision linear electronic fences, enabling timely and accurate detection of vehicle deviations.
Owner:HUNAN XINGBIDA NETLINK TECH CO LTD

Lightweight hydrophobic anti-freezing fly ash-based prefabricated part as well as preparation method and application thereof

ActiveCN121992698AEasy to reserveOvercome the difficulty of preparation methodsLamination ancillary operationsSolid waste managementCompressive resistanceSlurry
The invention belongs to the technical field of concrete prefabricated parts, and particularly relates to a light hydrophobic anti-freezing fly ash-based prefabricated part as well as a preparation method and application thereof. The foundation prefabricated part is composed of a filling core layer, a base body layer wrapping the filling core layer, a hydrophobic surface layer wrapping the base body layer and a blocked reserved hole. The reserved hole penetrates through the substrate layer on one side and the hydrophobic surface layer; the hydrophobic surface layer is prepared from stearic acid modified bentonite, cement, mineral powder and water, and the water-cement ratio of slurry of the hydrophobic surface layer is 0.1-0.3; the matrix layer is prepared from cement, fly ash, silica fume, stone chips, a water reducing agent and water, and the water-cement ratio of a mixture of the matrix layer is 0.1-0.3; the filling core layer is formed by blending one or more of fly ash, red mud and saw mud. The breaking strength and the compressive strength of the prefabricated part are equivalent to those of a cement prefabricated part of the same specification, but the density is greatly reduced, the water absorption rate is low, the frost resistance and the salt freezing resistance are greatly improved, and efficient utilization of solid waste is achieved.
Owner:山东高速工程检测有限公司

Catalyst for synthesizing cyclic carbonate and preparation method thereof

The invention discloses a catalyst for synthesizing cyclic carbonate and a preparation method of the catalyst. The catalyst is MO (at) Ag-HOF; wherein Ag-HOF represents a hydrogen bond organic framework material [Ag (HMCTA) (H2MCTA)] synthesized from AgNO3 and 5-methyl-1-(4-carboxyl phenyl)-1H-1, 2, 3-triazole-4-formic acid (H2MCTCA), and the chemical formula of the Ag-HOF is shown in the description. When the MO-Ag-HOF catalyst is used for cyclization synthesis of trimethylene carbonate from CO2 and 3-chloro-1-propanol, the catalytic activity is high, the reusability is good, and the yield of the product is greatly improved.
Owner:CHINA PETROLEUM & CHEMICAL CORP +1

Multifunctional tableware packaging box

ActiveCN224198176UAchieve combination decorationHigh reusabilityPackage recyclingRigid containersStructural engineeringIndustrial engineering
The utility model provides a multifunctional tableware packaging box, which relates to the technical field of packaging boxes, and comprises a top seat, an upper shell, a bracket and a base, the top seat is fixedly connected with the upper shell, the upper shell is detachably clamped on the bracket, a socket is arranged below the bracket, a first clamping groove is formed in the bottom end of the socket, and a group of insertion legs are formed in the positions, located on the two sides of the first clamping groove, of the socket; a second clamping groove and a third clamping groove are formed in the upper end of the base, and the second clamping groove and the third clamping groove are arranged in a crossed mode; the strip-shaped packaging sub-boxes are clamped in the third clamping grooves, the upper surfaces of the strip-shaped packaging sub-boxes are flush with the upper surface of the base, the insertion legs are inserted into the second clamping grooves in the two sides respectively, and the first clamping grooves are clamped in the strip-shaped packaging sub-boxes. According to the multifunctional tableware packaging box, combined containing of various tableware can be achieved, meanwhile, the multifunctional tableware packaging box can be used as a lantern box after being packaged and used, and repeated utilization is achieved.
Owner:CHONGQING SANHANG ADVANCED MATERIALS RES INST CO LTD

A mutant strain Cbg61-T37, a co-expression strain Cbg61-T37-MPR1 and a construction method and application thereof

ActiveCN121160502BGood hydrolysis activityImprove hydrolysis activityFungiTransferasesGinsenoside CKMicroorganism
The application relates to the field of biotechnology, and particularly discloses a mutant strain Cbg61-T37, a co-expression strain Cbg61-T37-MPR1 and a construction method and application thereof. The mutant strain Cbg61-T37 is preserved in the China General Microbiological Culture Collection Center on August 18, 2025, has a preservation number of CGMCC No. 35649, and is classified and named as Pichia pastoris. Pichia pastoris The mutant strain Cbg61-T37 provided by the application has an enzyme hydrolysis activity of 62.9 U / mg, which is increased by 43.8% compared to the original strain. Therefore, the mutant strain Cbg61-T37 is more conducive to catalysis and synthesis of the rare ginsenoside CK.
Owner:NORTHWEST UNIV

Phospholipase A1 gene and application thereof

PendingCN121975829AHigh reusabilityEfficient technical routeImmobilised enzymesFungiNucleotideNucleotide sequencing
The invention discloses a phospholipase A1 gene and application thereof, and relates to the technical field of bioengineering, and the key points of the technical scheme are as follows: the nucleotide sequence of the phospholipase A1 gene is as shown in SEQ ID No.1; a specific primer for expanding the gene of the phospholipase A1 is F-pPink: CGAGAAAGGCCTATGTTTCTTGGCTAGATT, and a specific primer for expanding the gene of the phospholipase A1 is F-pPink: CGAGAAAGGCCTATGCTGCTAGATT; r-pPink: GTAGTAGTAGTGATTCCATGGCCGGCCGGTA, and R-pPink:
Owner:QINGDAO SHENGCHUANG JINGHE BIOTECHNOLOGY CO LTD

Methods for preparing adsorbents

This invention provides a method for preparing an adsorbent, comprising: obtaining a first raw material, which is ginkgo leaves; pretreating the first raw material to obtain a raw material to be treated; pyrolyzing the raw material to obtain a pyrolysis product; grinding the pyrolysis product to obtain a ground product; obtaining a second raw material; ultrasonically treating the second raw material; reacting it with an alkaline solution to form a precipitate and stirring to obtain a mixture; passing the mixture and the ground product into a hydrothermal reactor for a hydrothermal reaction to obtain a hydrothermal reaction product; and post-treating the hydrothermal reaction product to obtain an adsorbent. This method solves the problem of zirconium oxide's inability to absorb SO4 in the prior art. 2‑ There are issues with the potential for loss during the process and the need to add additional solid-liquid separation equipment.
Owner:SHENHUA XINJIANG ENERGY CO LTD

A method for preparing fatty acids from acidulated oil

ActiveCN121380227BLittle effect on acid valueIncrease hydrolysis rateHydrolasesOn/in organic carrierCalcium nitrate tetrahydrateSilicic acid
This invention discloses a method for preparing fatty acids from acidified oil, belonging to the field of biochemical engineering. The method includes preparing an immobilized lipase and enzymatic hydrolysis; the preparation of the immobilized lipase includes preparing a carrier and immobilization; the preparation of the carrier involves placing magnetic Fe... 3 O 4 The granules, anhydrous ethanol, deionized water, and ammonia were mixed, stirred at room temperature, and ultrasonically vibrated. Then, they were mixed with tetraethyl orthosilicate, stirred at room temperature, collected by magnetic decantation, and washed to obtain Fe. 3 O 4 @SiO 2­ Particles; Fe 3 O 4 @SiO 2­ Granules, hexadecyltrimethylammonium bromide, and deionized water are mixed and stirred. Calcium nitrate tetrahydrate is added and stirred. The pH value is adjusted to 9.5-10. Diammonium hydrogen phosphate aqueous solution is added dropwise and the pH value is stabilized at 9.5-10. The mixture is stirred and collected by magnetic decantation. The method of this invention can simultaneously achieve high hydrolysis rate and good reusability, and the hydrolysis rate is less affected by the acid value of acidified oil.
Owner:WEIFANG DAMING CHEM CO LTD +2

Reusable sealed sample pool

The invention discloses a reusable sealed sample cell which is convenient to operate, good in reusability, long in service life and suitable for most of materials, a nut cover is screwed downwards through cooperation of an internal thread and an external thread, a sealing ring is deformed through applied pressure, a gap between the nut cover and the sealing ring is filled with the sealing ring, and gas sealing can be effectively achieved.
Owner:DALIAN INSTITUTE OF CHEMICAL PHYSICS CHINESE ACADEMY OF SCIENCES

Nickel-copper co-doped covalent organic framework material as well as preparation method and application thereof

The invention belongs to the technical field of material preparation and environment, and particularly relates to a nickel-copper co-doped covalent organic framework material and a preparation method and application thereof. The preparation method comprises the following steps: mixing 1, 3, 5-trimethylphloroglucinol, benzidine, nickel chloride, copper chloride, 1, 3, 5-trimethylbenzene and 1, 4-dioxane, adding glacial acetic acid as a catalyst, carrying out a hydrothermal reaction, and washing and drying after the reaction is finished, so as to obtain the nickel-copper co-doped covalent organic framework material. The removal rate and the maximum adsorption capacity of the material to BPAF reach 97.1% and 212.8 mg g <-1 > respectively, the removal rate of the material to BPAF can still be kept at 97.1% or above after five times of adsorption-desorption cycles, and excellent stability and adsorption performance are shown. In addition, the material can be successfully applied to three actual water bodies, namely deionized water, tap water and Xiau lake water, and has a wide application prospect in the fields of actual water body remediation and pollution control.
Owner:ZHONGHUI ENVIRONMENTAL DEVELOPMENT CO LTD +1