Application of cultivated soybean SDR family gene GmGAE47

Abstract

The invention discloses an application of a soybean SDR family gene GmGAE47 in cultivation. The invention discloses a cultivated soybean GmGAE47 protein coding gene GmGAE47. The nucleotide sequence of the cultivated soybean GmGAE47 protein coding gene is SEQ ID NO. 1. The constructed plant overexpression vector Pba002-GmGAE47 is subjected to heterologous expression in a wild type of arabidopsis thaliana, and it is found that a transgenic plant changes in the aspects of plant height, thousand seed weight and grain width characters. The gene can be introduced into a plant as a target gene, and the plant height and yield of the transgenic plant are regulated and controlled through the expression of the GmGAE47 gene. Therefore, the cultivated soybean GmGAE47 protein coding gene GmGAE47 disclosed by the invention can be applied to the aspects of regulating the plant height, increasing the thousand seed weight, the grain width and the like through genetic engineering.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering and relates to the application of a cultivated soybean SDR protein family gene GmGAE47, and specifically relates to the application of an SDR protein family gene GmGAE47 derived from cultivated soybean and related to seed development in regulating traits such as plant height, 1000-grain weight and grain width. Background Art

[0002] Grain development is a key link in the growth and development of crops. Grain weight is closely related to crop yield and agricultural product quality, and directly affects agricultural production efficiency. Therefore, improving crop grain weight is of great significance for high-yield breeding and agricultural production.

[0003] The SDR (short-chain dehydrogenase / reductase) family, also known as the short-chain dehydrogenase / reductase family, is widely present in various biological forms, such as archaea, prokaryotes, eukaryotes and viruses. It is one of the oldest and largest protein superfamilies known to date (Jornvall et al., 1995; Kallberg et al., 2002). Most SDR members are NAD(P)(H)-dependent oxidoreductases with diverse catalytic functions. Their substrates include polyols, vitamins, steroids, fatty acid derivatives and xenobiotics (Oppermann et al., 2003; Zhang Yueting et al., 2020). This superfamily includes retinol dehydrogenases (RDH), hydroxysteroid dehydrogenases (HSD), carbonyl reductases (CBR), 15-hydroxyprostaglandin dehydrogenase (15-PGDH), UDP-glucose 4-epimerase (GAE) and GDP-mannose 4,6-dehydratase (GMDS), etc., and plays an important role in lipid, amino acid, carbohydrate, hormone, xenobiotic metabolism and redox reaction sensing mechanisms.

[0004] Among them, GAE is a key enzyme that catalyzes the conversion of UDP-glucuronic acid to UDP-galacturonic acid. Galacturonic acid is an essential precursor for pectin synthesis. This enzyme is widely present in plants and affects the growth and development of plants. The Arabidopsis AtGAEs gene family contains 6 members, which belong to the type II membrane protein of the SDR family. It is predicted that none of them have introns. All members of this family contain the conserved motif GxxGxG related to NAD(P)+ binding (Gu et al., 2004). The AtGAE04 antisense gene was transformed into Arabidopsis and tobacco respectively. The callus formed by transgenic Arabidopsis was smaller and late; most of the transgenic tobacco had obvious growth restrictions, which showed that the plants were short, grew slowly, had long and thin leaves, and were difficult to form complete plants and eventually died. Only a few transgenic tobacco grew normally, indicating that the antisense AtGAE04 gene can indeed interfere with the normal expression of GAE family genes, reduce pectin content, and affect the normal adhesion of tobacco cells (Rhee et al., 1998). Pang et al. (2008) proved that the expression level of GhGAE1 increased significantly during the elongation period of cotton fibers, and GhGAE3 was efficiently expressed during the rapid elongation period of cotton fibers, indicating that GhGAEs have an important effect on the length of cotton fibers. Li et al. (2020) found that the gene GmST1 that controls soybean grain thickness, whose Arabidopsis homologous gene is AtGAE06, affects seed fullness by affecting pectin biosynthesis and glycolysis pathways. Soybean seeds overexpressing ST1 contain more and larger cells than the control. The Arabidopsis homologous gene of GmGAE47 involved in this article is AtGAE01. Studies have shown that GAE1 and GAE6 are evolutionarily older than other GAE family members, with a similarity of 76%, and may have overlapping functions different from other GAE family members. It is speculated that they may have important functions in soybean grain development. Summary of the invention

[0005] The purpose of the present invention is to disclose a soybean SDR family gene GmGAE47.

[0006] Another object of the present invention is to provide genetic engineering applications of the gene in plant height, thousand-grain weight and grain width.

[0007] Our laboratory conducted linkage analysis on the 100-grain weight trait data of 186 recombinant inbred families and discovered a gene from the SDR protein family, Glyma.17G069600, in the candidate segment on chromosome 17. It encodes UDP-glucose 4-glucose isomerase, named GmGAE47 in this article. The protein has a transmembrane domain from amino acids 2 to 152 and an epimerase domain at the C-terminus. This domain is widely present in proteins that use NAD as a cofactor and nucleotide-sugar substrates for various chemical reactions. As a key coenzyme in the metabolic network, NAD participates in multiple metabolic pathways such as glycolysis and lipid biosynthesis. Phenotypic observation of the Arabidopsis TDNA insertion mutant gae47 (SALK_085554C) showed that the 1000-grain weight and grain width of the phase mutant were significantly reduced. It is speculated that it may regulate grain development by participating in the plant sugar and lipid metabolism process, so the biological function of GmGAE47 was preliminarily studied.

[0008] The purpose of the present invention can be achieved through the following technical solutions:

[0009] The cultivated soybean SDR family gene GmGAE47, the nucleotide sequence is SEQ ID NO.1.

[0010] The amino acid sequence of the protein encoded by the cultivated soybean SDR family gene GmGAE47 of the present invention is SEQID NO.2.

[0011] An expression vector containing the cultivated soybean SDR family gene GmGAE47 of the present invention.

[0012] The invention discloses an application of the cultivated soybean GmGAE47 gene encoding protein in reducing the plant height of Arabidopsis thaliana and increasing the thousand-grain weight and grain width.

[0013] The recombinant expression vector of the present invention is used in reducing the plant height of Arabidopsis thaliana and increasing the thousand-grain weight and grain width.

[0014] When using GmGAE47 to construct a plant expression vector, any enhanced promoter or inducible promoter can be added before its transcription start nucleotide. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a selective marker gene (GUS gene, GFP gene, etc.) that can be expressed in plants or a resistance gene for an antibiotic marker (gentamicin marker, kanamycin marker, hygromycin marker, etc.). Considering the safety of transgenic plants, no selective marker gene can be added, and transformed plants can be directly screened by phenotypic traits.

[0015] The plant expression vector carrying GmGAE47 of the present invention can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues can be cultivated into plants. The transformed plant host can be monocotyledonous plants such as rice, wheat, and corn, or dicotyledonous plants such as tobacco, Arabidopsis, soybean, rapeseed, cucumber, tomato, poplar, lawn grass, and alfalfa.

[0016] Beneficial effects:

[0017] The purpose of the present invention is to disclose the high-yield genetic engineering application of soybean SDR family gene GmGAE47. The GmGAE47 gene is expressed in all soybean tissues. Subcellular localization results show that GmGAE47 is localized in the nucleus and cell membrane. Overexpression of the GmGAE47 gene in Arabidopsis reduces the plant height of Arabidopsis and increases the thousand-grain weight and grain width. GmGAE47 is overexpressed as a target gene through genetic engineering to change the plant height, thousand-grain weight and grain width of Arabidopsis.

[0018] In the present invention, GmGAE47 belongs to the SDR family, and its protein has a transmembrane domain from the 2nd to the 152nd amino acid, and an epimerase domain at the C-terminus. Through tissue expression analysis, it was found that GmGAE47 was expressed in all tissues, and subcellular localization showed that the GmGAE47 protein was located in the cytoplasm, nucleus, and cell membrane. GmGAE47 was overexpressed in Arabidopsis, and it was found that the plant height of transgenic Arabidopsis was reduced compared with the control. Statistical analysis of the thousand-grain weight, grain length, and grain width of transgenic Arabidopsis showed that the GmGAE47 transgenic strain can significantly increase the thousand-grain weight and grain width of seeds compared with the control. The present invention discloses the effectiveness of the gene in regulating plant growth and development, as well as changes in yield traits. The plant height, grain weight, and grain width of crops can be modified in a targeted manner to increase the yield of crops.

[0019] By using the plant overexpression vector pBA002-GmGAE47, the GmGAE47 of the present invention is introduced into the plant body, the growth and development of the plant can be regulated to obtain a transgenic plant. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0021] Figure 1 .Agarose gel electrophoresis after PCR cloning of GmGAE47. Target fragment size 1500bp. Marker: DL2000

[0022] Figure 2 . Tissue expression pattern of GmGAE47. N=3.

[0023] Figure 3 .Subcellular localization of GmGAE47.

[0024] Figure 4 .Positive identification of T2 generation overexpression transgenic lines and relative expression level of GmGAE47. Col-1: wild type, OE-GmGAE47-1 and OE-GmGAE47-2: 2 transgenic lines overexpressing GmGAE47. (Same below) (A) PCR detection of target genes in T2 generation transgenic Arabidopsis lines. Partial vector sequence and GmGAE47 CDS sequence were amplified using specific detection primer pairs. M: Marker, DL2000. Col-0: wild type. N: blank control. P: positive plasmid. OE-GmGAE47-1 and OE-GmGAE47-2: 2 transgenic lines overexpressing GmGAE47. N=3. (B) BAR test strip detection of wild type and transgenic lines. (C) The relative expression level is the expression level relative to the control after normalization with tubulin gene (relative expression level in Col-1=1). *: significant at P<0.05 level. **: P < 0.01 level. Error bars represent ± SD.

[0025] Figure 5 Phenotypic observation and plant height statistical analysis of transgenic and wild-type Arabidopsis. N≥12. (A) Phenotypic observation of wild-type and transgenic Arabidopsis plant height 45 days after sowing. (B) Statistical analysis of wild-type and transgenic Arabidopsis plant height 45 days after sowing. ***: P<0.001 level significant. Error bars represent ±SD.

[0026] Figure 6 Statistical analysis of 1000-grain weight, grain length, and grain width of transgenic and wild-type Arabidopsis. N≥12. (A) Phenotypic observation of wild-type and transgenic Arabidopsis seeds after harvest. Scale bar = 800 μm. (B) Statistical analysis of 1000-grain weight of wild-type and transgenic Arabidopsis seeds after harvest. **: significant at the P<0.01 level; ***: significant at the P<0.001 level. Error bars represent ±SD. (C) Statistical analysis of grain length of wild-type and transgenic Arabidopsis seeds after harvest. ***: significant at the P<0.001 level. ns: no significant difference. Error bars represent ±SD. (D) Statistical analysis of grain width of wild-type and transgenic Arabidopsis seeds after harvest. *: significant at the P<0.05 level; **: significant at the P<0.01 level. Error bars represent ±SD. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below in conjunction with the accompanying drawings and examples, and with reference to data. These examples are only intended to illustrate the present invention, and are not intended to limit the scope of the present invention in any way. In the following examples, various processes and methods not described in detail are conventional methods known in the art. The primers used are all indicated when they first appear, and the same primers used thereafter are all the same as the first indicated content.

[0028] Example 1 Cloning and identification of cultivated soybean GmGAE47 and its encoding gene

[0029] The cultivated soybean Nannong 1138-2 was used as the experimental material and was planted in the plant culture room of the South Building of the Science School of Nanjing Agricultural University in June 2022. PCR amplification was performed using Nannong 1138-2 cDNA as a template and GmGAE47-F and GmGAE47-R as primers.

[0030] Upstream primer GmGAE47-F: CAGCTGCAGGAAAATTAATGCC;

[0031] Downstream primer GmGAE47-R: ATCTGTGACTTAAAACCTACCACA.

[0032] The GmGAE47 gene was amplified from the total RNA of fresh young organs of soybean using the RT-PCR method. Take fresh soybean tissue, grind it with a mortar, add it to a 1.5mL EP tube containing lysis solution, shake it thoroughly, and then transfer it to a glass homogenizer. After homogenization, transfer it to a 1.5mL EP tube and use a plant total RNA extraction kit (TIANGEN DP404) to extract total RNA. Use formaldehyde denaturing gel electrophoresis to identify the quality of total RNA, and then determine the RNA content on a spectrophotometer. Use the obtained total RNA as a template, perform reverse transcription according to the instructions of the reverse transcription kit provided by Takara, and synthesize the first chain of cDNA. Perform PCR amplification reaction. The PCR reaction system was: 2μl cDNA (0.05μg), 2μl upstream and downstream primers (10μM), 25μl 2×Phanta MaxBuffer, 1μl dNTP (10mM) and 1U Phanta Max Super-Fidelity DNA polymerase (Vazyme), and 50μl was supplemented with ultrapure water. The PCR program was as follows: carried out on a Bio-RAD PTC200 PCR instrument, and the program was 94℃ pre-denaturation for 3min; 94℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 45s, a total of 30 cycles; then 72℃ extension for 5min to terminate the reaction, and stored at 4℃. The PCR product was recovered and cloned into the pClone007 vector to obtain the T-GmGAE47 vector. After sequencing, the cDNA sequence of the soybean gene GmGAE47 with a complete coding region was obtained, SEQ ID NO.1, with a total length of 1296bp, encoding 431 amino acids shown in SEQ ID NO.2.

[0033] Example 2 Expression characteristics of GmGAE47 in different organs of soybean

[0034] RNA was extracted from roots, stems, leaves, flowers, pods and seeds of Nannong 1138-2 material and converted into cDNA for RT-PCR analysis.

[0035] The extraction of total RNA was the same as in Example 1. The soybean constitutively expressed gene Tubulin was used as the internal reference gene, and the amplification primers were Tubulin forward primer sequence: CCTCGTTCGAATTCGCTTTTTG, Tubulin reverse primer sequence: CAACTGTCTTGTCACTTGGCAT. cDNA from different soybean tissues or organs was used as a template for real-time fluorescence quantitative PCR analysis. The amplification primers for GmGAE47 were: GmGAE47-qPCR-F: CACGTCTCCCTCGCCTTAAA, GmGAE47-qPCR-R: AGAGTTTCGCGTCGTTGACA. Results ( Figure 2) analysis showed that the expression of GmGAE47 was relatively high in roots, stems, leaves, and flowers, indicating that GmGAE47 may be related to soybean root and flower development.

[0036] Example 3 Subcellular localization of GmGAE47

[0037] Subcellular localization was performed using the transient expression method of Nicotiana benthamiana. The vector used was P2, and the primers were GmGAE47-P2-F:ACAAATCTATCTCTCTCGAGATGCCGTCATTAGAGGA, GmGAE47-P2-R:GCTCACCATGGATCCATTTACAGGTTTGCC. PCR amplification, after the target band was correct, the rubber was cut and recovered, and the rubber recovery product was connected to the vector by homologous recombination to construct the subcellular localization vector P2-GmGAE47 (the gene is at the N-terminus of GFP). After transient expression in tobacco, it was cultured in the dark for 48 hours. After laser irradiation with a laser confocal microscope (Zeiss, LSM780), a green fluorescent signal was generated to locate the protein and observe and take pictures. The results are shown in Figure 3 As shown, the empty vector was distributed throughout the cells, and the GmGAE47:GFP fusion protein was distributed in the cell membrane and nucleus, indicating that GmGAE47 may function in the nucleus and membrane.

[0038] Example 4 Genetic Engineering of GmGAE47

[0039] The vector was constructed using the double enzyme digestion method, which was divided into two steps: enzyme digestion reaction and recombination reaction. The primer sequences were: GmGAE47-pBA002-F: CGCGCCGGGCCCAGGCCTACGCGTATGCCGTCATTAGAGGA; GmGAE47-pBA002-R: ATCGGGGAAATTCGAGCTCTTAATTTACAGGTTTGCC.

[0040] The pBA002 vector was double-digested with MIUI and SacI, and the target fragment was amplified from the T-GmGAE47 vector by adding a linker primer, and then recombined and connected. The product was the expression vector pBA002-GmGAE47, which was transformed into Escherichia coli TOP10, and the transformation solution was spread on LB solid medium containing 50 mg / L Kana to screen positive clones. After sequencing verification, the plasmid was extracted to obtain the pBA002-GmGAE47 plant overexpression vector, and pBA002-GmGAE47 was transferred into the Agrobacterium tumefaciens strain EHA105 by freeze-thaw method. pBA002-GmGAE47 was transformed into Arabidopsis thaliana mediated by Agrobacterium strain EHA105, and cultured on MS medium containing 25 mg / L glufosinate-ammonium, and transgenic plants with glufosinate-ammonium resistance were initially screened.

[0041] The genomic DNA of transgenic Arabidopsis thaliana with glufosinate resistance was extracted and screened, and PCR identification was performed using gene-specific primers GmGAE47-pBA002-F: CGCGCCGGGCCCAGGCCTACGCGTATGCCGTCATTAGAGGA and pBA002-GmGAE47-R: CGAAGCCTTGGAAGCTGAGATAG. The transgenic Arabidopsis thaliana that could amplify a band of about 199 bp was positive ( Figure 4 A). Select the plants that were positive in PCR identification, and use GmGAE47-qPCR-F: CACGTCTCCCTCGCCTTAAA, GmGAE47-qPCR-R: AGAGTTTCGCGTCGTTGACA as primers, Arabidopsis internal reference upstream primer Actin-F: CTCAAGAGGTTCTCAGCAGTA, downstream primer Actin-R: TCACCTTCTTCATCCGCAGTT, for real-time fluorescence quantitative PCR detection. The results showed that GmGAE47 can be expressed in transgenic Arabidopsis ( Figure 4 C). The transgenic plants that were positive in both PCR and real-time fluorescence quantitative PCR were named 35S::GmGAE47 transgenic Arabidopsis.

[0042] Phenotypic observation of 35S::GmGAE47 transgenic Arabidopsis was performed. Under the growth conditions of 25°C and long daylight, the 35S::GmGAE47 transgenic Arabidopsis was compared with the control and the plants were observed 45 days after sowing. The results showed that the plant height of the two lines of GmGAE47 transgenic plants, OE-GmGAE47-1 and OE-GmGAE47-2, was significantly reduced compared with the WT ( Figure 5 ). The yield traits were observed and compared. Compared with the wild type, the 1000-grain weight and grain width of the two GmGAE47 transgenic lines were significantly increased, and the grain length of OE-GmGAE47-1 was significantly increased. In general, heterologous overexpression of GmGAE47 in Arabidopsis can regulate plant height, grain weight, and grain width, which provides a new idea for soybean yield breeding research.

Claims

1. A cultivated soybean GmGAE47 protein encoding gene, whose nucleotide sequence is: SEQ ID NO.

1.

2. The GmGAE47 protein encoded by the gene according to claim 1, whose amino acid sequence is: SEQ ID NO.

2.

3. A recombinant expression vector containing the gene encoding the cultivated soybean GmGAE47 protein according to claim 1.

4. Use of the cultivated soybean GmGAE47 protein encoding gene according to claim 1 in regulating plant height, 1000-grain weight and grain width.

5. The use according to claim 4, Features Overexpression of the cultivated soybean GmGAE47 protein encoding gene in Arabidopsis can reduce the plant height of Arabidopsis and increase the thousand-grain weight and grain width.

6. Use of the recombinant expression vector according to claim 3 in regulating plant height, 1000-grain weight and grain width of Arabidopsis thaliana.

7. The use according to claim 6, Features The recombinant expression vector is used in reducing the plant height of Arabidopsis thaliana and increasing the thousand-grain weight and grain width.

Images