Clostridium beijerinckii oxygen-resistant mutant strain as well as preparation method and application thereof

Abstract

The invention provides a clostridium beijerinckii oxygen-resistant mutant strain as well as a construction method and application thereof. The clostridium beijerinckii mutant strain provided by the invention is a mutant obtained by inactivating a PerR protein coding gene Cbei1336 due to fixed-point insertion. The mutant strain not only can grow under an anaerobic condition, but also can well grow in aerobic air, is oxygen-resistant, has remarkably improved performances of producing butanol and acetone, and shortens the fermentation period by 24 hours.

Description

Technical Field

[0001] The invention relates to the technical field of microbial engineering, and in particular to an oxygen-resistant mutant strain of Clostridium beijerinckii and a preparation method and application thereof. Background Art

[0002] Biobutanol has become a new type of renewable clean biomass energy that has attracted much attention after bioethanol due to its excellent fuel properties. The main industrial production method of biobutanol is anaerobic Clostridium ABE fermentation (AcetoneButanol and Ethanol fermentation), but compared with butanol derived from petrochemical methods, biobutanol has a high production cost due to its low yield, production efficiency, and raw material conversion rate, which makes it less competitive in the market. Among them, O2 and reactive oxygen species (ROS) cause lethal damage to the redox metabolism of anaerobic Clostridium, resulting in the growth of anaerobic Clostridium only in an absolutely anaerobic environment, which is an important factor in the increase in the cost of "industrial strain genetic improvement" and "ABE fermentation production".

[0003] Clostridium acetobutylicum ATCC 824 and Clostridium beijerinckii NCIMB 8052 are the two most important industrial strains currently used for ABE fermentation. However, all the genetic information related to butanol production in the former is located on the extrachromosomal megaplasmid pSOL1, which is prone to degradation of butanol production performance due to plasmid loss during the passage process; and the former contains the Cac824I type II restriction modification system, which requires methylation modification of exogenous DNA during genetic manipulation, and the steps are cumbersome. The latter Clostridium beijerinckii NCIMB 8052 does not have the above two disadvantages and has better genetic stability and genetic operability. Optimizing the fermentation performance of solvent-producing clostridium ABE through genetic modification has always been an important issue in reducing the cost of biobutanol production.

[0004] Dong et al. (2011) found that PerR (peroxide repressor) protein is a key repressor of the functional genes of the O2 and ROS oxidative stress defense system of Clostridium acetobutylicum ATCC 824. After knocking out the PerR encoding gene CA_C2634 in ATCC 824, the tolerance of Clostridium acetobutylicum to oxygen was significantly enhanced. However, there are no related research reports on Clostridium beijerinckii. Based on the above background, it is of practical value to develop oxygen-tolerant mutant strains of Clostridium beijerinckii. Summary of the invention

[0005] In response to the above needs, the present invention aims to provide an aerobic mutant strain of Clostridium beijerinckii, and a preparation method and application thereof. The Clostridium beijerinckii provided by the present invention is a facultative anaerobic mutant strain with significantly improved solvent production performance, which can not only grow under anaerobic conditions, but also grow well in aerobic air.

[0006] The present invention firstly provides an oxygen-resistant mutant strain of Clostridium beijerinckii, wherein the mutant strain is a mutation in which a PerR protein encoding gene Cbei_1336 of Clostridium beijerinckii is deleted or inactivated.

[0007] In one embodiment of the present invention, the oxygen-resistant mutant strain of Clostridium beijerinckii is based on the solvent-producing degraded strain of Clostridium beijerinckii NCIMB 8052, and the expression of the PerR protein encoding gene Cbei_1336 is blocked by genetic engineering means to obtain the strain; preferably, the means for blocking the expression of its PerR protein encoding gene Cbei_1336 is gene editing technology such as CRISPR / Cas9 gene in-frame deletion, CRISPR / Cas12a gene in-frame deletion, ClosTron type II intron insertion, gene inactivation or homologous recombination.

[0008] The present invention also provides a method for constructing an oxygen-resistant mutant strain of Clostridium beijerinckii, which comprises: using Clostridium beijerinckii as a starting strain, blocking the expression of the PerR protein encoding gene Cbei_1336 by genetic engineering means, and thereby obtaining the strain; preferably, the basic strain is a solvent-producing degraded strain of Clostridium beijerinckii NCIMB 8052.

[0009] According to one embodiment of the present invention, the means for blocking the expression of the PerR protein encoding gene Cbei_1336 is preferably a gene editing technology such as CRISPR / Cas9 gene in-frame deletion, CRISPR / Cas12a gene in-frame deletion, gene inactivation by ClosTron type II intron insertion, or homologous recombination; preferably, gene inactivation by ClosTron type II intron site-directed insertion.

[0010] In one embodiment according to the present invention, the gene inactivation by type II intron insertion is achieved by a method comprising the following steps:

[0011] 1) Construction of a knockout vector containing a specific ClosTron II intron fragment;

[0012] 2) transforming the knockout vector into the target strain of Clostridium beijerinckii;

[0013] 3) Subculturing, screening and identifying to obtain oxygen-resistant mutant strains of Clostridium beijerinckii.

[0014] In one embodiment of the present invention, the knockout vector in step 1) is constructed by a method comprising the following steps:

[0015] a) Using Intron PCR Template as template and IBS, EBS1d, EBS2 and EBS universal as primers, PCR amplification was performed to obtain specific fragments;

[0016] The nucleotide sequence of the IBS is SEQ ID NO: 1; the nucleotide sequence of EBS1d is SEQ ID NO: 2; the nucleotide sequence of EBS2 is SEQ ID NO: 3; the nucleotide sequence of EBS universal is SEQ ID NO: 4;

[0017] b) double digesting the specific fragment and the knockout shuttle plasmid using restriction endonucleases HindIII and BsrGI; preferably, the shuttle plasmid is pMTL007;

[0018] c) The digested fragment and plasmid were connected with T4 ligase to obtain a knockout vector.

[0019] Another aspect of the present invention provides a knockout vector, which comprises a specific ClosTron type II intron fragment and a shuttle plasmid; the specific ClosTron type II intron fragment is obtained by PCR amplification using Intron PCR Template as a template and IBS, EBS1d, EBS2 and EBS universal as primers; wherein the nucleotide sequence of IBS is SEQ ID NO: 1; the nucleotide sequence of EBS1d is SEQ ID NO: 2; the nucleotide sequence of EBS2 is SEQ ID NO: 3; and the nucleotide sequence of EBS universal is SEQ ID NO: 4.

[0020] In another aspect of the present invention, the present invention also provides the use of the above-mentioned oxygen-resistant mutant strain of Clostridium beijerinckii, or the oxygen-resistant mutant strain of Clostridium beijerinckii obtained according to the above-mentioned construction method in the production of biobutanol.

[0021] The present invention further provides a method for producing biobutanol, which utilizes the above-mentioned Clostridium beijerinckii aerobic mutant strain or the Clostridium beijerinckii aerobic mutant strain obtained according to the above-mentioned construction method to perform anaerobic fermentation in a biobutanol production device.

[0022] The beneficial effects of the above technical solution of the present invention are as follows:

[0023] 1. The method provided by the present invention knocks out the PerR protein encoding gene of Clostridium beijerinckii by the type II intron site-directed insertion method, and can stably obtain an expression-deficient mutant strain;

[0024] 2. The mutant strain of Clostridium beijerinckii provided by the present invention can grow well not only under anaerobic conditions but also in aerobic air;

[0025] 3. The mutant strain of Clostridium beijerinckii provided by the present invention has excellent oxygen resistance, and the performance of producing solvent butanol and acetone is significantly improved, and the fermentation cycle is shortened by 24 hours. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the construction method of the knockout vector pMTL007-Cbei1336-intron for the oxygen-resistance inhibitor PerR protein gene Cbei_1336 of Clostridium beijerinckii NCIMB 8052.

[0027] Figure 2 The diagrams are for the construction and identification of the Clostridium beijerinckii PerR gene knockout strain of the embodiment of the present invention; wherein (A) is an identification diagram of erythromycin-resistant positive clones, and (B) and (C) are molecular identification diagrams of erythromycin-resistant positive clones.

[0028] Figure 3 Schematic diagram of the growth of the solvent-producing degenerate strain (C. beijerinckii DS) and the oxygen-tolerant mutant strain under aerobic and anaerobic conditions for 24 hours on a plate provided in an embodiment of the present invention.

[0029] Figure 4 A comparison chart of the anaerobic fermentation performance of P2 culture of the oxygen-tolerant facultative anaerobic mutant (Cbei_1336mutant), wild-type Clostridium beijerinckii (C.beijerinckii) and solvent-producing degenerate strain (C.beijerinckii DS) provided in the embodiments of the present invention. DETAILED DESCRIPTION

[0030] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0031] Unless otherwise specified, the reagents and biological materials used in this example can be obtained through public legal or commercial channels.

[0032] Common reagents

[0033] Table 1 Main reagents

[0034]

[0035] Main instruments

[0036] Table 2 Instruments and equipment

[0037]

[0038] Main culture medium and culture method

[0039] 1) Main culture medium

[0040] Seed culture medium (RCM): glucose 5g / L, peptone 10g / L, yeast extract 3g / L, sodium chloride 5g / L, anhydrous sodium acetate 3g / L, soluble starch 1g / L, L-cysteine ​​HCl 0.5g / L, pH 6.68, 15-20g / L agar powder is added to the solid culture medium.

[0041] Traditional fermentation medium (P2 medium): ① Carbon source and nitrogen source: glucose 60g / L, yeast powder 1g / L; ② Vitamins: p-aminobenzoic acid 0.001g / L, thiamine-HCl 0.001g / L, biotin 0.00001g / L; ③ Buffer: KH2PO4 0.5g / L, K2HPO4 0.5g / L, CH3COONH42.2g / L; ④ Minerals: MgSO4·7H2O 0.2g / L, MnSO4·H2O 0.01g / L, FeSO4·7H2O0.01g / L, NaCl 0.01g / L.

[0042] 2) Cultivation methods

[0043] Seed solution preparation: Take 200 μl of the activated culture solution (OD600 between 0.8-1.0) of the strain (C. beijerinckii DS or Cbei_1336 mutant) from the freeze-dried storage tube and inoculate it into 5 mL of RCM seed culture medium. Incubate it at 150 rpm under anaerobic conditions at 34°C until the OD600 of the culture solution reaches between 0.8-1.0 to obtain the primary seed solution. Inoculate 5 ml of the primary seed solution into 100 ml of RCM seed culture medium and incubate it under the same conditions until the OD600 of the culture solution reaches between 0.8-1.0 to obtain the secondary seed solution.

[0044] Shake flask fermentation of strains: inoculate 6 ml of the secondary seed solution into 100 ml of P2 fermentation medium and culture continuously at 34°C under anaerobic conditions at 150 rpm for 96 h. Three replicates were made for each strain of C. beijerinckii DS and Cbei_1336 mutant.

[0045] The invention knocks out the Clostridium beijerinckii NCIMB 8052 PerR protein encoding gene Cbei_1336 by a type II intron insertion method, thereby obtaining a facultative anaerobic mutant strain Cbei_1336mutant which is oxygen-resistant and has significantly improved solvent butanol and acetone production performance.

[0046] Example 1 Vector Construction:

[0047] The present invention selects the 374|375s site of the gene Cbei_1336 encoding the PerR protein of Clostridium beijerinckii NCIMB 8052 as the site for site-directed insertion of the type II intron, and uses Clostron to design specific primers (IBS, EBS1d and EBSuniversal) to construct the shuttle plasmid pMTL007-Cbei1336-intron ( Figure 1 ) as a knockout vector for the gene of the solvent-producing degraded strain Cbei_1336 of Clostridium beijerinckii.

[0048] The pMTL007 plasmid sequence SEQ ID NO: 10 is as follows, obtained by full sequence synthesis (synthesis company: Qingke Biotechnology)

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055] The specific primers designed by Clostron are:

[0056] IBS (SEQ ID NO: 1):

[0057] AAAAAAGCTTATAATTATCCTTAATAACCATAAAAGTGCGCCCAGA TAGGGTG;

[0058] EBS1d (SEQ ID NO: 2):

[0059] CAGATTGTACAAATGTGGTGATAACAGATAAGTCATAAAAATTAACTTACCTTTCTTTTGT;

[0060] EBS2 (SEQ ID NO: 3):

[0061] TGAACGCAAGTTTCTAATTTCGGTTGTTATCCGATAGAGGAAAG TGTCT;

[0062] EBS universal (SEQ ID NO:4):

[0063] CGAAATTAGAAACTTGCGTTCAGTAAAC.

[0064] The steps are:

[0065] 1) Intron relocalization by PCR amplification experiment:

[0066] Using Intron PCR Template ( Gene Knockout System, sigma TA0100) was used as template, IBS, EBS1d, EBS2 and EBS universal were used as primers for PCR amplification to obtain a 353 bp specific fragment, and Intron relocation was achieved. The introduced restriction sites were HindIII and BsrGI.

[0067] 2) The 353 bp specific fragment and the knockout shuttle plasmid pMTL007 were double digested with restriction endonucleases HindIII and BsrGI, and then the digested fragment and plasmid were ligated with T4 ligase.

[0068] 3) The ligation product was transformed into E. coli (T1 cells) and positive clones were screened for resistance to chloramphenicol (15 μg / mL) and named pMTL007-Cbei1336-intron ( Figure 1 ), and stored in glycerol until ready for use at -80°C.

[0069] 4) Use a sterile inoculation loop to take the glycerol-frozen bacteria, streak inoculate on LB plates (containing 15 μg / mL chloramphenicol resistance), incubate at 37°C for 12 hours, pick a single colony on the plate and inoculate it into 10 ml LB liquid culture medium (containing 15 μg / mL chloramphenicol resistance), incubate at 37°C for 12 hours, and then centrifuge to collect the bacteria. Use a plasmid mini-extraction kit (Tian Gen, catalog number: DP103) to extract the plasmid pMTL007-Cbei1336-intron for knockout of the PerR protein encoding gene Cbei_1336.

[0070] The nucleotide sequence of the PerR coding gene Cbei_1336 is SEQ ID NO:9:

[0071]

[0072] Example 2 Plasmid transformation and expression

[0073] 1) The plasmid pMTL007-Cbei1336-intron was transformed into the solvent-producing degenerate strain of Clostridium beijerinckii by electroporation to knock out the PerR protein encoding gene Cbei_1336.

[0074] 2) Under anaerobic conditions at 34°C, the electroporation solution was coated on the plate and cultured for 24 hours to produce 8 white, semi-transparent, nearly circular positive clones with a diameter of about 1 mm ( Figure 2 A).

[0075] 3) Pick a positive single clone, culture it in liquid (containing 10 μg / ml erythromycin resistance) and then perform liquid PCR with the plasmid-specific primers pMTL007-ltrA-up (SEQ ID NO: 5): AACGATAGCCTCCAAACATAAGGGA, pMTL007-ltrA-down (SEQ ID NO: 6): CGATGACAATGAAAGCATACAACAA to obtain a 381 bp band ( Figure 2 B), confirming that the plasmid was successfully transformed into the strain cells.

[0076] 4) After 8-10 generations of rapid subculture to eliminate the positive clone plasmid, the genomic DNA of the strain was extracted, and the DNA was used as a template to amplify the 981 bp fragment (pMTL007-ErmB-up (SEQ ID NO: 7): TACTTTGGCGTGTTTCATTGCTTG, pMTL007-ErmB-down (SEQ ID NO: 8): TCGTTTCGAGTCACTTGACCCTAC) using the designed type II intron fragment inserted into the genome. Figure 2 C), proving that the type II intron was successfully inserted into the genome, blocking the expression of the Cbei_1336 gene.

[0077] 5) Pick the positive clones on the erythromycin resistance plate, inoculate the liquid culture and then spread the plate, and culture them under normal air and anaerobic conditions for 24 hours, respectively. The starting strain, Clostridium beijerinckii DS, was used as a control. It can be observed that the mutant strain Cbei_1336mutant, which knocks out the PerR protein encoding gene, can grow both in air and under anaerobic conditions, while the starting strain can only grow under anaerobic conditions ( Figure 3 ).

[0078] Example 3 Solvent production performance of oxygen-tolerant mutant of Clostridium beijerinckii Cbei_1336mutant

[0079] Under the same culture conditions, the oxygen-tolerant mutant strain Cbei_1336mutant, wild-type Clostridium beijerinckii and solvent-producing degenerate strain of Clostridium beijerinckii were subjected to anaerobic fermentation for 96 h in P2 medium. Among them, Clostridium beijerinckii (Clostridium beijerinckii NCIMB 8052 (CGMCC 1491.5077)) was purchased from China Collection of Type Microorganisms (CGMCC); the solvent-producing degenerate strain of Clostridium beijerinckii (C. beijerinckii NCIMB 8052) C. beijerinckii DS was obtained by continuously subculturing the wild-type strain of C. beijerinckii NCIMB 8052 in RCM medium every 12 h for 50 times.

[0080] The test found that ( Figure 4 ): Compared with the solvent-producing degenerate strain of the starting strain, the biomass in the fermentation broth of the mutant strain Cbei_1336mutant increased by 8.11±0.11 (OD 600) (3.67±0.35 times), the concentrations of acetone and butanol increased by 4.7±0.40g / L (32.78±0.02 times) and 10.01±0.57g / L (57.23±0.01 times), respectively, and the total solvent production efficiency increased from 0.07±0.01g / L / h of the solvent-producing degenerate strain to 0.19±0.01g / L / h of the mutant strain, and the yield increased by 2.71±0.0 times; compared with the wild-type Clostridium beijerinckii, the fermentation broth of the aerobic mutant strain (Cbei_1336mutant) had slightly lower concentrations of acetone, butanol and total solvent, except for biomass, but the fermentation cycle was effectively shortened by 24 hours. The results showed that knocking out the PerR protein encoding gene Cbei_1336 not only increased the oxygen tolerance of Clostridium beijerinckii, but also greatly improved the ABE fermentation performance of the strain.

[0081] Detection method: The products of acetic acid, butyric acid, acetone, butanol and ethanol in the fermentation broth were detected by gas phase using a gas chromatograph PerkinElmer Clarus GC680. Capillary column (ZKAT, ZKAT): Filler: FFAP; Film thickness: 1 μm; Inner diameter: 0.32 mm; Length: 50 m. Chromatographic conditions: Carrier gas (N2 gas) flow rate 2 ml / min; flow: 25; H2: 40 ml / min; Air: 400 ml / min; Injector temperature: 250 °C; Detector temperature: 250 °C; Internal standard method quantification, internal standard: isobutanol. Sample volume: 1 μl. Program: 1) Initial temperature 55 °C, retain 1 min; 2) Gradient temperature increase: 3 °C / min, heat up to 90 °C, retain 1 min; 3) Gradient temperature increase: 50 °C / min, heat up to 180 °C, retain 6 min.

[0082] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

Claims

1. An oxygen-resistant mutant strain of Clostridium beijerinckii, wherein the mutant strain is a mutation in which the PerR protein encoding gene Cbei_1336 of Clostridium beijerinckii is inactivated due to site-directed insertion.

2. The oxygen-resistant mutant strain of Clostridium beijerinckii as described in claim 1, which is based on the solvent-producing degraded strain of Clostridium beijerinckii NCIMB 8052, and the expression of the PerR protein encoding gene Cbei_1336 is blocked by genetic engineering means to obtain the strain; preferably, the blocking of the PerR protein encoding gene adopts gene inactivation gene editing technology using ClosTron type II intron site-specific insertion.

3. The oxygen-resistant mutant strain of Clostridium beijerinckii as described in claim 1 or 2, wherein the means for blocking the expression of its PerR protein encoding gene Cbei_1336 is a gene editing technology for gene inactivation by site-directed insertion of ClosTron type II intron.

4. A method for constructing an oxygen-tolerant mutant strain of Clostridium beijerinckii, comprising: The strain is obtained by using Clostridium beijerinckii as a basic strain and blocking the expression of the PerR protein encoding gene Cbei_1336 by genetic engineering means; preferably, the basic strain is the solvent-producing degraded strain of Clostridium beijerinckii NCIMB 8052.

5. The construction method according to claim 4, wherein: The method for blocking the expression of the PerR protein encoding gene Cbei_1336 is a gene editing technology for gene inactivation by insertion of ClosTron type II intron; preferably, gene inactivation by site-directed insertion of ClosTron type II intron.

6. The construction method according to claim 5, wherein: The gene inactivation by site-directed insertion of type II introns is achieved by a method comprising the following steps: 1) Construction of a knockout vector containing a specific ClosTron II intron fragment; 2) transforming the knockout vector into the target strain of Clostridium beijerinckii; 3) Subculturing, screening and identifying to obtain oxygen-resistant mutant strains of Clostridium beijerinckii.

7. The construction method according to claim 6, wherein: The knockout vector in step 1) is constructed by a method comprising the following steps: a) Using Intron PCR Template as template and IBS, EBS1d, EBS2 and EBS universal as primers, PCR amplification was performed to obtain specific fragments; The nucleotide sequence of the IBS is SEQ ID NO: 1; the nucleotide sequence of EBS1d is SEQ ID NO: 2; the nucleotide sequence of EBS2 is SEQ ID NO: 3; the nucleotide sequence of EBS universal is SEQ ID NO: 4; b) double digesting the specific fragment and the knockout shuttle plasmid using restriction endonucleases HindIII and BsrGI; preferably, the shuttle plasmid is pMTL007; c) The digested fragment and plasmid were connected with T4 ligase to obtain a knockout vector.

8. A knockout vector, characterized in that It comprises a specific ClosTron type II intron fragment and a shuttle plasmid; the specific ClosTron type II intron fragment is obtained by PCR amplification using Intron PCR Template as a template and IBS, EBS1d, EBS2 and EBSuniversal as primers; wherein the nucleotide sequence of IBS is SEQ ID NO: 1; the nucleotide sequence of EBS1d is SEQ ID NO: 2; the nucleotide sequence of EBS2 is SEQ ID NO: 3; and the nucleotide sequence of EBS universal is SEQ ID NO:

4.

9. Use of the oxygen-tolerant mutant strain of Clostridium beijerinckii according to any one of claims 1 to 3, or the oxygen-tolerant mutant strain of Clostridium beijerinckii obtained according to the construction method of any one of claims 4 to 7 in the production of biobutanol.

10. A method for producing biobutanol, characterized in that: Anaerobic fermentation is carried out in a biobutanol production device using the Clostridium beijerinckii aerobic mutant strain described in any one of claims 1 to 3, or the Clostridium beijerinckii aerobic mutant strain obtained according to the construction method of any one of claims 4 to 7.

Images