Preparation method and application of 7-aminocephalosporanic acid production strain

Abstract

The invention discloses a 7-aminocephalosporanic acid producing strain as well as a preparation method and application thereof. The invention provides a method for preparing 7-aminocephalosporanic acid. The method comprises the following steps: carrying out combined plasmid construction on promoters from different sources and a plurality of cephalosporin C acyltransferases; a cephalosporin C acyltransferase gene is integrated into a cephalosporium acremonium strain genome through a protoplast transformation method to obtain recombinant bacteria, and the recombinant bacteria are fermented to obtain a 7-aminocephalosporanic acid product. According to the invention, CPC high-productivity cephalosporium acremonium strain is taken as a starting strain, and cephalosporin C acyltransferase is introduced into the starting strain in an exogenous manner by means of genetic engineering, synthetic biology and the like, so that direct production of 7-aminocephalosporanic acid from the engineering strain can be realized. The method has the advantages of simple steps, no chemical pollution in the production process, and huge industrialization prospect.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, in particular to the technical field of engineering bacteria construction, and specifically to a 7-aminocephalosporanic acid producing bacterium and a preparation method and application thereof. Background Art

[0002] Cephalosporin C (CPC) is a β-lactam antibiotic produced by the filamentous fungus Acremonium chrysogenum. Cephalosporin C can exert its antibacterial effect by affecting the synthesis and assembly of bacterial cell wall peptidoglycan, thereby interfering with the synthesis of bacterial cell wall. Due to its broad-spectrum antibacterial ability and its relative safety to humans and animals, cephalosporin antibiotics are widely used in the treatment of bacterial diseases and have become the most important anti-infective drugs in clinical practice.

[0003] 7-Aminocephalosporin acid (7-ACA) is a key intermediate of semi-synthetic cephalosporin antibiotics, accounting for more than 40% of the global cephalosporin antibiotic market. Since CPC has the disadvantages of narrow antibacterial spectrum and easy degradation by penicillinase, in order to solve this problem, CPC can be deacylated by chemical or biological methods to convert into 7-ACA. Among them, the chemical method not only requires harsh reaction conditions, but also faces the problems of high pollution and high energy consumption, and cannot meet the needs of producing high-quality 7-ACA. The process of producing 7-ACA by cleaving cephalosporin C by biological enzyme method has the advantages of simple process, high efficiency, low cost, safety, no pollution and stable product quality. It is recognized as a green production process and has been adopted by most companies at home and abroad. It has great competitiveness in economy and environmental protection.

[0004] The enzymatic cleavage production of 7-ACA includes a two-step enzymatic method and a one-step enzymatic method; the two-step enzymatic method is that CPC produces a keto-containing intermediate (7-(5-Oxoadipoamido)cephalosporanicacid) under the action of D-amino acid oxidase. This intermediate is unstable and is easily oxidized and decarboxylated by the H2O2 produced at the same time, and converted into glutaryl-7-aminocephalosporanic acid (Glutaryl-7-aminocephalosporanic Acid, GL-7-ACA), and then the side chain is removed under the action of GL-7-ACA cephalosporin C acyltransferase to generate 7-ACA. The one-step enzymatic method refers to the use of CPC acyltransferase (CA) to cleave the amide bond between the cephalexin nucleus and the acyl side chain, and directly convert CPC into 7-ACA. Therefore, using cephalosporin C cephalosporin C acyltransferase to directly acylate CPC to obtain 7-ACA is more suitable for industrial production needs.

[0005] At present, the one-step enzymatic production process of 7-ACA first purifies CPC produced by fermentation of Cephalosporium acremonium, and then adds CPC acyltransferase to react to obtain 7-ACA. However, this process not only requires the purification of CPC, but also requires the expression, purification and carrier fixation of CPC acyltransferase, which is very cumbersome.

[0006] In summary, there are currently a variety of ways to generate 7-ACA, but there is a lack of environmentally friendly and process-simplified methods for synthesizing 7-ACA from scratch. Summary of the invention

[0007] One object of the present invention is to provide a method for preparing a highly productive 7-ACA recombinant Cephalosporium acremonium strain.

[0008] The technical problem to be solved by the present invention is to provide a promoter for high protein expression in Cephalosporium acremonium, an amino acid sequence encoding cephalosporin C acyltransferase, and a method for transforming a CPC acyltransferase gene cloned in a high expression vector into a CPC high-productivity recombinant Cephalosporium acremonium strain.

[0009] The solution adopted by the present invention to solve the above technical problems is as follows:

[0010] The invention provides a method for preparing a 7-aminocephalosporanic acid producing strain, which comprises introducing genes related to the 7-aminocephalosporanic acid synthesis pathway into Acremonium chrysogenum to obtain a recombinant strain, namely the 7-aminocephalosporanic acid producing strain; preferably, the initial strain is Acremonium chrysogenum CGMCC 3.3795 or high-productivity CPC recombinant Acremonium chrysogenum.

[0011] Specifically, the 7-aminocephalosporanic acid synthesis pathway-related gene is a gene encoding cephalosporin C acyltransferase, and the cephalosporin C acyltransferase can hydrolyze the CPC side chain group.

[0012] Preferably, the cephalosporin C acyltransferase is SEQ ID NO: 1 or NCBI No. AAA25690.1, CAA48785.1, AAC34685.2, WP_092168096.1, WP_217659596.1 or a mutant thereof.

[0013] More preferably, the mutant has one of the following mutations based on the sequence of SEQ ID NO: 1: G141Q / L185K / A205E, H596K / A600E, W443I / L505A, W443I L505T, D485I / H496K, A571K, N240Q, D350K, V327I, T321G / V327I, T321G, A121H, M173Q, I 166L, F381Q, H453N, L505A, R437D or A565G.

[0014] Specifically, the gene encoding the cephalosporin C acyltransferase is introduced into Cephalosporium acremonium in the form of an expression vector of an expression cassette, including a promoter and a terminator.

[0015] More specifically, the promoter is the endogenous gpdA promoter of Cephalosporium acremonium; preferably, the promoter sequence is SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 5 or SEQ ID NO: 6 or a mutant thereof.

[0016] Furthermore, the vector backbone of the expression vector is plasmid pUC57.

[0017] In a specific embodiment, the 7-aminocephalosporanic acid synthesis pathway related genes are obtained by gene editing or homologous recombination.

[0018] The present invention also provides a 7-aminocephalosporanic acid producing strain obtained by the preparation method.

[0019] The present invention further provides a method for preparing 7-aminocephalosporanic acid, comprising the following steps: fermenting the 7-aminocephalosporanic acid producing strain to obtain 7-aminocephalosporanic acid; optionally, further comprising the step of collecting the 7-aminocephalosporanic acid.

[0020] The recombinant Cephalosporium acremonium strain prepared by the preparation method of the present invention can achieve one-step synthesis of 7-ACA, and the conversion efficiency is very high. The 7-ACA production capacity of the highly productive 7-ACA recombinant Cephalosporium acremonium strain prepared by the present invention can be 1 to 4.3 g / L, and the most preferred is 4.3 g / L or more. The production of 7-ACA is determined by parameters such as strain activation culture conditions, fermentation medium formula, and fermentation process.

[0021] The experiment of the present invention proves that the cephalosporin C acyltransferase synthesized by the present invention is introduced into Cephalosporium acremonium to obtain a recombinant bacterium that can ferment and synthesize 7-aminocephalosporanic acid in one step. The recombinant bacterium WH07 constructed with the cephalosporin C acyltransferase XY408 can produce more than 4.3 g / L of 7-aminocephalosporanic acid through a shake flask fermentation experiment, realizing the industrial fermentation method for synthesizing 7-aminocephalosporanic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the plasmid construction diagram of the recombinant expression plasmid pUC57-PgpdA_2-XY408.

[0023] Figure 2 This is the plasmid construction diagram of the recombinant expression plasmid pUC57-PgpdA_2-SE83.

[0024] Figure 3 This is the plasmid construction diagram of the recombinant expression plasmid pUC57-PgpdA_2-P130.

[0025] Figure 4 This is the plasmid construction diagram of the recombinant expression plasmid pUC57-PgpdA_2-OK403.

[0026] Figure 5 This is the plasmid construction diagram of the recombinant expression plasmid pUC57-PgpdA_2-V22.

[0027] Figure 6 This is the plasmid construction diagram of the recombinant expression plasmid pUC57-PgpdA_2-Rr.

[0028] Figure 7 This is the electrophoresis verification diagram of the recombinant transformant.

[0029] Figure 8 These are the HPLC test results of 7-ACA synthetic bacteria fermentation samples. DETAILED DESCRIPTION

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0031] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0032] In the following examples, there is no particular limitation on the method for detecting the concentration of 7-aminocephalosporanic acid, and a method familiar to those skilled in the art is used. It should be noted that a person skilled in the art may make several improvements and modifications without departing from the principles of the present invention, and these improvements and modifications shall also be deemed to be within the scope of protection of the present invention.

[0033] Instrument: High performance liquid chromatography

[0034] Chromatographic column: ZORBAX SB-C18 Analytical 4.6×150mm 5-Micron

[0035] Mobile phase: 4% methanol, 96% phosphate, pH of mobile phase was adjusted to 7.4 with sodium hydroxide, filtered through 0.45 μm filter membrane to remove impurities, and ultrasonicated for 20 min to remove bubbles.

[0036] Detection conditions: Detector: UV detector; Detection wavelength: 254nm; Running time: 15min; Injection volume: 10μL; Column temperature: 30℃; Flow rate: 1mL / min.

[0037] The standard substance 7-aminocephalosporanic acid was purchased from MERCK with the catalog number 191140.

[0038] The 7-aminocephalosporanic acid producing bacteria and the method for producing 7-aminocephalosporanic acid of the present invention are further introduced below in conjunction with specific examples. The technical solutions of the present invention include but are not limited to the following examples.

[0039] The high-yielding CPC Cephalosporium acremonium originated from our laboratory.

[0040] Some of the primers in the following examples are shown in Table 1:

[0041] Table 1 is a primer sequence table

[0042] Primer name Sequence (5'-3') Hyg-F ATGAAGAAGCCCGAGCTCACCGCC Hyg-R TCACTCCTTGGCCCTAGGGCGGGTGC ep-XY408-F ATGACCACCGACGCCGACCGCGAC ep-XY408-R TCAGGCGCGGGGGGGGGACGA vec-XY408-F TCTAGAGCCACCAACTTCTCCCTCCTC vec-XY408-R TTTGATTGATCTGGGAAGATTATTAGCC

[0043] Example 1. Expression vector construction

[0044] Through the enzymatic property characterization experiment, the cephalosporin C acyltransferase corresponding to sequence 1 and NCBI numbers AAA25690.1, CAA48785.1, AAC34685.2, WP_092168096.1, and WP_217659596.1 was screened. The gene suitable for expression of Cephalosporium acremonium was synthesized by full gene synthesis and constructed into the pUC57 expression vector by homologous recombination. The promoter responsible for gene initiation transcription in the vector is the gpdA promoter (sequence 2) derived from the endogenous Cephalosporium acremonium. The screening resistance gene is hygromycin B. After the ligation product is verified by nucleic acid agarose gel electrophoresis, it is transferred into E.coli DH5α competent cells by chemical transformation as exogenous DNA, screened on a screening plate containing ampicillin or kanamycin, and the monoclonal plasmid is extracted for PCR amplification and sequencing verification and identification of positive recombinant transformants. The endogenous gpdA promoter of Cephalosporium acremonium was connected to the upstream of cephalosporin C acyltransferase with sequence 1 and NCBI numbers AAA25690.1, CAA48785.1, AAC34685.2, WP_092168096.1, and WP_217659596.1 to obtain vectors pUC57-PgpdA_2-XY408, pUC57-PgpdA_2-SE83, pUC57-PgpdA_2-P130, pUC57-PgpdA_2-OK403, pUC57-PgpdA_2-V22, and pUC57-PgpdA_2-Rr.

[0045] Example 2: Conversion of Cephalosporin C Acyltransferase into Cephalosporium acremonium strains and verification of recombinants

[0046] Preparation of protoplasts of Cephalosporium acremonium:

[0047] 1) Activation of bacterial strains: 200 μL of frozen glycerol bacteria were inoculated into 5 mL of PDA basal medium and cultured at 30°C and 230 rpm for 4 days;

[0048] 2) Transfer culture: Take 2 mL of activated bacteria and inoculate into a 100 mL shake flask containing 20 mL of YPS liquid medium for secondary culture, and culture at 30°C and 230 rpm for 2 days;

[0049] 3) Washing with sterile water: centrifuge the strain obtained in step 2) at 4000 rpm for 10 min, and wash with sterile water for 3 times;

[0050] 4) Pretreatment of bacteria: Take 1 g of wet bacteria, add 10 mL of 0.01 M sodium acetate, 50 μL of 1 M DTT, 30 ° C 220 rpm for 1 h;

[0051] 5) Washing of bacteria: After centrifugation at 4000 rpm for 10 min, remove the supernatant, and then use 20 mL of KMC (1 M KCl, 50 mM CaCl2, 20 mM MgCl2) solution to wash the bacteria, and centrifuge at 4000 rpm for 10 min;

[0052] 6) Enzymatic lysis: Add 5 mL Lysing reagent (Vinotaste) to about 1 g of wet bacteria, shake on a horizontal shaker at 37°C and 80 rpm for 2 h, and observe the protoplasts under a microscope;

[0053] 7) Stop lysis: add 10 mL STC (1.33 M Sorbitol, 50 mM CaCl2, 10 mM pH 7.5 Tris-HCl buffer) stop solution, and gently pipette several times;

[0054] 8) Protoplast collection: Filter the lysate from the previous step using sterile non-woven fabric, the filtrate is the protoplasts, and centrifuge at 10°C and 4000 rpm for 10 min;

[0055] 9) Protoplast washing: Use STC solution to wash the protoplasts, centrifuge at 10°C and 2500 rpm for 10 min, repeat 3 times;

[0056] 10) Protoplast resuspension: Add 1 mL of STC solution to the centrifuge tube containing the protoplasts, and divide into 10 15 mL centrifuge tubes. Count the remaining protoplast liquid using a hemocytometer.

[0057] Transformation of protoplasts:

[0058] The protoplast transformation experiment of Cephalosporium acremonium used the PEG-mediated protoplast transformation method, and used 300 μg / mL hygromycin B as the screening condition. The detailed steps are as follows:

[0059] 1) PEG chemical transformation: Add 5 μg of exogenous DNA plasmid (pUC57-PgpdA_2-XY408, pUC57-PgpdA_2-SE83, pUC57-PgpdA_2-P130, pUC57-PgpdA_2-OK403, pUC57-PgpdA_2-V22, pUC57-PgpdA_2-Rr) to a 15 mL centrifuge tube containing 100 μL of protoplasts, and add 50 μL of PEG-6000 at the same time. After ice bathing for 5 minutes, add 1 mL of PEG-6000 and leave at room temperature for 5 minutes.

[0060] 2) Maintain osmotic pressure: add 2 mL of STC solution to the transformation system;

[0061] 3) Coating: add selective upper basal medium (with hygromycin added) to 15 mL, mix well and pour into selective MMSN lower basal medium plate (0.95 M sucrose, 0.6 / 1.2% agar, 0.05% glucose, 0.02% ASP+N, 2 mM magnesium sulfate heptahydrate, 0.01% Traceelements; Traceelements: weigh 10 g EDTA, 44 g ZnSO4·7H20, 1.01 g MnCl2·4H20, 0.32 g CoCl2·6H20, 0.315 g CuSO4·5H20, 0.22 g (NH4)6Mo7024·4H20, 1.11 g CaCl2, 1.0 g FeSO4·7H20, dissolved in 1 L water);

[0062] 4) Cultivation: After the culture medium solidifies for 20 minutes, cover the culture dish with sealing film and place it upside down in a 30°C incubator for cultivation. Observe after 5 days.

[0063] The recombinant Cephalosporium acremonium transformant obtained in Example 2 was picked from the regeneration transformation plate, inoculated into a PDA solid culture medium plate and continued to be cultured for 5 days. After the mycelium bulged and wrinkles appeared on the surface, it was picked into a liquid PDA culture medium and cultured for 4 days. The genomic DNA of the transformant was extracted by liquid nitrogen grinding method and subsequently verified by PCR and sequencing.

[0064] Extraction of recombinant Cephalosporium acremonium transformant DNA by liquid nitrogen grinding method:

[0065] 1) washing and recovering the transformant Cephalosporium acremonium hyphae cultured in liquid, and grinding the hyphae with a mortar and adding an appropriate amount of liquid nitrogen;

[0066] 2) After grinding, add 1 mL of extraction solution (Tris-HCl pH 7.5 0.2 mol / ml, NaCl 0.5 mol / L, EDTA 0.01 mol / L, SDS 1% (w / v));

[0067] 3) Add an equal volume of phenol-chloroform, vortex thoroughly for 3 minutes, and centrifuge at 12000 rpm for 3 minutes;

[0068] 4) Take the supernatant and add an equal volume of chloroform, centrifuge at 12000 rpm for 3 min;

[0069] 5) After centrifugation, discard the supernatant and add an equal volume of isopropanol. After standing at room temperature for 20 minutes, centrifuge at 12,000 rpm for 10 minutes to precipitate the genome.

[0070] PCR validation:

[0071] PCR primers were designed according to the hygromycin resistance gene sequence on the transformation plasmid described in Example 1. In the PCR verification experiment, the PCR reaction using plasmid DNA as a template was used as a positive control, the PCR reaction using the genomic DNA of the starting strain of Cephalosporium acremonium as a template was used as a negative control, and the PCR reaction using the recombinant Cephalosporium acremonium genomic DNA as a template was used as an experimental group. If cephalosporin C acyltransferase is successfully transformed into Cephalosporium acremonium, theoretically, the PCR reaction using the recombinant transformant genomic DNA as a template can amplify a 1026bp hygromycin resistance gene fragment. The reaction conditions of PCR are: 94℃3min; (94℃, 20s; 55℃, 20s; 72℃, 1min)) 30 cycles; 72℃10min, and the primers used are Hyg F / Hyg R in Table 1. The recombinant transformants of pUC57-PgpdA_2-XY408, pUC57-PgpdA_2-SE83, pUC57-PgpdA_2-P130, pUC57-PgpdA_2-OK403, pUC57-PgpdA_2-V22, and pUC57-PgpdA_2-Rr that were successfully transferred and verified were named recombinant bacteria WH01, WH02, WH03, WH04, WH05, and WH06, respectively, and stored in glycerol.

[0072] Example 3: Fermentation verification of recombinant transformants

[0073] The recombinant Cephalosporium acremonium verified correctly in Example 2 was activated and cultured. An inoculation needle was used to streak a PDA solid culture medium plate containing a final concentration of 300 μg / mL hygromycin B. After being treated with a sealing film, the culture plate was inverted and cultured in a 30°C incubator for 12-14 days. When a large monoclonal mycelium grew on the streaked plate and the surface was obviously raised, the monoclonal was picked up using an inoculation loop, and a 3×4 cm colony band was drawn on another culture plate, and cultured for 12-14 days. The colony band grown from the plate was inoculated in a 100 mL shaking flask filled with 20 mL seed culture medium (corn steep liquor 30 g·L-1, sucrose 35 g·L-1, glucose 5 g·L-1, methionine 0.5 g·L-1, ammonium sulfate 8 g·L-1, calcium carbonate 5 g·L-1, soybean oil 5 g·L-1, natural pH), and cultured at 230 rpm and 28°C for 4 days. Then, the inoculum size was transferred to 50 mL of 250 mL shake flask fermentation medium with an inoculum size of 15% for fermentation (60 g·L-1 corn steep liquor, 60 g·L-1 soybean oil, 40 g·L-1 glucose, 30 g·L-1 starch, 20 g·L-1 dextrin, 0.2 g·L-1 α-amylase, 6 g·L-1 D / L methionine, 30 g·L-1 ammonium sulfate, 3 g·L-1 magnesium sulfate, 5 g·L-1 calcium carbonate, 7 g·L-1 potassium dihydrogen phosphate, trace elements (0.3 g·L-1 ferrous sulfate, 0.02 g·L-1 copper sulfate, 0.02 g·L-1 zinc sulfate, 0.01 g·L-1 manganese sulfate), and the pH was adjusted to 7.4 using sodium hydroxide).

[0074] HPLC detection of fermentation products

[0075] 2 mL of fermentation broth was taken out from the fermentation medium and used for glucose content determination, nitrogen content determination, bacterial dry weight determination, bacterial microscopic examination and HPLC determination. The sample preparation conditions for HPLC determination are as follows: 2 mL of fermentation broth and 2 mL of methanol were mixed, vortexed to terminate the reaction, and the filter membrane was sterilized before sample injection. The chromatographic column ZORBAX SB-C18Analytical 4.6×150mm 5-Micron was used, the mobile phase conditions were 4% methanol, 0.2% phosphate 96%, and the pH was adjusted to 7.4 with sodium hydroxide. The detection conditions were as follows: UV detector, 254nm, running 15min, injection, 10μL, column temperature 30℃, flow rate 1mL / min. 7-ACA was detected in the fermentation broth by HPLC, and the fermentation yield of recombinant bacteria WH01 was 2.3 g / L, the fermentation yield of recombinant bacteria WH02 was 1.3 g / L, the fermentation yield of recombinant bacteria WH03 was 1.8 g / L, the fermentation yield of recombinant bacteria WH04 was 1.9 g / L, the fermentation yield of recombinant bacteria WH05 was 0.9 g / L, and the fermentation yield of recombinant bacteria WH06 was 0.5 g / L, indicating that the recombinant cephalosporium transformant obtained by the present invention can directly produce 7-ACA by one-step fermentation. If the fermentation process and product purification and extraction steps are further optimized, the 7-ACA production bacteria obtained by the present invention can fully have the potential for industrial use.

[0076] Bacteria 7-ACA yield (g / L) WH01 2.3 WH02 1.3 WH03 1.8 WH04 1.9 WH05 0.9 WH06 0.5

[0077] Example 4. Screening of cephalosporin C acyltransferase mutants

[0078] According to the fermentation yield results in Example 3, the 7-ACA yield of the recombinant transformant WH01 of Cephalosporium acremonium transferred into the plasmid pUC57-PgpdA_2-XY408 is the highest. The present invention uses the error-prone PCR method to establish a random mutant library for the XY408 cephalosporin C acyltransferase sequence to obtain a higher final product 7-ACA conversion rate. The error-prone PCR reaction conditions are as follows: the plasmid pUC57-PgpdA_2-XY408 constructed in Example 1 is used as a template, and the system includes 10ng template, 50mM KCl, 2mM MgCl2, 0.05-0.075mM MnCl2, 0.2mM dATP, 0.2mM dGTP, 1.0mM dCTP, 1.0mM dTTP, 0.2μM upstream and downstream primers, and 5U Taq enzyme. The reaction conditions of PCR are: 94℃3min; (94℃, 20s; 55℃, 20s; 72℃, 60s)) 25 cycles; 72℃3min, and the primers used are ep-XY408-F\ep-XY408-R in Table 1. At the same time, primers vec-XY408-F\vec-XY408-R are used to amplify the plasmid vector backbone, and connected with the ep-PCR fragment of the XY408 cephalosporin C acyltransferase gene by homologous recombination. The connected plasmid was transferred into the protoplasts of Cephalosporium acremonium according to the transformation method described in Example 2, and 800 transformant monoclones were selected from the transformation plate for liquid culture activation, and the 7-ACA production was verified according to the fermentation method described in Example 3. The top 20 transformants with the highest 7-ACA production were sequenced and named, and the table information is as follows:

[0079]

[0080]

[0081] Example 5: Promoter Strength Screening

[0082] In Example 4, the 7-ACA yield of recombinant bacteria WH07 is the highest. The promoter responsible for the initiation of transcription of cephalosporin C acyltransferase in this strain is the endogenous gpdA promoter of cephalosporium acremonium. In order to further improve the expression of cephalosporin C acyltransferase in the bacteria, the present invention uses plasmid pUC57-PgpdA_2-XY408 as a template, and replaces the promoter element by PCR and homologous recombination technology, respectively, by gpdA promoter (sequence 3, recombinant bacteria WH27) derived from Aspergillus niger, gdhA promoter (sequence 4, recombinant bacteria WH28) derived from Aspergillus awamori, cbhI promoter (sequence 5, recombinant bacteria WH29) derived from Trichoderma reesei, and glaA promoter (sequence 6, recombinant bacteria WH30) derived from Aspergillus niger. By the method for protoplast preparation and transformation described in Example 2, the above plasmid is transformed into CPC high-yield cephalosporium acremonium protoplasts to obtain 7-ACA recombinant cephalosporium acremonium transformants. According to the fermentation process described in Example 3, the transformants were fermented in 50 mL shake flasks to evaluate their 7-ACA synthesis ability, but the maximum 7-ACA yield of the transformants was 3.6 g / L. Based on the above results, the endogenous gpdA promoter of Cephalosporium acremonium is more suitable for the expression of acylase in bacteria, and the corresponding 7-ACA yield of recombinant bacteria WH07 is 4.3 g / L. The table information is as follows:

[0083] Bacteria 7-ACA yield (g / L) WH27 3.6 WH28 2.2 WH29 1.1 WH30 1.8

Claims

1. A method for preparing a 7-aminocephalosporanic acid producing strain, It is characterized in that Genes related to the 7-aminocephalosporanic acid synthesis pathway are introduced into Acremonium chrysogenum to obtain a recombinant bacterium, which is a 7-aminocephalosporanic acid producing strain; preferably, the initial bacterium is Acremonium chrysogenum CGMCC 3.3795 or a highly productive CPC recombinant Acremonium chrysogenum.

2. The preparation method according to claim 1, Features: The 7-aminocephalosporanic acid synthesis pathway-related gene is a gene encoding cephalosporin C acyltransferase, and the cephalosporin C acyltransferase can hydrolyze the CPC side chain group.

3. The preparation method according to claim 2, Features: The cephalosporin C acyltransferase is SEQ ID NO: 1 or NCBI No. AAA25690.1, CAA48785.1, AAC34685.2, WP_092168096.1, WP_217659596.1 or a mutant thereof.

4. The preparation method according to claim 3, Features: The mutant is one of the following mutations based on the sequence of SEQ ID NO: 1: G141Q / L185K / A205E, H596K / A600E, W443I / L505A, W443I L505T, D485I / H496K, A571K, N240Q, D350K, V327I, T321G / V327I, T321G, A121H, M173Q, I166L, F381Q, H453N, L505A, R437D, or A565G.

5. The preparation method according to claim 2, Features: The gene encoding cephalosporin C acyltransferase is introduced into Cephalosporium acremonium in the form of an expression vector of an expression cassette, including a promoter and a terminator.

6. The preparation method according to claim 5, Features: The promoter is the endogenous gpdA promoter of Cephalosporium acremonium; preferably, the promoter sequence is SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 5 or SEQ ID NO: 6 or a mutant thereof.

7. The preparation method according to claim 5, Features: The vector backbone of the expression vector is plasmid pUC57.

8. The preparation method according to any one of claims 1 to 7, Features: The genes related to the 7-aminocephalosporanic acid synthesis pathway are obtained by gene editing or homologous recombination.

9. A 7-aminocephalosporanic acid producing strain obtained by the preparation method according to any one of claims 1 to 8.

10. A method for preparing 7-aminocephalosporanic acid, comprising the following steps: fermenting the 7-aminocephalosporanic acid producing strain according to claim 7 to obtain 7-aminocephalosporanic acid; optionally, further comprising the step of collecting the 7-aminocephalosporanic acid.

Images