Reagent for detecting SNP (Single Nucleotide Polymorphism) sites in genome of micropterus salmoides and application of reagent

Abstract

The invention relates to a reagent for detecting SNP sites in genome of micropterus salmoides and application of the reagent, and belongs to the technical field of fish molecular breeding. The invention provides a reagent for detecting SNP (Single Nucleotide Polymorphism) sites in a genome of micropterus salmoides. The reagent is used for detecting genotypes of an SNP site 1, an SNP site 2 and an SNP site 3. The SNP locus 1 is located at the g38928188 position of the chromosome 3 of the genome of the micropterus salmoides, the SNP locus 2 is located at the g38930790 position of the chromosome 3 of the genome of the micropterus salmoides, the SNP locus 3 is located at the g38943374 position of the chromosome 3 of the genome of the micropterus salmoides, and the GenBank login number of the genome of the micropterus salmoides is ASM1485139v1. By detecting the genotypes of the SNP1, SNP2 and SNP3 sites, the resistance of the to-be-detected largemouth bass to the frog iridovirus is effectively determined.

Description

Technical Field

[0001] The invention relates to the technical field of fish molecular breeding, and in particular to a reagent for detecting SNP sites in a largemouth bass genome and an application thereof. Background Art

[0002] Largemouth bass (Micropterus salmoides), also known as California bass, is an important aquaculture species. The viral disease caused by Largemouth bass ranavirus (LMBV) infection is serious and has a mortality rate of up to 100%. There is currently no effective treatment plan, resulting in serious economic losses, which has become a bottleneck problem restricting the healthy development of largemouth bass aquaculture. The location of disease resistance sites and the selection of highly disease-resistant populations have become important strategies for the sustainable development of largemouth bass aquaculture.

[0003] Genome wide association study (GWAS) is a process of detecting genetic variation (marker) polymorphisms of multiple individuals across the genome to obtain genotypes, and then performing statistical analysis on the genotypes and observable traits, i.e., phenotypes, at the population level. The genetic variation (marker) that is most likely to affect the trait is screened out based on the statistic or significant p-value, and then the linkage disequilibrium relationship between the marker and the functional gene is used to mine genes related to trait variation. GWAS has high association accuracy and a short research cycle, and has become an important means of functional gene mining. With the development of science and technology, obtaining high-density genetic markers through high-throughput sequencing technology has become the mainstream of marker development. Based on high-throughput typing technology and combined with GWAS methods, people have discovered and identified a large number of genetic variations associated with complex traits, which has greatly promoted the development of genetics.

[0004] At present, researchers have screened out SNP loci related to largemouth bass resistance to rhabdovirus, but there is a lack of research on SNP loci related to largemouth bass resistance to frog iridovirus. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a reagent for specifically detecting SNP sites in the genome of largemouth bass and its application.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] In a first aspect, the present invention provides a reagent for detecting SNP sites in the genome of largemouth bass, wherein the reagent is used to detect the genotypes of SNP site 1, SNP site 2, and SNP site 3;

[0008] The SNP site 1 is located at g 38928188 of chromosome 3 of the largemouth bass genome,

[0009] The SNP site 2 is located at g 38930790 of chromosome 3 of the largemouth bass genome,

[0010] The SNP site 3 is located at g 38943374 of chromosome 3 of the largemouth bass genome.

[0011] The GenBank accession number of the largemouth bass genome is: ASM1485139v1.

[0012] The invention determines the single nucleotide polymorphism site (SNP) related to the largemouth bass's resistance to frog iridescence virus, and the largemouth bass's resistance to frog iridescence virus can be obtained by detecting the genotype of the SNP site.

[0013] In a specific embodiment of the present invention, the reagents include a primer set;

[0014] The nucleotide sequences of the primer set for detecting SNP site 1 are shown in SEQ ID NOs: 1 to 3;

[0015] The nucleotide sequences of the primer set for detecting SNP site 2 are shown in SEQ ID NOs: 4 to 6;

[0016] The nucleotide sequences of the primer set for detecting SNP site 3 are shown in SEQ ID NOs: 7-9.

[0017] In a second aspect, the present invention provides the use of the reagent in identifying the resistance of largemouth bass to frog iridovirus.

[0018] In a third aspect, the present invention provides the use of the reagent in preparing a kit for identifying the resistance of largemouth bass to frog iris virus.

[0019] In a fourth aspect, the present invention provides use of the agent in largemouth bass breeding.

[0020] In a fifth aspect, the present invention provides a method for identifying the resistance of largemouth bass to frog iridovirus, detecting the genotypes of SNP site 1, SNP site 2 and SNP site 3 of the largemouth bass to be tested;

[0021] The SNP site 1 is located at g 38928188 of chromosome 3 of the largemouth bass genome,

[0022] The SNP site 2 is located at g 38930790 of chromosome 3 of the largemouth bass genome,

[0023] The SNP site 3 is located at g 38943374 of chromosome 3 of the largemouth bass genome.

[0024] The GenBank accession number of the largemouth bass genome is: ASM1485139v1;

[0025] The samples with the GG genotype at SNP site 1 were significantly more resistant to frog iridescent virus than the samples with the GT and TT genotypes;

[0026] The samples with CC genotype at SNP site 2 were significantly more resistant to frog iridescent virus than the samples with GG and GC genotypes;

[0027] The samples with CC genotype at SNP site 3 are significantly more resistant to frog iridescent virus than the samples with AA and AC genotypes.

[0028] In a specific embodiment of the present invention, the reagent is used for detection.

[0029] Furthermore, the method is PCR amplification.

[0030] In a sixth aspect, the present invention provides a kit for identifying the resistance of largemouth bass to frog iris virus, wherein the kit contains the reagent.

[0031] In a specific embodiment of the present invention, the kit further contains Flu-Arms 2×PCR Mix and water.

[0032] The genomic DNA of the largemouth bass to be tested is used as a DNA template, and PCR amplification is performed using primers with nucleotide sequences shown in SEQ ID NOs: 1 to 3, SEQ ID NOs: 4 to 6, and SEQ ID NOs: 7 to 9, respectively, to obtain amplified products, determine the genotypes of SNP sites 1 to 3 of the largemouth bass to be tested in the amplified products, and judge the resistance of the largemouth bass to frog iris virus to the tested largemouth bass.

[0033] The PCR amplification program was as follows: 95°C for 10 min; 95°C for 15 s, gradient annealing from 61 to 55°C for 60 s (-0.6°C / cycle, decreasing by 0.6°C each cycle), for 10 cycles; 95°C for 15 s, 55°C for 60 s, for a total of 30 cycles; 30°C for 30 s.

[0034] The PCR amplification system (total volume 10 μL) is: DNA template 5 ng~250 ng, Flu-Arms 2×PCR Mix 5.0 μL, upstream typing primer F1 (10 μM) 0.05 μL~0.25 μL, downstream typing primer F2 (10 μM) 0.05 μL~0.25 μL, downstream universal primer R (10 μM) 0.1 μL~0.5 μL, supplemented with ddH2O to 10 μL.

[0035] The preferred PCR amplification system (total volume 10 μL) is: DNA template 5ng~50ng, Flu-Arms 2×PCR Mix 5.0μL, upstream typing primer F1 (10μM) 0.1μL, downstream typing primer F2 (10μM) 0.1μL, downstream universal primer R (10μM) 0.3μL, supplemented with ddH2O to 10μL.

[0036] The amplification product of the primers with nucleotide sequences as shown in SEQ ID NOs: 1 to 3 (named as amplification product 1) is shown in SEQ ID NO: 13; the amplification product of the primers with nucleotide sequences as shown in SEQ ID NOs: 4 to 6 (named as amplification product 2) is shown in SEQ ID NO: 14; the amplification product of the primers with nucleotide sequences as shown in SEQ ID NOs: 7 to 9 (named as amplification product 3) is shown in SEQ ID NO: 15.

[0037] When SNP site 1 was located at the 25bp at the 5' end of amplified product 1 (i.e., g 38928188 of chromosome 3 of the reference largemouth bass genome with GenBank accession number: ASM1485139v1), largemouth bass samples with GG genotype were significantly more resistant to frog iris virus than those with GT and TT genotypes, and survived longer after infection with frog iris virus.

[0038] When SNP site 2 was located at the 25bp at the 5' end of amplified product 2 (i.e., g 38930790 of chromosome 3 of the reference largemouth bass with GenBank accession number: ASM1485139v1), largemouth bass samples with CC genotype were significantly more resistant to frog iris virus than those with GG and GC genotypes, and survived longer after infection with frog iris virus.

[0039] When SNP site 3 was located at the 25bp at the 5' end of amplified product 3 (i.e., g 38943374 of chromosome 3 of the reference largemouth bass genome with GenBank accession number: ASM1485139v1), largemouth bass samples with CC genotype were significantly more resistant to frog iris virus than those with AA and AC genotypes, and survived longer after infection with frog iris virus.

[0040] In a seventh aspect, the present invention provides a largemouth bass breeding method, comprising detecting the genotypes of SNP site 1, SNP site 2 and SNP site 3 of the largemouth bass, obtaining a largemouth bass having a genotype of GG at SNP site 1, a genotype of CC at SNP site 2 and a genotype of CC at SNP site 3 as a parent, breeding the parents and obtaining a largemouth bass variety resistant to frog iris virus;

[0041] The SNP site 1 is located at g 38928188 of chromosome 3 of the largemouth bass genome,

[0042] The SNP site 2 is located at g 38930790 of chromosome 3 of the largemouth bass genome,

[0043] The SNP site 3 is located at g 38943374 of chromosome 3 of the largemouth bass genome.

[0044] The GenBank accession number of the largemouth bass genome is: ASM1485139v1.

[0045] Furthermore, the reagent or the kit is used to detect the genotypes of SNP site 1, SNP site 2 and SNP site 3 of largemouth bass.

[0046] Compared with the prior art, the present invention has the following beneficial effects:

[0047] The present invention screened 3 single nucleotide polymorphism sites (SNPs) related to the resistance to frog iridescence virus of largemouth bass through GWAS, and the SNP sites were g38928188G>T site, g38930790C>G site and g38943374C>A site on chromosome 3 of largemouth bass, and the resistance of largemouth bass to frog iridescence virus of GG genotype of SNP1, CC genotype of SNP2 and CC genotype of SNP3 was significantly higher than that of individuals with other genotypes. By detecting the genotypes of SNP1, SNP2 and SNP3 sites, the resistance of largemouth bass to frog iridescence virus to be tested was effectively determined, which provided a basis for further studying the genetic structure of largemouth bass frog iridescence virus resistance and provided valuable information for disease-resistant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 These are the symptoms of largemouth bass infected with largemouth bass frog iris virus (LMBV). A is a healthy largemouth bass; B is a largemouth bass infected with LMBV.

[0049] Figure 2 Distribution density of SNPs on largemouth bass chromosomes after filtering for quality control.

[0050] Figure 3 This is the genome-wide association analysis of largemouth bass resistance to LMBV. A is a Manhattan plot; B is a quantile-quantile (QQ) plot.

[0051] Figure 4 The fluorescence signal reading diagram of different genotypes of largemouth bass at each site. A is g 38928188G>T; B is g38930790C>G; C is g 38943374C>A; D is g 38943495G>A.

[0052] Figure 5 The following is a statistical chart of the survival time of different genotypes of largemouth bass at each site. A is g 38928188G>T; B is g38930790C>G; C is g 38943374C>A; and D is g 38943495G>A.

[0053] Figure 6 The disease incidence and survival rate of largemouth bass in the selected and unselected groups after infection with largemouth bass frog iris virus. A is the unselected group; B is the selected group; C is the survival rate. DETAILED DESCRIPTION

[0054] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific examples. Other materials, reagents, etc. used in the examples, unless otherwise specified, can be obtained from commercial sources.

[0055] Example 1 Analysis of SNP sites of largemouth bass resistance to frog iris virus disease

[0056] 1. Experimental Methods

[0057] 1. Phenotypic determination of largemouth bass resistance to frog iridovirus

[0058] 1000 healthy "Youlu No. 3" (body length about 5.5cm) were selected and artificially infected with largemouth bass frog iris virus (LMBV). 4 TCID 50 / tail), the water temperature was controlled at 28℃, and the largemouth bass were observed once in the morning, noon and evening every day. The time of onset and death of the largemouth bass was recorded, and the tail fins of the dying largemouth bass were collected in time and preserved in anhydrous ethanol.

[0059] 2. Resequencing of the Largemouth Bass Genome

[0060] The tail fin samples of largemouth bass from the top 50 individuals (susceptible group) who died after LMBV infection and the 50 surviving individuals (resistant group) after 14 days of LMBV infection were selected to extract genomic DNA and test the concentration and purity. The OD260 / OD280 of the extracted genomic DNA was between 1.8 and 2.0, and the DNA concentration was greater than 100ng / μL for whole genome resequencing. The genomic DNA was randomly broken into short DNA fragments by enzymes and then blunt-end repaired. Then, dA tails were connected to both ends of the DNA fragments, and sequencing adapters were connected. The DNA fragments with adapters were purified by AMPure XP magnetic beads, and fragments in the range of 300 to 400bp were selected for PCR amplification to obtain the library to be sequenced. After purification and library inspection, the library to be sequenced was sequenced on the whole genome sequencer Hiseq X10 PE150 with a sequencing depth of 10×. After preliminary quality control, an average of 10,556,429,233 bp of high-quality data were obtained for each sample, with 92.48% of high-quality bases (Q value > 30) and an average GC content of 42.45%, and raw reads were obtained.

[0061] The largemouth bass genome (ASM1485139v1) released by NCBI was selected as the reference genome. After quality control of the raw reads obtained by sequencing each sample, the clean reads of each sample were aligned with the reference genome for short sequences to obtain the variant sites of each sample. The obtained variant sites were quality-controlled and filtered using plink2 software to remove non-binary sites, sites with a second allele frequency less than 0.05, sites with a deletion rate greater than 0.5, and sites with a heterozygous ratio greater than 0.8, and a total of 2,902,562 SNPs were obtained. Further SNP quality control filtering was performed to obtain 2,064,240 high-quality SNPs.

[0062] 3. Genome-wide association analysis and disease resistance SNP site screening

[0063] Genome-wide association analysis is a process of detecting genetic variation (marker) polymorphisms of multiple individuals across the entire genome to obtain genotypes, and then performing statistical analysis on the genotypes and observable traits, i.e., phenotypes, at the population level. The genetic variation (marker) that is most likely to affect the trait is screened out based on statistics or significant p-values, and then the linkage disequilibrium relationship between markers and functional genes is used to explore genes related to trait variation.

[0064] The generalized linear model GLM (Q) was calculated using gemma software (v0.98.1), and association analysis was performed on the target trait in the population to locate candidate genes associated with the target trait. The GWAS analysis model is expressed as: y = Xα + Qβ + Kμ + e.

[0065] Among them, y is the phenotypic vector, that is, the survival time of largemouth bass after being infected with frog iris virus, X is the genotype matrix, α is the genotype effect vector, Q is the fixed effect matrix (which can be information such as population structure), β is the fixed effect vector, K is the random effect matrix, mainly referring to the kinship matrix, μ is the random effect vector, and e is the residual vector.

[0066] For each SNP site, we test whether α is 0 and the probability value of α being 0. p is used to measure the degree of association between the marker genotype and the phenotype. The smaller the p value, the smaller the probability of α being 0, and the more likely the marker is associated with the trait.

[0067] 2. Experimental Results

[0068] 1. The peak period of death for largemouth bass is 3-4 days after infection. The main symptoms of death are dragging stool, roaming, spinning, bleeding on the edge of the gill cover and fins, and enlarged spleen. Figure 1 A and Figure 1 B) The survival of the experimental fish was basically stable 7 days after the infection, and the mortality rate of largemouth bass during the whole experiment was 78.8%.

[0069] 2. The distribution of high-quality SNPs on 22 chromosomes is as follows: Figure 2 As shown, the SNP density map shows that the density is highest on chromosome 1 (chr 1) and lowest on chromosome 15 (chr 15) of the largemouth bass genome.

[0070] 3. The susceptible population was assigned a value of 1 and the resistant population was assigned a value of 0 as the phenotypic trait, and an association analysis was performed with the genotypes obtained by resequencing. A total of 2348 SNP loci associated with LMBV resistance were obtained under the threshold line of -log10 p = 4.0 ( Figure 3 A). Among them, the most significant SNP is mainly located on chromosome 3 of the largemouth bass genome. Use R to draw a quantile-quantile (QQ) plot to visualize the association analysis results, such as Figure 3 As shown in B. The results show that the p-value of the significant SNP (-log10p=4) is greater than its expected value, indicating that the GLM model is reliable for the sample data.

[0071] Thus, four SNP sites were obtained, namely:

[0072] SNP1: g 38928188G>T on chromosome 3 of the largemouth bass genome, there are three genotypes: GG, GT and TT;

[0073] SNP2: g 38930790C>G on chromosome 3 of the largemouth bass genome, there are three genotypes: GG, GC and CC;

[0074] SNP3: g 38943374C>A on chromosome 3 of the largemouth bass genome, there are three genotypes: CC, AC and AA;

[0075] SNP4: At g38943495G>A on chromosome 3 of the largemouth bass genome, there are three genotypes: AA, AG and GG.

[0076] Example 2 Correlation analysis between genotype and resistance to frog iris virus

[0077] 1. Experimental Methods

[0078] The four SNP sites of Example 1 of the present invention were verified in another population containing 311 largemouth bass.

[0079] With reference to the chromosome gene sequence of the largemouth bass genome (GenBank accession number: ASM1485139v1), SNPprimer software was used to design PCR amplification specific primer combinations according to the position information of the four SNP sites determined in Example 1. Each primer combination included an upstream typing primer F1, a downstream typing primer F2 and a downstream universal primer R. The primer sequences are shown in Table 1.

[0080] Table 1

[0081]

[0082]

[0083] The largemouth bass frog iridovirus (10 4.5 TCID 50 / tail), recorded the onset and death time of 311 experimental largemouth bass, collected the tail fins of dying fish in time, extracted the genomic DNA of 311 largemouth bass, and stored it at -20℃ for later use. The genomic DNA of 311 largemouth bass was amplified by PCR using the specific primers in Table 1 to obtain the genotypes of SNP sites in different samples. According to the genotyping results, the number of individuals with different genotypes at each site was counted, the gene frequency and genotype frequency of different SNP sites were calculated, and the survival time of largemouth bass after the challenge was correlated.

[0084] PCR amplification system (10 μL): DNA template 5 ng~50 ng, Flu-Arms 2×PCR Mix 5 μL, upstream typing primer F1 (10 μM) 0.1 μL, downstream typing primer F2 (10 μM) 0.1 μL, downstream universal primer R (10 μM) 0.3 μL, supplemented with ddH2O to 10 μL.

[0085] PCR amplification program: 95°C for 10 min; 95°C for 15 s, gradient annealing from 61 to 55°C for 60 s (-0.6°C / cycle, decreasing 0.6°C each cycle), 10 cycles; 95°C for 15 s, 55°C for 60 s, for a total of 30 cycles; 30°C for 30 s.

[0086] 2. Experimental Results

[0087] Figure 4 A. Figure 4 B. Figure 4 C and Figure 4 D are the fluorescence signal reading diagrams of different genotypes of largemouth bass SNP1, SNP2, SNP3 and SNP4 sites.

[0088] As shown in Table 2, Figure 5 A. Figure 5 B and Figure 5 As shown in C, SNP1, SNP2 and SNP3 are significantly correlated with the resistance of largemouth bass to frog iridovirus. The resistance of largemouth bass to frog iridovirus (i.e., the survival time after infection with largemouth bass frog iridovirus) of GG genotype of SNP1 is significantly higher than that of GT and TT genotypes (p<0.01); the resistance of largemouth bass to frog iridovirus of CC genotype of SNP2 is significantly higher than that of GG genotype (p<0.01), and significantly higher than that of GC genotype (p<0.05); the resistance of largemouth bass to frog iridovirus of CC genotype of SNP3 is significantly higher than that of AA and AC genotypes (p<0.01). As shown in Table 2 and Figure 5 As shown in C, there is no significant difference between the genotypes of SNP4 in the resistance of largemouth bass to frog iridovirus.

[0089] Table 2

[0090]

[0091]

[0092] Example 3 A kit for identifying the characteristics of largemouth bass anti-frog iridovirus

[0093] 1. Composition

[0094] Flu-Arms 2×PCR Mix, primers with nucleotide sequences as shown in SEQ ID NOs: 1 to 9, and water.

[0095] 2. Usage

[0096] The genomic DNA of the largemouth bass to be tested is used as a DNA template, and PCR amplification is performed using primers with nucleotide sequences shown in SEQ ID NOs: 1 to 3, SEQ ID NOs: 4 to 6, and SEQ ID NOs: 7 to 9, respectively, to obtain amplified products, determine the genotypes of SNP sites 1 to 3 of the largemouth bass to be tested in the amplified products, and judge the resistance of the largemouth bass to frog iris virus to the tested largemouth bass.

[0097] The PCR amplification program was as follows: 95°C for 10 min; 95°C for 15 s, gradient annealing from 61 to 55°C for 60 s (-0.6°C / cycle, decreasing by 0.6°C each cycle), for 10 cycles; 95°C for 15 s, 55°C for 60 s, for a total of 30 cycles; 30°C for 30 s.

[0098] The PCR amplification system (total volume 10 μL) was: DNA template 5 ng to 50 ng, Flu-Arms 2×PCR Mix 5 μL, upstream typing primer F1 (10 μM) 0.1 μL, downstream typing primer F2 (10 μM) 0.1 μL, downstream universal primer R (10 μM) 0.3 μL, and water was added to 10 μL.

[0099] 3. Interpretation of results

[0100] The amplification product of the primers with nucleotide sequences as shown in SEQ ID NOs: 1 to 3 (named as amplification product 1) is shown in SEQ ID NO: 13 (atacaagagagaaaagtctctatcggcctttctctgagtttcagagtgcagattt ctcct); the amplification product of the primers with nucleotide sequences as shown in SEQ ID NOs: 4 to 6 (named as amplification product 2) is shown in SEQ ID NO: 14 (cgttaagagctaaattcagagatacgtccgtgaggtgtgaggaa gcagagatctgtgccg); the amplification product of the primers with nucleotide sequences as shown in SEQ ID NOs: 7 to 9 (named as amplification product 3) is shown in SEQ ID NO: 15 (gatgatgaggtgccagggtggaggctgaaaataa cacttccgctcagcagttacagccttc).

[0101] When SNP site 1 was located at the 25bp at the 5' end of amplified product 1 (i.e., g 38928188 of chromosome 3 of the reference largemouth bass genome with GenBank accession number: ASM1485139v1), largemouth bass samples with GG genotype were significantly more resistant to frog iris virus than those with GT and TT genotypes, and survived longer after infection with frog iris virus.

[0102] When SNP site 2 was located at the 25bp at the 5' end of amplified product 2 (i.e., g 38930790 of chromosome 3 of the reference largemouth bass genome with GenBank accession number: ASM1485139v1), largemouth bass samples with CC genotype were significantly more resistant to frog iris virus than those with GG and GC genotypes, and survived longer after infection with frog iris virus.

[0103] When SNP site 3 was located at the 25bp at the 5' end of amplified product 3 (i.e., g 38943374 of chromosome 3 of the reference largemouth bass genome with GenBank accession number: ASM1485139v1), largemouth bass samples with CC genotype were significantly more resistant to frog iris virus than those with AA and AC genotypes, and survived longer after infection with frog iris virus.

[0104] Example 4: Breeding method and verification of largemouth bass with frog iris virus resistance

[0105] 1. Experimental Methods

[0106] A largemouth bass with a genotype of GG at the SNP1 site, CC at the SNP2 site, and CC at the SNP3 site was selected as a disease-resistant parent for breeding to obtain offspring, and 1000 offspring with a body length of 4 to 5 cm were selected as a breeding group. The offspring produced by a common largemouth bass population with a body length of 4 to 5 cm that was not bred at the SNP1, SNP2, and SNP3 sites was used as a control group (unselected group), and a challenge experiment was performed according to the method of Example 1, and the incidence of largemouth bass and the survival rate of each group 14 days after the challenge were recorded.

[0107] 2. Experimental Structure

[0108] Three days after the challenge, the back muscles of the largemouth bass in the control group were severely ulcerated ( Figure 6 A), only a few of the largemouth bass in the breeding group showed slight ulceration ( Figure 6 B); 14 days after the challenge, the survival rate of each group was counted. The survival rate of the largemouth bass in the breeding group was 65.47%, which was significantly higher than that of the control group (22.99%). Figure 6 C).

[0109] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A reagent for detecting SNP sites in the genome of largemouth bass, characterized in that: The reagent is used to detect the genotypes of SNP site 1, SNP site 2 and SNP site 3; The SNP site 1 is located at g 38928188 of chromosome 3 of the largemouth bass genome, The SNP site 2 is located at g 38930790 of chromosome 3 of the largemouth bass genome, The SNP site 3 is located at g 38943374 of chromosome 3 of the largemouth bass genome. The GenBank accession number of the largemouth bass genome is: ASM1485139v1.

2. The reagent according to claim 1, characterized in that The reagents include a primer set; The nucleotide sequences of the primer set for detecting SNP site 1 are shown in SEQ ID NOs: 1 to 3; The nucleotide sequences of the primer set for detecting SNP site 2 are shown in SEQ ID NOs: 4 to 6; The nucleotide sequences of the primer set for detecting SNP site 3 are shown in SEQ ID NOs: 7-9.

3. Use of the reagent according to claim 1 or 2 in identifying the resistance of largemouth bass to frog iridovirus.

4. Use of the reagent according to claim 1 or 2 in preparing a kit for identifying the anti-frog iridovirus trait of largemouth bass.

5. Use of the reagent according to claim 1 or 2 in breeding of largemouth bass.

6. A method for identifying the anti-frog iridovirus trait of largemouth bass, characterized in that: Detecting the genotypes of SNP site 1, SNP site 2 and SNP site 3 of the largemouth bass to be tested; The SNP site 1 is located at g 38928188 of chromosome 3 of the largemouth bass genome, The SNP site 2 is located at g 38930790 of chromosome 3 of the largemouth bass genome, The SNP site 3 is located at g 38943374 of chromosome 3 of the largemouth bass genome. The GenBank accession number of the largemouth bass genome is: ASM1485139v1; The samples with the GG genotype at SNP site 1 were significantly more resistant to frog iridescent virus than the samples with the GT and TT genotypes; The samples with CC genotype at SNP site 2 were significantly more resistant to frog iridescent virus than the samples with GG and GC genotypes; The samples with CC genotype at SNP site 3 are significantly more resistant to frog iridescent virus than the samples with AA and AC genotypes.

7. The method according to claim 6, characterized in that The detection is performed using the reagent described in claim 1 or 2.

8. A kit for identifying the anti-frog iridovirus trait of largemouth bass, characterized in that: The kit contains the reagent according to claim 1 or 2.

9. The kit according to claim 8, characterized in that The kit also contains Flu-Arms 2×PCR Mix and water.

10. A method for breeding largemouth bass, characterized in that: Detecting the genotypes of SNP site 1, SNP site 2, and SNP site 3 of largemouth bass, obtaining largemouth bass with a genotype of GG at SNP site 1, CC at SNP site 2, and CC at SNP site 3 as parents, breeding the parents, and obtaining a largemouth bass variety resistant to frog iris virus; The SNP site 1 is located at g 38928188 of chromosome 3 of the largemouth bass genome, The SNP site 2 is located at g 38930790 of chromosome 3 of the largemouth bass genome, The SNP site 3 is located at g 38943374 of chromosome 3 of the largemouth bass genome. The GenBank accession number of the largemouth bass genome is: ASM1485139v1.

Images