Sebastes schlegeli testis cell line and construction method and application thereof

Abstract

The invention discloses a sebastes schlegeli testis cell line as well as a construction method and application thereof, and belongs to the technical field of marine fish cell culture. Primary culture and subculture are carried out on sebastes schlegeli juvenile fish testis tissues, so that the sebastes schlegeli testis cell line capable of being continuously subcultured in vitro for a long time is established. The sebastes schlegeli testis cell line established by the invention is in a fibroblast shape, has a good growth curve, and has relatively strong multiplication capacity. The lentiviral vector can significantly express the stromal cell marker gene temp2, can transfect the cell line, and can be subsequently applied to research of gonad development related functional genes. At present, the cell line has been subjected to in-vitro continuous passage for more than 60 generations, can be subjected to cryopreservation, and is high in recovery survival rate. Establishment of the cell line provides a stable and excellent experimental material for research of fish gonad development genes.

Description

Technical Field

[0001] The invention belongs to the technical field of marine fish cell culture, and particularly relates to a testicular cell line of Scorpio schrenkiana and a construction method and application thereof. Background Art

[0002] Xu's flathead scorpionfish Sebastes schlegelii ), commonly known as blackhead, belongs to the class of bony fish, order of Scorpionfish, family of Scorpionfish, genus of Scorpionfish. It is mainly distributed in the Yellow Sea, Bohai Sea and East China Sea of ​​my country. It is one of the dominant species adapted to deep-sea cage farming in northern my country. Its meat is delicious and has high nutritional value. It is a treasure in the water with high development potential and research value. The establishment of marine fish cell lines provides good experimental materials for virus attack, gene editing and transgenic technology. Compared with in vivo experiments, it has the advantages of high repeatability, simple operation, low cost and short experimental cycle.

[0003] The flatfish has a dimorphic growth pattern between male and female, with females of the same age being more than 25% larger than males. Therefore, the analysis of sex-related mechanisms is particularly important. amhy Male sex-determining genes have been identified, and a variety of sex-related genes have been cloned. However, due to the lack of gonadal cell lines as materials for in vitro experiments, the research on sex-related genes is greatly limited. At the same time, studies have shown that the culture of reproductive stem cells needs to rely on gonadal somatic cell lines as feeder layers, which plays an important role in their in vitro proliferation and in vitro spermatogenesis.

[0004] At present, there are few reports on the construction of cell lines of S. schrenkiana. Only the myoblast cell line of S. schrenkiana has been established, and there are no reports on the establishment of gonadal tissue cell lines of this fish species. The establishment of S. schrenkiana testis cell lines has far-reaching significance for the in vitro functional study of its sex-related genes and reproduction and breeding. Summary of the invention

[0005] In view of the above deficiencies in the prior art, the present invention provides a testicular cell line of Scorpio humilis and a construction method and application thereof.

[0006] The technical solution of the present invention is as follows: In one aspect, the present invention relates to a method for constructing a testicular cell line of Scorpio schrenkiana, the method comprising the following steps: (1) Sampling of testicular tissue of S. philippinarum: Select S. philippinarum juveniles, take testicular tissue, and place it in phosphate buffer containing antibiotics; (2) Primary cell culture: The testicular tissue is washed in a phosphate buffer containing antibiotics, during which the blood vessels, connective tissue and impurities surrounding the testicular tissue are removed until the testicular tissue finally becomes dark black; then, the testicular tissue is transferred to an L-15 medium containing antibiotics, the tissue is cut into minced pieces, and the supernatant is discarded after standing; the tissue blocks are resuspended in an L-15 medium containing antibiotics, and the supernatant is discarded after standing; the tissue blocks are subjected to enzymatic digestion; the digestion is terminated, the mixture is passed through a cell sieve, and the tissue blocks are collected; the tissue blocks are transferred to a cell culture bottle, inverted to allow the tissue to adhere to the wall, and then complete culture medium is added for culture; the cell migration is observed and the complete culture medium is replaced regularly; The complete culture medium is: L-15 culture medium is used as a basic culture medium, and fetal bovine serum, MEM non-essential amino acids, penicillin-streptomycin mixed solution, sodium pyruvate, glutamine, thiol reducing agent solution, scorpionfish embryo extract, basic fibroblast growth factor and epidermal growth factor are added to the basic culture medium; (3) Cell subculture: When the cell abundance reaches 70%-90%, subculture is performed, and the subculture ratio is 1:1~2.

[0007] Preferably, step (3) comprises: When the cell abundance reaches 70%-90%, the cells are subcultured; the ratio of the first subculture is 1:1, and the ratio of subsequent subcultures is 1:2 or 2:3; depending on the cell growth, the cells are subcultured every 3-5 days.

[0008] More preferably, step (3) comprises: When the cell abundance reaches 70%-90%, the cell culture is subcultured. The ratio of the first subculture is 1:1, the ratio of the 2nd to 4th generations is 1:2, the ratio of the 5th to 20th generations is 2:3, and the ratio of the subculture after the 20th generation is 1:2.

[0009] Preferably, the complete culture medium is: L-15 culture medium is used as the basic culture medium, and 20v / v% fetal bovine serum, 1v / v% MEM non-essential amino acids, 1v / v% penicillin-streptomycin mixture, 1 mM sodium pyruvate, 2 mM glutamine, 1v / v‰ thiol reducing agent solution, 1v / v% scorpionfish embryo extract, 10 ng / mL basic fibroblast growth factor, and 20 ng / mL epidermal growth factor are added to the basic culture medium. L-15 culture medium and fetal bovine serum provide cells with abundant nutrients such as protein; the addition of non-essential amino acids, sodium pyruvate, glutamine, basic fibroblast growth factor, and epidermal growth factor can promote cell proliferation and improve cell activity; the thiol reducing agent solution, as a strong reducing agent, can neutralize oxygen free radicals accumulated in the cell culture medium; the embryo extract can provide proteins, polypeptides, and growth factors, etc., to promote cell proliferation and differentiation; the penicillin-streptomycin mixture, as an antibiotic, can inhibit bacterial growth and avoid cell contamination.

[0010] Preferably, the preparation method of the Scorpionfish embryo extract is as follows: Healthy embryos at the somitic stage were collected and washed in phosphate buffer. The embryos were ground on ice until no large fragments were visible, and the homogenate was repeatedly frozen and thawed in a liquid nitrogen-37°C water bath. The homogenate was centrifuged at 4°C and 3500 g, and the supernatant was transferred to a new centrifuge tube and centrifuged at 4°C and 18000 g for 30 min. The bright yellow substance in the middle was the embryonic extract of Scorpionfish xu's.

[0011] Embryonic extract can provide nutrients and cytokines necessary for the growth of testicular cells. If this substance is removed from the complete culture medium, the testicular cells will gradually stop proliferating and fall off the culture bottle. Therefore, we believe that the embryonic extract of the flatfish plays a vital role in the establishment of its testicular cell line.

[0012] Preferably, the antibiotic is a penicillin-streptomycin mixture, and the usage amount of the penicillin-streptomycin mixture is 1-5w / w%.

[0013] Preferably, the enzymatic digestion treatment comprises: using an enzyme solution having a final concentration of 0.25 w / w% trypsin and 1 mg / mL collagenase IV for digestion for 1 hour.

[0014] Preferably, the periodic replacement of the complete culture medium is to replace half of the complete culture medium every 2-3 days.

[0015] In a second aspect, the present invention relates to a testicular cell line of Scorpio schrenkiana, which is prepared by adopting the aforementioned construction method.

[0016] In a third aspect, the present invention relates to a method for constructing the testicular cell line of the flathead raccoon or an application of the testicular cell line of the flathead raccoon in the study of sex-related genes.

[0017] To further illustrate, those skilled in the art will understand that cell abundance refers to the coverage of cells in the culture container. Specifically, when the cell abundance reaches 70-90%, it means that approximately 70-90% of the surface of the culture container is covered by cells. Cell passaging refers to the process of diluting the cells in the original culture bottle according to a certain ratio and transferring them to a new culture container for continued culture. A 1:1 ratio means that the cells in the original culture bottle are transferred to a new culture bottle or dish in equal amounts. A cell passaging ratio of 1:2 means that the number of cells is evenly distributed to two new culture containers for subculture.

[0018] The beneficial effects achieved by the present invention are: The present invention successfully constructed the first testicular cell line of the flatfish. The cells are fibroblast-like, divide vigorously, and have a high frequency of passage. At present, they have been stably passaged for more than 60 times, and can provide a large number of testicular cells of the flatfish for in vitro experiments. After chromosome identification and molecular specific marker identification, it was determined that the cell line is a normal diploid cell and specifically expresses matrix cell marker genes timp2 , which provides good in vitro material for functional studies of sex-related genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The testicular cell line of the flathead raccoon under an inverted microscope provided in the embodiment of the present invention, wherein A is the primary testicular cell of the flathead raccoon; B is the testicular cell of the 3rd generation of the flathead raccoon; C is the testicular cell of the 20th generation of the flathead raccoon; and D is the testicular cell of the 60th generation of the flathead raccoon.

[0020] Figure 2 This is a growth curve of the 30th generation of the testicular cell line of Scorpio humilis provided in an embodiment of the present invention.

[0021] Figure 3 The morphological comparison diagram of the testicular cell line of the flatfish Xu's before and after cryopreservation and thawing provided in the embodiment of the present invention. Among them, A is the morphological diagram of the 15th generation cells, and B is the morphological diagram of the 15th generation cells after thawing.

[0022] Figure 4 This is the 40th generation chromosome metaphase of the testicular cell line of the flathead raccoon fish provided in the embodiment of the present invention.

[0023] Figure 5 The molecular identification results of the testicular cell line of the flatfish provided in the embodiment of the present invention. TE, testicular tissue; TEC, testicular cell line.

[0024] Figure 6Testicular cells of Scorpionfish under a fluorescent inverted microscope provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0025] In order to better understand the technical content of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0026] Example 1 Primary culture of testicular cells of Scorpio humilis, the specific method is as follows: 1) Prepare complete culture medium: L-15 medium (VivaCell, C3070-0500) was used as the basal medium, and 20 v / v% FBS (fetal bovine serum) (Hyclone, SH30406.05), 1 v / v% MEM non-essential amino acids (VivaCell, C3240-0100), 1 v / v% penicillin-streptomycin mixture (VivaCell, C3420-0100), 1 mM sodium pyruvate (Solarbio, SP0100), 2 mM glutamine (Solarbio, G0200), 1 v / v‰ thiol reducing agent solution (G-Clone, CB1430), 1 v / v% scorpionfish embryo extract, 10 ng / mL basic fibroblast growth factor (ABclonal, RP01042), and 20 ng / mL epidermal growth factor (ABclonal, RP01030) were added. Store at 4 ℃ until ready to use.

[0027] 2) Sampling and disinfection of testicular tissue blocks of Xu's flatfish: ① Select 6-7 10-month-old Xu's flatfish juveniles for sampling of testicular tissue. ② Before sampling, wipe the surface of the fish body with 75v / v% alcohol for disinfection. ③ When sampling, use sterile scissors to cut open the fish belly from the genital opening, then use sterile tweezers and scissors to peel off the testicular tissue, and then transfer it to a culture dish filled with PBS (phosphate buffered saline) containing a 5w / w% penicillin-streptomycin mixture.

[0028] 3) Primary culture of cells: ① Wash the testicular tissue 2-3 times in PBS containing 5w / w% penicillin-streptomycin mixture, and remove blood cells and other impurities on the surface of the tissue with sterile scissors and forceps. ② Remove the white membrane on the surface of the testicular tissue and continue to wash it 3-4 times in PBS containing 5w / w% penicillin-streptomycin mixture. ③ Transfer the processed tissue block to a penicillin vial, add 1 mL L-15 culture medium (containing 1w / w% penicillin-streptomycin mixture), and cut the tissue into minced pieces. ④ Let the tissue block solution after cutting in step ③ stand, discard the upper layer of liquid, and leave the tissue block; add L-15 culture medium containing 1w / w% penicillin-streptomycin mixture to resuspend the tissue block, let it stand, discard the upper layer of liquid again, and repeat 2 times; ⑤ Transfer the tissue block to a 50 mL centrifuge tube and perform enzyme digestion for 1 h at 28℃ shaking table (final concentration: 0.25v / v% trypsin, 1 mg / mL collagenase IV). ⑥After digestion, add 1 mL FBS to terminate digestion, pass the mixture through a 70 μm cell sieve, and collect tissue blocks. ⑦Transfer tissue blocks to a culture bottle and arrange them evenly. Invert and culture for 4 hours to allow the tissue to adhere to the wall, then add complete culture medium for culture. Observe cell migration regularly and replace half of the complete culture medium every 2-3 days.

[0029] 4) Subculture of cells: When the abundance of the migrated cells reaches about 70%-80%, subculture can be performed. The first subculture adopts the original bottle subculture method. ① Aspirate all the complete culture medium and wash the cells twice with PBS. ② Add 1 mL of trypsin analogs and digest in a 24 ℃ incubator for 5-8 min. When most of the cells shrink and become round, tap the culture bottle to make the cells float. ③ Add twice the volume of serum-containing culture medium to terminate digestion. ④ Gently blow the cell suspension evenly, transfer it to a 1.5 mL ep tube, and centrifuge it at 1000rpm for 5 min. ⑤ Discard the supernatant, resuspend the cells with complete culture medium, gently blow and mix, and subculture in the original bottle at a ratio of 1:1. When the second generation cells grow to 90% abundance, they are subcultured at a ratio of 1:2. The 2nd-4th generation cells are subcultured at a ratio of 1:2, and the 5th-20th generation cells are subcultured at a ratio of 2:3. After 20 generations, continue to subculture at a ratio of 1:2. PBS, complete culture medium, trypsin and other reagents used in the subculture should be preheated in a 24 ℃ incubator for more than 30 minutes. At present, the cells have been subcultured for more than 60 generations, with strong cell proliferation ability and fibroblast-like appearance. The cell line is named SSTC.

[0030] Example 2 Plotting of the Growth Curve of the Testicular Cell Line of the Scorpionfish In order to analyze the growth of the testicular cell line of S. xu’sii, cells at passage 30 were taken and cultured at 2×10 5The cells were inoculated into 12-well plates at a density of 10 cells / mL and cultured in a 24°C incubator. During the cell culture period, cells from 3 wells were digested and counted using a hemocytometer every day for a total of 7 days. A growth curve was drawn with the number of culture days as the horizontal axis and the number of cells per mL of culture medium as the vertical axis. Figure 2 shown.

[0031] Example 3 Cryopreservation and revival of the testicular cell line of Scorpio hussini 1) Cryopreservation of cells: ① Prepare cell freezing solution in advance: 90% FBS, 10% DMSO (dimethyl sulfoxide), precooled at 4 ℃. ② Take out the cell culture flask with an abundance of about 90%, discard the original culture medium, wash away the residual serum with 2 mL PBS, and wash twice; ③ Add 1 mL of trypsin analogs, digest in a 24 ℃ incubator for 5-8 min, observe the state of the cells, and when most of the cells shrink and become round, tap the culture flask to make the cells float, and then add 2 mL of serum-containing culture medium to terminate digestion. ④ Transfer 3 mL of cell suspension into a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 min. ⑤ After discarding the supernatant, add 1 mL of precooled cell freezing solution, gently blow and pipette to mix, and then transfer to a 2 mL cryopreservation tube, and quickly transfer to a gradient cooling box, place it at -80 ℃ overnight, and then transfer it to liquid nitrogen for long-term storage.

[0032] 2) Cell recovery: ① After taking the frozen cells out of liquid nitrogen, incubate them in a 37 ℃ water bath for 1-2 min. During this period, continue to gently shake the cryopreservation tube to accelerate thawing. Stop the water bath when only a few small ice cubes remain in the cryopreservation tube. ② Immediately transfer to a centrifuge tube containing 5 mL of complete culture medium, centrifuge at 1000 rpm for 5 min, and collect the cells. ③ After discarding the supernatant, add an appropriate amount of complete culture medium, mix gently, and transfer the cell mixture to the culture bottle. After cell recovery, observe the adhesion the next day and change the medium in time. The cell survival rate is as high as 70%-80%, and there is no obvious change in proliferation ability. It can cover the bottom of the bottle for passage in about 3 days, and the cell morphology is no different from before freezing.

[0033] Example 4 Chromosome Analysis of the Testicular Cell Line of Scorpionfish The 40th generation of testicular cells of the flatfish were collected and the cells were divided into 1×10 6 The cells were inoculated at a density of 10 cells / mL in 25 cm 2In a cell culture bottle, culture at 24 °C for 48 h until the confluence reaches 70%-80% and then chromosome karyotype analysis can be performed. ① Add colchicine to the culture medium to make a final concentration of 0.2 μg / mL, and continue to culture at 24 °C for 3.5 h. ② Digest and centrifuge to collect cells into a 15 mL tube, add 5 mL of 0.075 mol / L KCl solution, and treat hypotonicity in a water bath at 37 °C for 30 min. ③ Add 1 mL of pre-cooled Carnoy's fixative (methanol: acetic acid = 3:1 (v / v)) and pre-fix for 2 min. Centrifuge at 1000 g for 5 min to remove the supernatant, add 5 mL of pre-cooled Carnoy's fixative and fix at room temperature for 20 min, repeat 3 times. ④ Add 500 μL of pre-cooled Carnoy's fixative to resuspend the cells, and blow evenly to make a cell suspension. ⑤ Use the cold drop method to drop the slide, pass it over the flame of an alcohol lamp and air dry. ⑥ Stain with 10% Giemsa stain, rinse with water after 10 minutes, and dry naturally. ⑦ Rinse the slide in xylene twice, seal with neutral gum, and observe and count under a 100× oil lens. The results showed that the chromosome mode of the testicular cells of the flatfish was 48 ( Figure 4 ), the chromosome karyotype is 2n=48t.

[0034] Example 5 Molecular identification of testicular cells of Scorpio xu's In order to identify the cell types of the testis cell line of the flatfish, RT-PCR detection of marker genes of different cell types of the testis was performed. The RNA of the testis tissue of the flatfish of different ages and the RNA of the testis cell line were extracted by the Trizol method, and the 5× all in one reverse transcriptase of Acry Biotechnology was used to reverse transcribe and synthesize cDNA as a template. Using the single-cell data previously available in our research group, RT-PCR detection of marker genes of different cell types was performed using the mixed cDNA of testis tissues of different ages and the cDNA of testis cell lines as templates. We amplified the marker genes of germ cells (spermatogonia, spermatocytes, spermatids) in the testis tissue of the flatfish. vasa, sycp2, spam1 and marker genes for somatic cells (support cells, stromal cells, interstitial cells, endothelial cells) gsdf, timp2, cyp17a, adm The specific sequences of the above genes are shown in SEQ ID NO.1 to SEQ ID NO.7. The results showed that stromal cells timp2 It was significantly expressed in the testicular cell line, while other marker genes were not expressed significantly, that is, we established a testicular cell line with stromal cells as the dominant cells.

[0035] The nucleotide sequence of the gene fragment is: sycp2(SEQ ID NO.1):TGCTCGTACAGTCTATGGACCCAGCAAAAACAAAGTCTTTGTGGGGAAGACGGGCACATCTGTAGTGAAGACTACAGTTAAAATTACAATGGAGGACAACATCTCTCAGGTTGTTCCAGAGAGTCAGACGTCCGTTGGCGAAAGTGAGAAAAATACTGCCTCCCATCTTTTACCTGTCCCGTCTG spam1 (SEQ ID NO.2): CCAGGAGAAGTACCTGTTTACGGATCCTCCCCTCTCTCCCGGCCACCCTTTCCTGTTAATTTGGAACGCCCCGACCGAGCTCTGCGAAATCCACCACAAATTGCCACTCGACCTCTCCCACTTCCACATCATTAGCAGCACGCTGAAGCGGGAGACCAACCAGACCATCGCCCTATTCTACATCGACCGCT cyp17a (SEQ ID NO.3): GAGGACTGGTGGACATTTACCCCTGGATGAAGGTCTTTCCTAACAAATGTCTCAGTAAACTGAAGGACTGCATCACCGTGAGAGACCGACTGCTGTCCCGTAAACTGGAGGAGCACA timp2 (SEQ ID NO.4): CAACGACATCTACGGAAACCCCATCAAGAGTCTCAAGTACGAGATCAAACAGATCAAGATGTTCAAAGGTCCCACCCAGGATATTGATGCCATCTACACTGCTCCCATCTCCTCACTGTGTGGAGCGACTCTGGAGAGTAACGGCAAGGAGTA adm2 (SEQ ID NO.5): CTCTTCGACAAGCTCATTGACCGGACAGAGGATGAACCCTCAGCGTCAGGAAGCCAGACTCACGACGCCGTCGCCGTCACCGTCACCGTCACCGTCCCCTCTCCGGCACCCAGCCGATCCCGAAATGGCTGCCCCCCTTCCTGAGACACCAACC gsdf (SEQ ID NO.6): AGATCTGGGATGGGAAAGCTGGGTTATCGTTCCTGCCAGTGTTACCATCGTTCAGTGTGCACTCTGCAACGCCGAAGGGAACACTGTGCAGTGTCCATCATCCCTTACCAATGTC vasa (SEQ ID NO.7): CAACACTGGACACCAAATACGAGACATCTTAAGGGGGTGCAATGTGGTGTGTGGAACCCCAGGGAGACTGTTGGACATGATAGGAAGAGGAAAGGTTGGGCTGAGTA Example 6 Expression of GFP reporter gene in testicular cells of Scorpio hussini One day before transfection, testicular cells of the 60th generation of Xu's flathead raccoon were taken and spread into 96-well cell culture plates in advance, so that the cell confluence was about 60%-70%, and cultured at 24°C overnight. After that, a new complete culture medium was replaced, and the lentiviral suspension was taken out from the -80°C refrigerator. After standing on ice to melt, the lentiviral suspension (lentiviral suspension carrying the GFP reporter gene) was added at an MOI (multiplicity of infection) of 100. After gently mixing, the cells were placed in a 24°C incubator to infect the cells for 24 hours. After that, a new complete culture medium was replaced and the cells were cultured for another 24 hours. Finally, the cell nuclei were stained with Hochest (UElandy, H4047) live cell DNA dye, and the green fluorescence signal was observed under a fluorescence inverted microscope. It was found that more than 10% of the cells expressed strong fluorescence ( Figure 6 ). This indicates that the GFP reporter gene can be effectively expressed in the testicular cells of the flatfish, which means that it is effective to introduce foreign genes into the cells and make them express, providing a feasible technical means for the subsequent use of the cells to conduct in-depth research on the functions of related genes (for example, genes related to gonadal development), cell physiology, etc.

[0036] In summary, the present invention successfully established the first testicular cell line of the flat raccoon in vitro, which is fibroblastic, has a good growth curve, can be stably passaged in vitro for a long time, and has a strong proliferation ability. The testicular cell line of the flat raccoon significantly expresses matrix cell marker genes timp2 , which can be applied to the study of functional genes related to gonadal development. At present, the cell line has been continuously propagated in vitro for more than 60 generations, and can be cryopreserved with a high survival rate. The establishment of this cell line provides stable and excellent experimental materials for the study of genes related to fish gonadal development.

[0037] The above descriptions are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall fall within the protection scope of the present invention.

Claims

1. A method for constructing a testicular cell line of Scorpio xu'sii, characterized in that: The following steps are involved: (1) Sampling of testicular tissue of S. philippinarum: Select S. philippinarum juveniles, take testicular tissue, and place it in phosphate buffer containing antibiotics; (2) Primary cell culture: The testicular tissue is washed in a phosphate buffer containing antibiotics, during which the blood vessels, connective tissue and impurities surrounding the testicular tissue are removed until the testicular tissue finally becomes dark black; then, the testicular tissue is transferred to an L-15 medium containing antibiotics, the tissue is cut into minced pieces, and the supernatant is discarded after standing; the tissue blocks are resuspended in an L-15 medium containing antibiotics, and the supernatant is discarded after standing; the tissue blocks are subjected to enzymatic digestion; the digestion is terminated, the mixture is passed through a cell sieve, and the tissue blocks are collected; the tissue blocks are transferred to a cell culture bottle, inverted to allow the tissue to adhere to the wall, and then complete culture medium is added for culture; the cell migration is observed and the complete culture medium is replaced regularly; The complete culture medium is: L-15 culture medium is used as a basic culture medium, and fetal bovine serum, MEM non-essential amino acids, penicillin-streptomycin mixed solution, sodium pyruvate, glutamine, thiol reducing agent solution, scorpionfish embryo extract, basic fibroblast growth factor and epidermal growth factor are added to the basic culture medium; (3) Cell subculture: When the cell abundance reaches 70%-90%, subculture is performed, and the subculture ratio is 1:1~2.

2. The method for constructing the testicular cell line of Scorpio hussini according to claim 1, characterized in that: Step (3) includes: When the cell abundance reaches 70%-90%, the cells are subcultured; the ratio of the first subculture is 1:1, and the ratio of subsequent subcultures is 1:2 or 2:3; depending on the cell growth, the cells are subcultured every 3-5 days.

3. The method for constructing the testicular cell line of Scorpio hussini according to claim 1, characterized in that: Step (3) includes: When the cell abundance reaches 70%-90%, the cell culture is subcultured. The ratio of the first subculture is 1:1, the ratio of the 2nd to 4th generations is 1:2, the ratio of the 5th to 20th generations is 2:3, and the ratio of the subculture after the 20th generation is 1:

2.

4. The method for constructing the testicular cell line of Scorpio xu'sii according to claim 1, characterized in that: The complete culture medium is: L-15 culture medium as the basic culture medium, 20v / v% fetal bovine serum, 1v / v% MEM non-essential amino acids, 1v / v% penicillin-streptomycin mixture, 1 mM sodium pyruvate, 2 mM glutamine, 1v / v‰ thiol reducing agent solution, 1v / v% scorpionfish embryo extract, 10 ng / mL basic fibroblast growth factor, and 20 ng / mL epidermal growth factor are added to the basic culture medium.

5. The method for constructing the testicular cell line of Scorpio hussini according to claim 1, characterized in that: The preparation method of the scorpionfish embryo extract is as follows: Healthy embryos at the somitic stage were collected and washed in phosphate buffer. The embryos were ground on ice until no large fragments were visible, and the homogenate was repeatedly frozen and thawed in a liquid nitrogen-37°C water bath. The homogenate was centrifuged at 4°C and 3500 g, and the supernatant was transferred to a new centrifuge tube and centrifuged at 4°C and 18000 g for 30 min. The bright yellow substance in the middle was the embryonic extract of Scorpionfish xu's.

6. The method for constructing the testicular cell line of Scorpio hussini according to claim 1, characterized in that: The antibiotic is a penicillin-streptomycin mixture, and the usage amount of the penicillin-streptomycin mixture is 1-5w / w%.

7. The method for constructing the testicular cell line of Scorpio xu'sii according to claim 1, characterized in that: The enzyme digestion treatment includes: using an enzyme solution with a final concentration of 0.25 w / w% trypsin and 1 mg / mL collagenase IV to perform digestion for 1 h.

8. The method for constructing the testicular cell line of Scorpio hussini according to claim 1, characterized in that: The regular replacement of the complete culture medium is to replace half of the complete culture medium every 2-3 days.

9. A testicular cell line of Scorpio xu'sii, characterized in that: The method is prepared by the construction method described in any one of claims 1 to 8.

10. Use of the construction method according to any one of claims 1 to 8 or the testicular cell line of Scorpio hussini according to claim 9 in the study of genes related to gonadal development.

Images