Rice nitrogen high-efficiency utilization gene osnac15, protein encoded by the gene and application of the gene and the protein

By overexpressing or mutating the OsNAC15 gene in rice, the nitrogen use efficiency of rice was improved, solving the problem of low nitrogen fertilizer utilization in rice and achieving the dual goals of increasing crop yield and protecting the environment.

CN119220557BActive Publication Date: 2026-03-03NORTHEAST AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411652019.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-19
Publication Date
2026-03-03
Estimated Expiration
2044-11-19

AI Technical Summary

Technical Problem

Current technologies result in low nitrogen fertilizer utilization rates in rice, leading to reduced grain yields and environmental pollution. There is a lack of effective nitrogen-efficient utilization genes and proteins.

Method used

We provide the rice nitrogen-efficient utilization gene OsNAC15 and its encoded protein. By overexpressing or mutating this gene through genetic engineering, we can improve the plant's ability to absorb, transport, and assimilate nitrogen. We can then use recombinant vectors and host cells to introduce the gene and cultivate crop varieties with high nitrogen efficiency.

Benefits of technology

It significantly improved nitrogen use efficiency in rice, enhanced crop yield and biomass, reduced environmental pollution from excessive nitrogen fertilizer application, provided crop varieties with high nitrogen efficiency, and addressed global challenges to food security and environmental protection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119220557B_ABST
    Figure CN119220557B_ABST
Patent Text Reader

Abstract

This invention discloses the rice nitrogen-efficient utilization gene OsNAC15, its encoded protein, and its applications, belonging to the field of molecular breeding technology. This invention is the first to disclose the role of the OsNAC15 gene in the efficient nitrogen utilization of rice. Overexpression of the rice OsNAC15 gene significantly improves the nitrogen use efficiency and yield of the plant, while mutation of the OsNAC15 gene significantly reduces the nitrogen use efficiency and yield. Mutations and / or overexpressions of the OsNAC15 gene do not result in normal plant development. By precisely regulating the expression level of this gene, the nitrogen nutrient utilization rate of rice can be controlled, thereby increasing crop biomass and yield, and reducing environmental pollution. This has broad application prospects in the agricultural field, especially in the breeding of crop varieties that can efficiently absorb and utilize nitrogen fertilizer, such as rice, corn, wheat, soybeans, cotton, and rapeseed. Its widespread application is expected to lead to more environmentally friendly and efficient agricultural production, providing strong scientific and technological support for solving global food security and environmental protection challenges.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular breeding technology, and in particular to the rice nitrogen-efficient utilization gene OsNAC15, the protein it encodes, and its applications. Background Technology

[0002] Rice (Oryza sativa) is one of the most important food crops for humankind, rich in nutrients, and is the staple food for more than half of the world's population. Nitrogen fertilizer is a major limiting factor for increasing crop yields. Currently, in my country's agricultural production, there is a widespread phenomenon of excessive nitrogen application and low utilization rate. Excessive nitrogen fertilizer application not only leads to reduced grain yields but also causes a series of serious environmental problems such as eutrophication of water bodies. Improving nitrogen use efficiency (NUE) in rice has become one of the important ways to achieve sustainable agricultural development. Therefore, cultivating new varieties with high nitrogen utilization efficiency in rice cultivation can not only achieve the rational use of nitrogen fertilizer in rice but also mitigate the environmental problems caused by excessive nitrogen application, possessing significant potential agricultural production value.

[0003] Nitrogen is a macronutrient and one of the essential nutrients for rice growth. Appropriate application of nitrogen fertilizer can not only increase rice yield but also improve rice quality. The process of nitrogen utilization in rice includes nitrogen absorption, translocation, assimilation, and reuse, involving the participation and regulation of multiple genes and pathways. Nitrogen fertilizer exists in the soil in the forms of nitrate nitrogen and ammonium nitrogen. Rice roots can regulate the absorption and translocation of nitrate and ammonium nitrogen and achieve nitrogen assimilation through nitrate reductase, nitrite reductase, glutamine synthase, and glutamate synthase. In the aboveground parts of the plant, nitrogen transport and distribution are regulated by nitrogen transport proteins, amino acid transport proteins, and other mechanisms.

[0004] Transcription factors play a crucial role in the efficient nitrogen use of rice. They regulate gene expression by binding to specific sequences on DNA to activate or inhibit gene transcription, thereby affecting the plant's processes of nitrogen uptake, transport, assimilation, and reuse. Increasing the expression level of specific transcription factors can significantly improve nitrogen use efficiency in rice. For example, SNAC1 may affect nitrogen fertilizer use efficiency in rice by regulating the expression of genes related to nitrogen metabolism; transgenic rice overexpressing the OsENOD93-1 gene showed higher yield and biomass, indicating that this gene may play an important role in improving nitrogen use efficiency in rice. Transcription factors directly affect nitrogen use efficiency in rice by regulating the expression of genes related to nitrogen metabolism. Therefore, studying and utilizing these transcription factors and the genes they regulate can provide an important theoretical basis and technical support for breeding new nitrogen-efficient rice varieties. Summary of the Invention

[0005] The purpose of this invention is to provide the rice nitrogen-efficient utilization gene OsNAC15, its encoded protein, and its applications, in order to provide a candidate gene highly linked to nitrogen-efficient utilization in order to address global food security and environmental protection challenges.

[0006] To achieve the above objectives, the present invention provides the role of overexpressing the OsNAC15 gene in nitrogen-efficient utilization. The nucleotide sequence of the OsNAC15 gene can be selected from 1) the CDS sequence shown in SEQ ID NO.3; 2) a nucleotide sequence that can hybridize with the DNA sequence shown in SEQ ID NO.3 under high stringency conditions.

[0007] The amino acid sequence encoded by the OsNAC15 gene consists of 301 amino acid residues as shown in SEQ ID NO.4 (A); (B) a protein derived from (A) by substituting, deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.4 and having the same activity as (A); (C) a protein encoded by other genes that has more than 50% similarity in amino acid identity to the protein consisting of the amino acid sequence shown in SEQ ID NO.4 and has the same activity as (A).

[0008] Preferably, overexpression of the OsNAC15 gene increases the nitrogen uptake rate of roots and shoots in seedlings.

[0009] The application of overexpression of the OsNAC15 gene to improve crop yield, as described above.

[0010] The application of recombinant vectors containing the OsNAC15 gene mentioned above in improving crop nitrogen use efficiency and yield, wherein the recombinant vector is an overexpression vector.

[0011] The application of host cells containing the above-mentioned recombinant vector overexpressing the OsNAC15 gene in improving crop nitrogen use efficiency and yield, wherein the host cell is a microbial cell, preferably Escherichia coli cells or Agrobacterium cells.

[0012] Plants overexpressing the OsNAC15 gene as described above, obtained through genetic engineering methods including Agrobacterium-mediated transfection, plasmid transformation, direct DNA transformation, and microinjection; or by using hybridization methods to obtain progeny plants overexpressing the nitrogen-efficient utilization gene OsNAC15 or its active fragment. The plants include, but are not limited to, rice, Arabidopsis thaliana, wheat, maize, cotton, rapeseed, or soybean, with rice being preferred.

[0013] The application of OsNAC15 gene overexpression as described above in the breeding of crop varieties with high nitrogen utilization efficiency.

[0014] A method for cultivating nitrogen-efficient plants, the method comprising: introducing the above-mentioned gene or its active fragment or recombinant expression vector into plant cells to obtain transgenic plants, or hybridizing a plant containing the above-mentioned gene or its active fragment with another plant.

[0015] In another embodiment, the nitrogen-efficient gene OsNAC15 is introduced into progeny plants via hybridization. For example, a plant containing an isolated nucleotide sequence or its active fragment encoding the amino acid sequence shown in SEQ ID NO.4 is hybridized with another plant to obtain progeny plants. Stable homozygous hybrid plants containing the nucleotide sequence or its active fragment are screened out, and the resulting hybrid progeny plants have improved nitrogen utilization compared to unhybridized plants.

[0016] Preferably, the method further includes a step of codon optimization of the above-mentioned gene for the codon application of the plant before it is introduced into plant cells.

[0017] Those skilled in the art will understand that the above method also includes the step of codon optimization of the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 4 for codon application in the plant prior to its introduction into plant cells.

[0018] The breeding method of this invention can be used for breeding rice, corn, wheat, cotton, rapeseed, soybean, forage grass, or Arabidopsis thaliana, preferably for rice breeding. Using this method, plant varieties with improved nitrogen use efficiency can be obtained. The breeding principle is to overexpress the OsNAC15 gene in the plant; specifically, this can be achieved by overexpressing the isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 4 or its active fragment. Transgenic plants or hybrid offspring obtained using the breeding method exhibit growth advantages under low-nitrogen and / or high-nitrogen growth conditions. In this invention, the normal nitrogen application rate is generally 150 kg nitrogen / ha; "low-nitrogen growth conditions" typically refer to applying nitrogen fertilizer at 0.1-0.5 times the normal application rate, and "high-nitrogen growth conditions" typically refer to applying nitrogen fertilizer at 1.5-2 times the normal application rate.

[0019] When used to cultivate rice with improved nitrogen use efficiency, the cultivation method includes: introducing a separated nucleotide sequence or its active fragment encoding the amino acid sequence shown in SEQ ID NO. 4 into rice cells to obtain transgenic rice cells; producing transgenic rice plants expressing the separated nucleotide sequence or its active fragment from the transgenic rice cells; and having improved nitrogen use efficiency compared to control rice without the separated nucleotide sequence or its active fragment introduced; or the method includes: crossing a rice plant containing a separated nucleotide sequence or its active fragment encoding the amino acid sequence shown in SEQ ID NO. 4 with another rice plant to obtain offspring rice plants; screening for stable homozygous hybrid plants containing the nucleotide sequence or its active fragment; and having improved nitrogen use efficiency compared to unhybridized rice plants.

[0020] In summary, the nitrogen-efficient utilization gene provided by this invention is derived from rice and is named OsNAC 15, which is one of the following nucleotide sequences:

[0021] 1) The nucleotide sequence encoding the polypeptide shown in SEQ ID NO.4;

[0022] 2) The DNA sequence of SEQ ID NO.3;

[0023] 3) A nucleotide sequence that can hybridize with the DNA sequence defined in SEQ ID NO.3 under highly stringent conditions.

[0024] SEQ ID NO.3 consists of 906 bases, and its coding sequence starts from the first base at the 5′ end and encodes the amino acid sequence shown in SEQ ID NO.4.

[0025] Expression vectors, transgenic cell lines, and host bacteria containing the nitrogen-efficient utilization gene of the present invention are also within the scope of protection of the present invention.

[0026] Primer pairs that amplify any fragment of OsNAC15 are also within the scope of protection of this invention.

[0027] By using a plant expression vector, the nitrogen-efficient utilization gene of the present invention can be introduced into plant cells to obtain transgenic cell lines and transgenic plants with enhanced nitrogen utilization efficiency.

[0028] The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microbombardment. The plant expression vectors may also include the 3′ untranslated region of a foreign gene, i.e., containing a polyadenylate signal and any other DNA fragment that can participate in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3′ end of the mRNA precursor; similar functions exist in the untranslated regions transcribed at the 3′ ends of Agrobacterium crown gall tumor-inducing (Ti) plasmid genes (such as the lipase NOS gene) and plant genes (such as the soybean storage protein gene).

[0029] When constructing plant expression vectors using OsNAC15, any enhancing or inducible promoter, such as the cauliflower mosaic virus (CAMV) 35S promoter or root-specific expression promoter, can be added before its transcription initiation nucleotide. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The translation control signals and start codons are widely available and can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0030] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as the herbicide Bar gene). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0031] The plant expression vector carrying the OsNAC15 of this invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant cells or tissues can be cultured into plants. The plant hosts to be transformed can be monocotyledonous plants such as rice, corn, and wheat, or dicotyledonous plants such as Arabidopsis thaliana, soybean, rapeseed, and cotton.

[0032] Growth experiments and field trials on transgenic rice transformed with the OsNAC15 gene in nutrient solutions with different nitrogen levels demonstrated that the gene significantly improves nitrogen use efficiency and increases plant biomass after transformation. Growth experiments on transgenic Arabidopsis thaliana transformed with the OsNAC15 gene in culture media with different nitrogen levels showed that the gene's function is conserved in the model plant. This invention provides a foundation for artificially enhancing plant nitrogen use efficiency and will play an important role in cultivating nitrogen-efficient plants (especially crops such as rice, corn, wheat, rapeseed, soybean, and cotton).

[0033] Therefore, the specific technical effects of the rice nitrogen-efficient utilization gene OsNAC15, its encoded protein, and its applications provided by this invention are as follows:

[0034] (1) This invention discloses for the first time the role of the OsNAC15 gene in the efficient nitrogen use of rice. Overexpression of the rice OsNAC15 gene significantly improves the nitrogen use efficiency of the plant, while mutation of the OsNAC15 gene significantly reduces the nitrogen use efficiency of the plant.

[0035] (2) Overexpression of the rice OsNAC15 gene significantly increased the seed setting rate, effective panicle number, yield per plant, and dry weight of rice; mutation of the OsNAC15 gene significantly decreased the seed setting rate, effective panicle number, yield per plant, and dry weight of rice.

[0036] (3) Mutation and / or overexpression of the OsNAC15 gene result in normal plant development. By precisely regulating the expression level of this gene, the nitrogen nutrient utilization rate of rice can be controlled. This can not only promote the increase of rice yield, but also effectively alleviate the environmental problems caused by excessive application of nitrogen fertilizer. It shows great application potential in the agricultural field, especially in the cultivation of crop varieties that can efficiently absorb and utilize nitrogen fertilizer, such as rice, corn, wheat, soybean, cotton and rapeseed. Its widespread application is expected to lead agricultural production to be more environmentally friendly and efficient, and provide strong scientific and technological support for solving global food security and environmental protection challenges.

[0037] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0038] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0039] Figure 1This is the subcellular localization result of the OsNAC15 gene in Example 1 of the present invention; where A is the GFP green fluorescent protein of the control group, B is the red fluorescence observation result of the control group, C is the protoplast state of the control group under bright field, D is the cell state of the control group under bright field, E is the GFP green fluorescent protein of OsNAC15, F is the red fluorescence observation result of OsNAC15, G is the protoplast state of OsNAC15 under bright field, and H is the cell state of OsNAC15 under bright field.

[0040] Figure 2 The physical spectrum of the recombinant expression vector PBWA(V)HS-NAC15-OE-GL osgfp10500 obtained in Example 2 of this invention;

[0041] Figure 3 The results are RT-PCR detection results of transgenic positive homozygous plants OE-1 and OE-2 overexpressing the OsNAC15 gene and wild-type plants (WT) in Example 3 of this invention.

[0042] Figure 4 This is a physical map and target location information map of the recombinant CRISPR-cas9 expression vector obtained in Embodiment 4 of the present invention;

[0043] Figure 5 This refers to the mutation site information of the OsNAC15 gene mutant lines KO-1, KO-2, and KO-3 relative to WT in Example 5 of this invention;

[0044] Figure 6 This is the statistical result of nitrogen uptake rate of buds and roots of transgenic positive homozygous plants OE-1 and OE-2 that overexpress the OsNAC15 gene, as well as OsNAC15 gene mutant lines KO-1, KO-2 and KO-3, during the seedling stage in Example 6 of this invention.

[0045] Figure 7 In Example 6 of this invention, the statistical results of plant photographs A, effective panicle number B, yield C, seed setting rate D, and dry weight E of transgenic positive homozygous plants OE-1 and OE-2 overexpressing the OsNAC15 gene, and OsNAC15 gene mutant lines KO-1, KO-2, and KO-3 under high nitrogen (HN) and low nitrogen (LN) conditions were presented. * indicates significant differences between the two groups: *: P < 0.05, **: P < 0.01, ***: P < 0.001, ****: P < 0.0001. Detailed Implementation

[0046] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0047] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0048] The instruments, equipment, reagents and materials used in the embodiments were all obtained through commercial means, and the methods unless otherwise specified are conventional techniques in the field.

[0049] Example 1

[0050] Obtain the cDNA sequence of the OsNAC15 gene and perform subcellular localization analysis.

[0051] Total RNA was extracted from 7-day-old Dongnong 427 seedlings using the TRIzol method (TRIzol reagent was purchased from Invitrogen, Carlsbad, CA). 1 μg of total RNA was used to obtain cDNA by reverse transcription using a reverse transcription kit produced by Hangzhou Xinjing Bio-Reagent Development Co., Ltd., following the steps described in the product user guide.

[0052] Using the obtained cDNA as a template, RT-PCR amplification was performed with the primers shown in SEQ ID NO.1 and SEQ ID NO.2 to obtain the cDNA sequence of the OsNAC15 gene. The amplification system consisted of: 0.8 μL FastPfu polymerase (Beijing TransGen Biotech Co., Ltd.), 0.5 μL cDNA, 10 μL 5×PCR buffer, 100 μM dNTPs, 25 μM each of forward and reverse primers, and then the reaction system was brought to 50 μL with double-distilled water. The PCR program was: 95℃ for 1 min, then 58℃ for 30 s, and finally 72℃ for 1 min, for a total of 40 cycles.

[0053] SEQ ID NO.1:TTCTCCTGCGTCGTCATCG

[0054] SEQ ID NO.2:ACTTGCGGTCCTTGTGGC

[0055] After the PCR reaction was completed, the PCR products were recovered using a gel extraction kit and sent to the company for sequencing. The sequencing results showed that the cDNA sequence of the OsNAC15 gene is shown in SEQ ID NO.3, and the encoded amino acid sequence is shown in SEQ ID NO.4.

[0056] SEQ ID NO.3:

[0057]

[0058] SEQ ID NO.4:

[0059]

[0060] The empty PBWA(V)HS vector was digested with EcoRI and BamHI, and the PBWA(V)HS vector fragment was recovered by gel electrophoresis. Homologous recombination was then performed to ligate the target fragment into the vector, followed by transformation. 10 μL of the ligation product was transformed into competent *E. coli* cells (see standard method for *E. coli* competent cell transformation) and plated with kanamycin-resistant plaques. The plaques were incubated at 37°C for 12 hours, and then identified by plaque PCR. Single plaques were then picked and sequenced. Subcellular localization was determined by transfecting rice protoplasts, and fluorescence signals were observed using a laser confocal microscope. The results are as follows: Figure 1 As shown, the green fluorescence signal of the control group sample transformed with the empty vector was present in the rice protoplast, while the green fluorescence signal of the OsNAC15 fusion protein transfected appeared in the nucleus region of the protoplast, indicating that the protein encoded by the OsNAC15 gene is located in the nucleus.

[0061] Example 2

[0062] Constructing an overexpression vector for the OsNAC15 gene

[0063] Using homologous recombination and Golden Gate seamless cloning, the purified OsNAC15 gene CDS fragment obtained in Example 1 was ligated into the PBWA(V)HS vector. The specific steps are as follows:

[0064] Using the CDS sequence of the OsNAC15 gene as a template, PCR was performed using primers shown in SEQ ID NO.5 and SEQ ID NO.6. The amplification system consisted of 20 μL Nuclease-free Water, 25 μL Biorun Pfu PCR Mix, 2 μL each of forward and reverse primers, and 1 μL template. The amplification program was as follows: 94℃ for 5 min (1 cycle), 94℃ for 30 sec (30 cycles), 50℃ for 45 sec (30 cycles), 72℃ for 54 sec (30 cycles), 72℃ for 10 min (1 cycle), and 16℃ for 30 min (1 cycle), for a total of 93 cycles. In addition to sequencing, the recombinant plasmid was digested with EcoRV restriction enzyme, and the actual fragment size of the recombinant plasmid was verified to be consistent with the theoretical value. The physical map of the recombinant expression vector PBWA(V)HS-NAC15-OE-GLosgfp10500 is shown below. Figure 2 As shown.

[0065] SEQ ID NO.5:AACACGGGGGACTTTGCAACATGTCGGAGTCGGAGGTGTCG

[0066] SEQ ID NO.6:CCTGAAGCGGCCGCTGTACAGGCCTTCCATATGTAGGAGTAGTCC Example 3

[0067] Obtaining and identifying transgenic positive plants overexpressing the OsNAC15 gene

[0068] The recombinant expression vector PBWA(V)HS-NAC15-OE-GLosgfp10500 obtained in Example 2 was genetically transformed using Agrobacterium tumefaciens EHA105-mediated transformation, with the Dongnong 422 rice variety as the experimental material. For details, please refer to the Efficient Transformation of Rice (Oryza sativa).

[0069] L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, 1994, Plant Journa 16: 271-282.

[0070] After the transgenic plants have rooted, they are transferred to culture soil for growth. Young leaves are cut off, and whole-genome DNA is extracted from each transgenic plant using the CTAB method. The obtained DNA is used as a template, and PCR is performed using primers shown in SEQ ID NO.7 and SEQ ID NO.8 to obtain transgenic positive plants of the OsNAC15 gene, which are the T0 generation. Individual plants are harvested and sown, and then harvested individually after conventional sowing and self-pollination until the T2 generation is detected to obtain transgenic homozygous plants of the OsNAC15 gene.

[0071] SEQ ID NO.7:TCCGCAAAGGAGGAATGG

[0072] SEQ ID NO.8:GGGAGAAGTAGCCGTAGTGGT

[0073] Seeds of the obtained OsNAC15 gene-positive homozygous transgenic plants were sown on MS medium (formula shown in Table 1). The germinating homozygous lines were cultured routinely until day 7. Young leaves were harvested, and RNA was extracted using the method described in Example 1. Reverse transcription was then performed. Using the cDNA obtained from reverse transcription as a template, the ACTIN1 gene as an internal control, and primers shown in SEQ ID NO. 9 and SEQ ID NO. 10, qRT-PCR was performed using a Q-PCR kit (Takara Premix Ex Taq™ II) manufactured by Takara Bio Inc. (Dalian) to identify the expression level of the OsNAC15 gene in each line. The qRT-PCR system consisted of: 0.25 μL each of 10 μM forward and reverse primers, 0.3 μL of cDNA, 4.2 μL of double-distilled water, and 5 μL of SYBR Green reagent. The qRT-PCR program was: 95℃, 1 min; 95℃, 5 s; 60℃, 30 s, 40 cycles. The primer sequences used to amplify the ACTIN1 gene are shown in SEQ ID NO.11 and SEQ ID NO.12. The expression level of the OsNAC15 gene in 7-day-old wild-type (Dongnong 427) seedlings was detected as a control using the same method.

[0074] The two strains with the largest expression levels compared to the wild type were selected and named OE-1 and OE-2, respectively, for subsequent experiments. The relative expression levels of OE-1 and OE-2 compared to the wild type are shown below. Figure 3 As shown.

[0075] SEQ ID NO.9:GGAGGAATGGGCGGTTTG

[0076] SEQ ID NO.10:CCGTCTTGAGCGTGGAGGT

[0077] SEQ ID NO.11:TGGTCGTACCACAGGTATTGTGTT

[0078] SEQ ID NO.12:AAGGTCGAGACGAAGGATAGCAT

[0079] Table 1

[0080]

[0081]

[0082] Example 4

[0083] Constructing a CRISPR-Cas9 expression vector for the OsNAC15 gene

[0084] According to the "Kinmen" cloning method, a target with one target (target sequence as follows) will be used. Figure 4 The gRNA expression cassette (as shown) is linked to the pYLCRISPR / Cas9Pubi-H vector backbone, and the constructed vector is the pYLCRI SPROsNAC15-gRNA vector.

[0085] Example 5

[0086] Obtaining and identifying OsNAC15 gene CRISPR-Cas9 transgenic positive plants

[0087] The recombinant expression vector pYLCRISPROsNAC15-gRNA obtained in Example 4 was introduced into the normal Dongnong 422 rice variety using Agrobacterium EHA105-mediated genetic transformation (for details, see Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, 1994, Plant Journal 6: 271-282).

[0088] When the transgenic plants reached 5-6 true leaves, the leaves were cut and the whole genome DNA of the transgenic plants was extracted using the CTAB method. The target region sequence was amplified using primers shown in SEQ ID NO.13 and SEQ ID NO.14. The amplified products were sent to the company for sequencing. Positive plants with effective mutations in the OsNAC15 gene were screened and recorded as the T0 generation. Individual plants were harvested and planted until homozygous plants were detected in the T2 generation. Three OsNAC15 gene mutant lines were selected from the obtained lines for subsequent experiments and named KO-1, KO-2, and KO-3, respectively.

[0089] The OsNAC15 gene mutant strain produced mutations near the target site that impaired the normal functioning of the gene. Information on the KO-1, KO-2, and KO-3 mutation sites is as follows: Figure 5 As shown, the OsNAC15 gene of the KO-1 strain has a deletion of 1 base at the target site, the OsNAC15 gene of the KO-2 strain has a deletion of 2 bases at the target site, and the OsNAC15 gene of the KO-3 strain has an insertion of 1 base at the target site.

[0090] Example 6

[0091] Evaluation of nitrogen nutrient use efficiency of transgenic positive lines obtained in Examples 3 and 5 (I) Nitrogen uptake rate of each transgenic positive line at the seedling stage

[0092] All transgenic positive lines were simultaneously sown in the field and managed routinely until the seedling stage. On the same day, the nitrogen uptake rates of the buds and roots of each transgenic positive line were measured, with the wild type as a control. The results are as follows: Figure 6 As shown, the nitrogen uptake rates of shoots and roots of the overexpression lines were significantly higher than those of the wild type, while the nitrogen uptake rates of shoots and roots of the KO-1, KO-2, and KO-3 mutant lines were significantly lower than those of the wild type.

[0093] (II) Examining yield-related parameters of each transgenic positive line

[0094] After each transgenic positive line has grown normally in the field for 3 months, plant photos are as follows. Figure 7 As shown in Figure A, the OsNAC15 overexpression lines exhibited a significant growth advantage, while the knockout mutants showed weaker growth. The effective spike number, yield, seed setting rate, and dry weight of each line were statistically analyzed, and the results are shown below. Figure 7 As shown in B, C, D, and E, the overexpression lines showed a slight increase in seed setting rate compared to the wild type, but the increase was not significant. The number of effective panicles was significantly increased, the yield was significantly improved, and the dry weight was increased. On the other hand, the seed setting rate of the KO-1, KO-2, and KO-3 lines was slightly lower than that of the wild type, but the decrease was not significant. However, the number of effective panicles and the yield were significantly reduced, and the dry weight was also reduced. These data indicate that rice overexpressing OsNAC15 has a significant advantage in field growth.

[0095] Therefore, this invention discloses for the first time the role of the OsNAC15 gene in the efficient nitrogen use of rice. Overexpression of the rice OsNAC15 gene significantly improves the nitrogen use efficiency of the plant, while mutation of the OsNAC15 gene significantly reduces the nitrogen use efficiency of the plant. Overexpression of the rice OsNAC15 gene significantly improves the seed setting rate, effective panicle number, yield per plant, and dry weight of rice; mutation of the OsNAC15 gene significantly reduces the seed setting rate, effective panicle number, yield per plant, and dry weight of rice. Mutations and / or overexpressions of the OsNAC15 gene result in normal plant development. By precisely regulating the expression level of this gene, the nitrogen nutrient utilization rate of rice can be controlled, thereby increasing crop biomass and yield, and reducing environmental pollution. This has broad application prospects in the agricultural field, especially in the breeding of crop varieties that can efficiently absorb and utilize nitrogen fertilizer, such as key crops like rice, corn, wheat, soybeans, cotton, and rapeseed. Its widespread application is expected to lead to more environmentally friendly and efficient agricultural production, providing strong scientific and technological support for solving global food security and environmental protection challenges.

[0096] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. Overexpression OsNAC15 The application of genes in the efficient nitrogen utilization of rice is characterized by: OsNAC15 The CDS sequence of the gene is shown in SEQ ID NO.3, and the encoded amino acid sequence is shown in SEQ ID NO.4; overexpression OsNAC15 Genes enhance nitrogen uptake rates in rice seedling roots and shoots.

2. Containing the contents of claim 1 OsNAC15 The application of recombinant gene vectors in improving nitrogen use efficiency in rice is characterized by: The recombinant vector is an overexpression vector.

3. Containing the invention described in claim 2 OsNAC15 The application of host cells of gene recombinant vectors in improving nitrogen use efficiency in rice is characterized by: The host cell is either an Escherichia coli cell or an Agrobacterium cell.

4. The overexpression as described in claim 1 OsNAC15 Application of genes in the breeding of nitrogen-efficient rice varieties.

5. A method for cultivating nitrogen-efficient rice, characterized in that, The method includes: introducing the gene of claim 1 or the recombinant vector of claim 2 into rice cells to obtain transgenic rice.

Citation Information

Patent Citations

  • Plants having enhanced yield-related traits and a method for making the same

    CN102459614A