Medicine for treating tumor containing TP53 gene mutation

Abstract

The invention discloses a medicine for treating tumors containing TP53 gene mutation. The medicine comprises a thymine DNA (Deoxyribose Nucleic Acid) glycosylase (TDG for short) inhibitor and pharmaceutically acceptable auxiliary components of the thymine DNA glycosylase (TDG for short) inhibitor. The TDG inhibitor used in the invention can effectively inhibit human TDG protein expression, and has a good treatment effect on TP53 gene mutation-containing tumors.

Description

Technical Field

[0001] The present invention relates to the field of medicine. Specifically, the present invention discloses a drug for treating tumors containing TP53 gene mutations. Background Art

[0002] The accumulation of genetic and epigenetic changes in cells can lead to uncontrolled cell growth and proliferation, which in turn leads to cancer. TP53 is one of the most commonly mutated genes in human cancer, occurring in about 50% of human cancers, including lung cancer, breast cancer, colon cancer, ovarian cancer, and gastric cancer. TP53 mutations can occur at any stage of cancer development and are associated with poor prognosis and resistance to treatment.

[0003] TP53 is an important tumor suppressor gene that acts as a transcription factor to regulate the expression of genes related to cell cycle, DNA repair and apoptosis. Its mutation can lead to the loss of function of related proteins, which in turn leads to the inability to induce apoptosis or arrest the cell cycle in response to DNA damage, ultimately promoting tumor growth and metastasis. TP53 mutations can also cause proteins to gain abnormal functions, thereby promoting tumor growth and metastasis.

[0004] Despite the importance of TP53 mutations in cancer development and progression, there are currently no drugs that directly target TP53 mutations. There are several challenges in developing TP53-directed targeted therapies, mainly in the following aspects: (1) TP53 is a complex protein with multiple functions, so it is difficult to develop drugs that selectively target the mutant protein form without affecting the normal protein form; (2) TP53 mutations may occur at any stage of cancer development, so it is difficult to develop drugs that are effective for all cancer stages; (3) TP53 mutations can be heterozygous or homozygous, resulting in different levels of protein expression and function. This heterogeneity may make it difficult to develop drugs that are effective against all TP53 mutant tumors.

[0005] Although TP53 is a difficult target to develop into a drug, its gene mutation not only causes it to lose its normal function, but also activates cascade signaling pathways to promote tumor progression and compensate for the loss of function, suggesting that a large number of "synthetic lethal" partners may be hidden in these altered pathways. In summary, the field still needs to develop tumor therapeutic drugs targeting TP53 targets. Summary of the invention

[0006] The inventors have found through research that thymine DNA glycosylase (abbreviated as TDG, the same below) is a good "synthetic lethal" partner of TP53 gene mutation, and has great application prospects in the treatment of TP53 mutant tumors. The use of a pharmaceutical composition including a thymine DNA glycosylase (TDG) inhibitor and a pharmaceutically acceptable auxiliary component thereof can effectively inhibit the expression of human TDG protein and has a good therapeutic effect on tumors containing TP53 gene mutations.

[0007] In a first aspect, the present invention provides a use of a TDG inhibitor for preparing a pharmaceutical composition for treating TP53 gene mutation-related tumors;

[0008] The pharmaceutical composition comprises: a therapeutically effective amount of a TDG inhibitor and a pharmaceutically acceptable carrier auxiliary component thereof.

[0009] In another preferred embodiment, the pharmaceutical composition is used to down-regulate the TP53 gene expression level or expression amount of the treatment subject.

[0010] In another preferred embodiment, the TP53 gene mutation tumor is selected from the following group: lung cancer, skin melanoma, liver cancer, breast cancer, acute myeloid leukemia, colon cancer, colorectal cancer, esophageal cancer, gastric cancer, pancreatic cancer, and bladder cancer.

[0011] In another preferred embodiment, the TP53 gene mutation is selected from the following group: missense mutation, gene deletion, frameshift mutation, splice site mutation, and truncation mutation.

[0012] In another preferred embodiment, the protein sequence changes caused by the TP53 gene mutation include but are not limited to the following group:

[0013] p.146_149WVDS>C、p.157_158insL、p.165_166insYKQ、p.173_174VR>G、p.239_240insN、p.247_248NR>KW、p.249_250insR、p.A119fs、p.A138P、p.A159D、p.A159P、p.A159V、p.A161D、p.A161T、p.A189A、p.A347P、p.A347V、p.A70A、p.A74S、p.A76fs、p.A88fs、p.C124*、p.C124R、p.C135F、p.C135fs、p.C135R、p.C135Y、p.C141W、p.C141Y、p.C176F、p.C176fs、p.C176S、p.C176W、p.C176Y、p.C229fs、p.C238F、p.C238fs、p.C238G、p.C238R、p.C238S、p.C238Y、p.C242F、p.C242fs、p.C242G、p.C242R、p.C242S、p.C242W、p.C242Y、p.C275F、p.C275fs、p.C275G、p.C275Y、p.C277F、p.D148G、p.D207Y、p.D228fs、p.D259V、p.D259Y、p.D281G、p.D281N、p.D281Y、p.D48fs、p.D48N、p.D49H、p.E11Q、p.E171*、p.E171del、

[0014] p.E180*、p.E180fs、p.E204*、p.E204fs、p.E224D、p.E224E、p.E224K、p.E258*、p.E258A、p.E258K、p.E271*、p.E271fs、p.E271K、p.E285K、p.E285V、p.E286K、p.E287*、p.E287D、p.E294*、p.E294fs、p.E298*、p.E326*、p.E326K、p.E336*、p.E336fs、p.E339*、p.E343*、p.E349*、p.E349fs、p.E51*、p.E56*、p.E62*、p.EE286del、p.F113C、p.F113L、p.F113S、p.F113V、p.F134fs、p.F341F、p.G105R、p.G108del、p.G108fs、p.G108V、p.G154V、p.G187C、p.G187R、p.G199*、p.G199G、p.G244A、p.G244C、p.G244D、p.G244S、p.G245C、p.G245D、p.G245R、p.G245S、p.G245V、p.G262D、p.G262S、p.G262V、p.G266*、p.G266E、p.G266R、p.G266V、p.G293fs、p.G334V、p.G356G、p.G360V、p.G389W、p.H178D、p.H179D、p.H179fs、p.H179Q、p.H179R、p.H179Y、p.H193fs、p.H193L、p.H193N、p.H193P、p.H193R、p.H193Y、p.H214H、p.H214R、p.H233del、p.H296Y、p.I162N、p.I195F、p.I195S、p.I195T、p.I232N、p.I232S、p.I251fs、p.I251L、p.I251N、p.I251T、p.I254D、p.I254S、p.I255del、p.I255N、p.I255S、p.I255T、p.K101*、p.K101fs、p.K120*、p.K120fs、p.K120N、p.K132E、p.K132M、p.K132N、p.K132Q、p.K132R、p.K132T、p.K139fs、p.K164*、p.K164E、p.K164N、p.K291*、p.K291E、p.K291L、p.K292I、p.K319*、p.K320N、p.K382fs、p.L130F、p.L130R、p.L130V、p.L137Q、p.L145R、p.L194F、p.L194R、p.L252fs、p.L252L、p.L264R、p.L265P、p.L323fs、p.L35fs、p.L93fs、p.LAPP188del、p.M133K、p.M237I、p.M246I、p.M246R、p.M246T、p.M246V、p.N131K、p.N200fs、p.N235del、p.N239D、p.N239S、p.N268fs、p.N268I、p.N310fs、p.N345fs、p.N345S、p.P142fs、p.P142R、p.P151A、p.P151H、p.P151S、p.P152fs、p.P152L、p.P152P、p.P152S、p.P153fs、p.P177L、p.P177T、p.P190L、p.P191del、p.P191fs、p.P219fs、p.P223L、p.P250L、p.P278F、p.P278H、p.P278L、p.P278P、p.P278R、p.P278S、p.P278T、p.P27L、p.P295P、p.P301fs、p.P309S、p.P316P、p.P318fs、p.P322fs、p.P36fs、p.P36L、p.P47fs、p.P47P、p.P58fs、p.P98fs、p.P98L、p.P98S、p.PPQH190del、p.Q100*、p.Q104*、p.Q136*、p.Q136fs、p.Q144*、p.Q167*、p.Q16L、p.Q192*、p.Q317*、p.Q317fs、p.Q331*、p.Q331R、p.Q38*、p.Q52*、p.Q52fs、p.Q52P*、p.R110C、p.R110L、p.R110P、p.R156P、p.R158G、p.R158H、p.R158L、p.R158P、p.R174fs、p.R175fs、p.R175H、p.R175L、p.R181C、p.R181H、p.R181P、p.R196*、p.R196P、p.R209*、p.R209fs、p.R213*、p.R213G、p.R213L、p.R213Q、p.R248G、p.R248L、p.R248Q、p.R248W、p.R249fs、p.R249G、p.R249M、p.R249S、p.R249T、p.R263S、p.R267fs、p.R267L、p.R267P、p.R267Q、p.R267W、p.R273C、p.R273H、p.R273L、p.R280fs、p.R280G、p.R280K、p.R280R、p.R280S、p.R280T、p.R282G、p.R282Q、p.R282W、p.R283C、p.R283del、p.R283H、p.R283P、p.R290C、p.R290fs、p.R290H、p.R306*、p.R306fs、p.R335fs、p.R337C、p.R337L、p.R342*、p.R342fs、p.R379fs、p.S106R、p.S127C、p.S127F、p.S127P、p.S149fs、p.S166*、p.S183*、p.S185S、p.S215C、p.S215del、p.S215G、p.S215I、p.S215N、p.S215R、p.S240R、p.S241A、p.S241C、p.S241F、p.S241Y、p.S261T、p.S313fs、p.S315fs、p.S33fs、p.S37fs、p.S90F、p.S90fs、p.S94*、p.S95F、p.S99fs、p.T118fs、p.T125M、p.T125P、p.T125T、p.T140fs、p.T155N、p.T155P、p.T211A、p.T211I、p.T256fs、p.T284fs、p.V122fs、p.V143A、p.V143M、p.V147D、p.V147G、p.V157F、p.V157fs、p.V173L、p.V173M、p.V197fs、p.V197L、p.V203L、p.V216L、p.V216M、p.V217G、p.V218del、p.V218L、p.V272E、p.V272fs、p.V272L、p.V272M、p.V274C、p.V274D、p.V274F、p.V31I、p.V73fs、p.W146*、p.W53*、p.W91*、p.W91fs、p.Y103fs、p.Y107*、p.Y107fs、p.Y126*、p.Y126C、p.Y163C、p.Y163H、p.Y205C、p.Y205F、p.Y205fs、p.Y205H、p.Y220C、p.Y220D、p.Y220fs、p.Y234C、p.Y234D、p.Y234fs、p.Y234N、p.Y236*、p.Y236C, p.Y236N, p.Y236S, p.Y327fs. .

[0015] *Indicates mutation to a stop codon.

[0016] In another preferred embodiment, the TDG inhibitor is an inhibitor against human TDG (GENE ID: 6996).

[0017] In another preferred embodiment, the NCBI accession number of the human TDG mRNA sequence is NM_003211.6.

[0018] In another preferred embodiment, the NCBI accession number of the human TDG protein sequence is NP_003202.3.

[0019] In another preferred embodiment, the TDG inhibitor is selected from the following group: small molecule inhibitors, polypeptide drugs, sgRNA compositions targeting human TDG used in CRISPR-Cas9 gene knockout technology, siRNA or a combination thereof targeting human TDG sequences used in RNA interference technology, shRNA or a combination thereof targeting human TDG sequences used in RNA interference technology.

[0020] In another preferred embodiment, the TDG inhibitor is a small molecule inhibitor described in US20160199381A1, US2022213070A1 and WO2022047288A1.

[0021] In another preferred embodiment, the TDG inhibitor is an sgRNA targeting a human TDG sequence used in CRISPR-Cas9 gene knockout technology, and the sgRNA is selected from the following group (each nucleotide sequence is 5'-3'):

[0022]

[0023]

[0024] In another preferred embodiment, the TDG inhibitor is an siRNA targeting a human TDG sequence used in RNA interference technology, and the siRNA is selected from the following group (each nucleotide sequence is 5'-3'):

[0025]

[0026]

[0027] In the above nucleic acid sequences, U nucleotides and T nucleotides are interchangeable.

[0028] In another preferred embodiment, the TDG inhibitor is a shRNA targeting a human TDG sequence used in RNA interference technology, and the shRNA is selected from the following group (each nucleotide sequence is 5'-3'):

[0029]

[0030]

[0031]

[0032]

[0033] In another preferred embodiment, the pharmaceutical composition further comprises a second therapeutically active ingredient, and the second therapeutically active ingredient is an immune checkpoint inhibitor.

[0034] In another preferred embodiment, the immune checkpoint inhibitor is PD-1 monoclonal antibody.

[0035] In another preferred embodiment, the immune checkpoint inhibitor is CTLA-4 monoclonal antibody.

[0036] In a second aspect of the present invention, a drug combination is provided, the combination comprising:

[0037] (1) a first therapeutically active ingredient, wherein the first therapeutically active ingredient is a TDG inhibitor;

[0038] (2) A second therapeutically active ingredient, wherein the second therapeutically active ingredient is an immune checkpoint inhibitor.

[0039] In the third aspect of the present invention, a sgRNA for a human TDG sequence used in a CRISPR-Cas9 gene knockout technique is provided, wherein the sgRNA is selected from the following group (each nucleotide sequence is 5'-3'):

[0040]

[0041] In the fourth aspect of the present invention, a siRNA targeting a human TDG sequence is provided, wherein the siRNA has a sequence selected from the following group (each nucleotide sequence is 5'-3'):

[0042]

[0043]

[0044]

[0045] In the above nucleic acid sequences, U nucleotides and T nucleotides are interchangeable.

[0046] In another preferred embodiment, the present invention provides a nanoliposome composition containing the siRNA as a therapeutically active ingredient.

[0047] In another preferred embodiment, the nanoliposome composition comprises: a carrier, the siRNA, a pharmaceutical adjuvant, or a combination thereof.

[0048] In another preferred embodiment, the carrier comprises: one or more cationic lipid compounds, auxiliary lipids, structural lipids, polymer-conjugated lipids, or a combination thereof.

[0049] In another preferred embodiment, the molar ratio of the cationic lipid compound to the lipid enhancer is 0.5:1-15:1.

[0050] In another preferred embodiment, the molar ratio of the cationic lipid compound to the structural lipid is 0.5:1-5:1.

[0051] In another preferred embodiment, the molar ratio of the cationic lipid compound to the polymer-conjugated lipid is 10:1-250:1.

[0052] In another preferred embodiment, the nanoliposome composition is lipid nanoparticles, and the average size of the lipid nanoparticles is 30-200 nm.

[0053] In another preferred embodiment, the polydispersity index of the lipid nanoparticle preparation is ≤0.3.

[0054] In another preferred embodiment, the pharmaceutical adjuvant includes: a diluent, a stabilizer, a preservative or a lyoprotectant, or a combination thereof.

[0055] In the fifth aspect of the present invention, a shRNA targeting a human TDG sequence is provided, wherein the shRNA has a sequence selected from the following group (each nucleotide sequence is 5'-3'):

[0056]

[0057]

[0058]

[0059]

[0060] In a sixth aspect of the present invention, a sgRNA sequence for constructing a Trp53 knockout mouse model is provided, wherein the sequence (5'-3') comprises:

[0061] 95mTrp53_sg-1:AGTGAAGCCCTCCGAGTGTC;

[0062] 96mTrp53_sg-2:GACCCTGTCACCGAGACCCC.

[0063] In the seventh aspect of the present invention, a sgRNA sequence for constructing a Tdg knockout mouse model is provided, wherein the sequence comprises:

[0064] 97mTdg_sg-1:TTCTAGATTGGCATTAACCC;

[0065] 98mTdg_sg-2:CCGGGAAGGAGGGCGCATCC.

[0066] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 To study the development of TP53 gene deletion-related and non-related tumor cells in Tdg gene knockout mice; a: In Kras G12D Effect of knockout of Tdg (abbreviated as KT, the same below) on tumor burden in a mutation-driven mouse lung adenocarcinoma model (abbreviated as K, the same below); b: In the Kras G12D In the mouse lung cancer model with mutation and Trp53 knockout (abbreviated as KP, the same below), the effect of further knockout of Tdg (abbreviated as KPT, the same below) on tumor burden.

[0068] Figure 2 This is the KEGG pathway enrichment analysis of differentially expressed genes in KPT cells, where the control group was KP cells.

[0069] Figure 3 The results of immunofluorescence detection of double-stranded RNA in the cytoplasm of KP and KPT cells, where the control group was KP cells treated with 5Aza.

[0070] Figure 4 Single-cell sequencing results of KP Tdg KO and KP cell subcutaneous tumor models.

[0071] Figure 5 The changes in tumor volume (a) and mouse body weight (b) after KP and KPT mice were treated with PD1 monoclonal antibody + CTLA4 monoclonal antibody, respectively.

[0072] Figure 6:a: Changes in cell proliferation after TDG knockout in the TP53-deficient human lung adenocarcinoma cell line NCI-H1299; b: Changes in cell proliferation after wild-type TP53 was restored in TDG-knockout NCI-H1299 cells; Among them, TDG KO-1 and TDGKO-2 are two monoclonal clones of TDG knockout.

[0073] Figure 7 The figure shows the changes in subcutaneous tumorigenesis in vivo after TDG was knocked out in the TP53-deficient human lung adenocarcinoma cell line NCI-H1299; among them, TDG KO-1 and TDG KO-2 are two monoclonal clones of TDG knockout.

[0074] Figure 8 The figure shows the changes in cell proliferation after TDG knockout in TP53 mutant SK-MEL-28 (a) and TP53 wild-type A375 (b); among them, TDG KO-1 and TDG KO-2 are two monoclonal clones of TDG knockout.

[0075] Fig. 9 The B16 model was developed in fully immunized mice. The results showed that double knockout of Tdg and Trp53 significantly inhibited the subcutaneous tumorigenesis of B16, while single knockout of Tdg or Trp53 had no effect. Further knockout of Mavs, a key gene for innate immune activation, restored the subcutaneous tumorigenesis ability.

[0076] Fig.10 Heat map analysis of differentially expressed genes in B16 cells is shown, and knockout of Mavs abolished the effects of Tdg and Trp53 double knockout on innate immunity-related genes.

[0077] Fig.11 The results show the effect of 21 siRNAs targeting different sites of human TDG on knocking down TDG in A549 cells.

[0078] Fig.12 The effect of TDG knockdown on the proliferation of TP53 mutant and wild-type tumor cells is shown. DETAILED DESCRIPTION

[0079] After long-term and in-depth research, the inventor unexpectedly found that downregulating TDG activity or expression can effectively improve the condition of tumors related to TP53 gene mutations, and can further inhibit tumor growth when used in combination with immune checkpoint inhibitors. Based on the above findings, the inventor completed the present invention.

[0080] Treatment of TP53 gene mutation tumors by downregulating TDG levels

[0081] The inventors have discovered that downregulating TDG activity or expression can effectively improve the condition of tumors associated with TP53 gene mutations. Based on this, the inventors have developed a drug for TP53 gene mutation tumors, which may include: a TDG inhibitor and pharmaceutically acceptable auxiliary ingredients thereof.

[0082] In the present invention, there is no particular limitation on the method for down-regulating the activity or expression of TDG, and conventional methods such as small molecule inhibitors or pharmaceutically acceptable salts thereof, polypeptide drugs, etc. can be used. Preferably, the down-regulation method comprises administering to the desired subject an effective amount of a therapeutic component selected from the group consisting of: 6-keto-prostaglandin F1a, prostaglandin A1, E6 berbamine, juglone, GW-5074, rottlerin, cefixime, idarubicin, doxorubicin, menamin, Congo red, sodium ferric gluconate, ferrous sulfate, aurothioglucose, Evans blue, closantel, cinchonine sulfate, hexadimethoxam bromide, indigo disulfonate, protamine chloride, or any combination thereof.

[0083] The method may also include administering other methods that can be used to downregulate TDG activity or expression, such as administering small molecule inhibitors described in US2022213070A1 and WO2022047288A1.

[0084] In other preferred embodiments of the present invention, other techniques known in the art such as CRIPSR-Cas9 gene knockout technology, or RNA therapeutic active ingredients such as siRNA may also be used. In a preferred embodiment of the present invention, the TDG inhibitor is an sgRNA for human TDG sequence used in CRIPSR-Cas9 gene knockout technology, which can be used in vitro to perform gene editing on tumor cells using CRIPSR-Cas9 gene knockout technology.

[0085] Furthermore, the TDG inhibitor is sgRNA, and its nucleotide sequence is (5'-3'):

[0086]

[0087]

[0088] Furthermore, the TDG inhibitor is at least one of the siRNAs targeting the human TDG sequence used in RNA interference technology. When the TDG inhibitor is siRNA, it can be delivered to tumor tissues in vivo using drug delivery systems known in the art, such as nanoliposomes.

[0089] Furthermore, the TDG inhibitor is a siRNA, and its nucleotide sequence is (5'-3'):

[0090]

[0091]

[0092] Furthermore, the TDG inhibitor is at least one of the shRNAs targeting the human TDG sequence used in RNA interference technology. When the TDG inhibitor is shRNA, it can be delivered to tumor tissues in vivo using drug delivery systems known in the art, such as nanoliposomes.

[0093] Furthermore, the TDG inhibitor is a shRNA, and its nucleotide sequence is (5'-3'):

[0094]

[0095]

[0096]

[0097]

[0098] When prepared into nanoliposomes, in a preferred embodiment, the nanoliposome composition comprises: a carrier, a carried drug, a pharmaceutical adjuvant, or a combination thereof.

[0099] Wherein, the auxiliary lipid may include: phosphatidylcholine, phosphatidylethanolamine, sphingomyelin (SM), sterols and their derivatives, ceramides, charged lipids, one or more combinations thereof; phosphatidylcholine as a preferred embodiment includes: DSPC, DPPC, DMPC, DOPC, POPC; phosphatidylethanolamine as a preferred embodiment includes DOPE; sterol as a preferred embodiment includes cholesterol; charged lipids as an embodiment include DOTAP, DOTMA, 18PA; this is not exhaustive, as long as the composition of the cationic lipid compound using the structure of the present invention is within the protection scope of the present invention, all are inspired by the present invention. This is not exhaustive, the choice of auxiliary lipid is not limited, as long as the cationic lipid compound using the structure of the present invention is within the protection scope of the present invention, all are inspired by the present invention.

[0100] Charged lipids refer to a class of lipid compounds that exist in the form of positive or negative charges; their charge is independent of pH within the physiological range, such as pH 3 to 9, and is not affected by pH. Charged lipids can be synthetic or naturally derived. Examples of charged lipids include, but are not limited to, DOTAP, DOTMA, and 18PA.

[0101] The siRNA of the present invention may also contain one or more functional nucleotide analogs, examples of which include pseudouridine, 1-methyl-pseudouridine or 5-methylcytosine, etc. The examples here are not exhaustive, and any modified mRNA or its derivatives can be applied to the present invention.

[0102] Small molecule compounds can be active ingredients in therapeutic or preventive agents, such as anti-tumor drugs, anti-infective drugs, local anesthetics, antidepressants, anticonvulsants, antibiotics / antibacterial agents, antifungal drugs, antiparasitic drugs, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, anti-glaucoma agents, anesthetics, or imaging agents, etc., which are not exhaustive.

[0103] Polypeptides are compounds formed by α-amino acids linked together by peptide bonds and are intermediate products of protein hydrolysis.

[0104] Protein is a substance with a certain spatial structure formed by the coiling and folding of polypeptide chains composed of amino acids in a "dehydration condensation" manner; protein can be interferon, protein hormone, cytokine, chemokine or enzyme, etc.

[0105] The diluent is any pharmaceutically acceptable water-soluble excipient known to those skilled in the art, including: amino acids, monosaccharides, disaccharides, trisaccharides, tetrasaccharides, pentasaccharides, other oligosaccharides, mannitol, dextran, sodium chloride, sorbitol, polyethylene glycol, phosphates, or derivatives thereof.

[0106] The stabilizer can be any pharmaceutically acceptable excipient known to those skilled in the art: Tween-80, sodium lauryl sulfate, sodium oleate, mannitol, mannose or sodium alginate, etc.

[0107] The preservative can be any pharmaceutically acceptable preservative known to those skilled in the art, such as thimerosal.

[0108] The lyoprotectant can be any pharmaceutically acceptable lyoprotectant known to those skilled in the art, such as glucose, mannitol, sucrose, lactose, trehalose, maltose, and the like.

[0109] The TDG inhibitor can inhibit the expression of TDG protein and activate the innate immune system of tumor patients. In another preferred embodiment of the present invention, the TDG inhibitor can be used in combination with immune checkpoint inhibitors to obtain better efficacy, including the combination of PD-1 antibody and CTLA-4 antibody.

[0110] Compared with the prior art, the present invention has the following beneficial effects:

[0111] The TDG inhibitor used in the present invention can effectively inhibit the expression of human TDG protein and achieve the effect of killing TP53 mutant tumors by activating the innate immune system of tumor patients.

[0112] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually based on conventional conditions or the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0113] Example 1

[0114] Breeding to obtain Kras G12D Mutation, Tdg conditional knockout mouse; Kras G12D Mutations, Trp53 conditional knockout mice, and Kras G12D Mutation, Trp53 and Tdg conditional knockout mice. For detailed experimental procedures, please refer to DuPage et al. (2009) "Conditional mouse lung cancer models using adenoviral or lentiviral delivery of Cre recombinase". The sgRNA sequence used to knock out mouse Trp53 is: mTrp53_sg-1: AGTGAAGCCTCCGAGTGTC; mTrp53_sg-2: GACCCTGTCACCGAGACCCC. The sgRNA sequence used to knock out mouse Tdg is: mTdg_sg-1: TTCTAGATTGGCATTAACCC; mTdg_sg-2: CCGGGAAGG AGGGCGCATCC. Using the Kras obtained by breeding G12D Mutation; Tdg conditional knockout mice, and Kras G12D Mutation; Trp53 and Tdg conditional knockout mice were induced to develop tumors by intranasal inhalation of Ad-Cre for 3-4 weeks, and the lung tissues of the mice were collected, perfused and fixed, and then embedded in paraffin, sectioned and stained with H&E.

[0115] After 3-4 weeks of tumor induction by intranasal inhalation of Ad-Cre in mice, Kras G12D Mutation, Trp53 knockout, and Kras G12D Mutation, Trp53 and Tdg knockout of tumor nodules in the lung tissue of mice, and two groups of specific cells (KP cells and KPT cells) were cultured separately for the construction of cDNA library for RNA-seq.

[0116] The results showed that Trp53 knockout (mimicking TP53 gene-deficient tumor cells) Kras G12D Further knockout of Tdg inhibited tumor growth in a mutation-driven mouse lung adenocarcinoma model ( Figure 1 b). As a control, in the Trp53 non-knockout mouse lung adenocarcinoma model, knockout of Tdg alone did not affect tumor growth ( Figure 1 a). The above results further confirmed that knocking out Tdg only had an inhibitory effect on the Trp53-deficient mouse lung adenocarcinoma model. RNA-seq results showed that a large number of innate immune activation pathways were enriched after double knockout of Trp53 and Tdg in the mouse lung adenocarcinoma model ( Figure 2 ), proving that after gene knockout, tumor cells simulated the viral infection state and activated innate immune-related signaling pathways.

[0117] Example 2

[0118] Immunofluorescence assay to detect double-stranded RNA (abbreviated as dsRNA, the same below). After fixation, permeabilization, and blocking of adherent KP and KPT cells, J2 antibody (antibody that specifically recognizes dsRNA, catalog number: SCICONS#10010200), fluorescent secondary antibody Cy TM 3 (Cat. No.: Jackson #115-165-146) and DAPI were treated and then photographed under a fluorescence microscope.

[0119] Immunofluorescence assays revealed that the level of dsRNA in the cytoplasm of KPT cells (which mimic TP53-deficient lung cancer cells inhibited by TDG) was increased compared to that of KP cells. Figure 3 ). KP cells treated with 0.5 μM 5-Aza-2'-deoxycytidine (5Aza) for 5 days were added to the group as the positive control of the experiment. It has been reported in the literature that 5Aza can stimulate cells to produce dsRNA. After RNase III was added to KPT cells, the characteristic fluorescence signal of dsRNA disappeared, indicating that dsRNA was degraded by RNase III. This group was used as the negative control of the experiment ( Figure 3 ).

[0120] Example 3

[0121] Single-cell transcriptome sequencing. KP and KPT cells were respectively grown in subepithelial tumors of two groups of fully immune C57 mice. Tumors in the logarithmic growth phase (two weeks after inoculation) were taken to make cell suspensions. Immune cells infiltrating in the tumors were separated by gradient centrifugation and sent for single-cell transcriptome sequencing. Immune cells were grouped according to different immune cell markers, and the changes in the proportions of various infiltrating immune cell subsets in the KP and KPT models were compared.

[0122] The results of single-cell transcriptome sequencing showed that in the KP model (lung adenocarcinoma model with both Kras G12D mutation and Trp53 knockout mouse model), after further knockout of Tdg (KP Tdg KO model, or KPT model), the proportion of T cells and NK cells in immune-infiltrating lymphocytes in subcutaneous tumors increased significantly compared with the KP model ( Figure 4 ).

[0123] Example 4

[0124] Effect of PD1 monoclonal antibody + CTLA4 monoclonal antibody combination on subcutaneous tumor formation ability of KP and KPT cells. KP and KPT cells were inoculated into the right thigh of fully immune C57 mice, and medication (PD1 monoclonal antibody + CTLA4 monoclonal antibody, 10+10mpk) was started 6 days later. The control group was PBS. The drug was administered twice a week for a total of 5 times. The tumor size and mouse weight were recorded 3 times a week. The tumor in the control group was close to 2000mm 3 The mice were killed at this time, and the experiment was terminated.

[0125] Tdg knockout causes activation of the innate immune system in mice, significantly increasing the proportion of T cells and NK cells in immune-infiltrating lymphocytes in subcutaneous tumors, and can be combined with PD1 monoclonal antibody + CTLA4 monoclonal antibody to further inhibit tumor growth ( Figure 5 ).

[0126] Example 5

[0127] Construction of human lung cancer cell line NCI-H1299 with TDG gene knockout. Construction of human lung cancer cell line NCI-H1299 with TDG gene knockout used the pSECC-mediated CRISPR-Cas9 system gene editing system. In this embodiment, the construction of pSECC plasmid and specific experimental methods refer to Sanchez-Rivera et al. (2014) "Rapid modelling of cooperating genetic events in cancer through somatic genome editing". For detailed operations, please refer to protocol "LentiCRISPRv2 and lentiGuide-Puro: lentiviral CRISPR / Cas9 and single guide RNA". The sgRNA used to knock out human TDG is: sg-1~10. NCI-H1299 cell TP53 overexpression is achieved by integrating the TP53 gene into NCI-H1299 cells by Lentivirus. The plasmid used is pCDH-CMV-3xFLAG-TDG-EF1a-GFP, and GFP-positive cells are sorted by flow cytometry. The cell proliferation experiment used CCK8 kit to detect cell viability. The mouse subcutaneous tumor formation experiment used BALB / c nude mice. The tumor size was recorded from the 6th day after cell inoculation. The tumor size of the control group was 2000mm 3 The experiment was terminated by killing the mice at about 1:00 p.m.

[0128] In the human lung adenocarcinoma cell line NCI-H1299 with TP53 gene deletion, the cell proliferation ability was observed after TDG was knocked out using the CRISPR-Cas9 system ( Figure 6 a) and in vivo subcutaneous tumor formation ability were inhibited ( Figure 7 ). In NCI-H1299 cells with TDG gene knockout, complementation of wild-type TP53 can restore cell proliferation ability ( Figure 6 b). TDG knockout only inhibited the proliferation of NCI-H1299 cells lacking TP53 gene.

[0129] Example 6

[0130] The TDG gene knockout human melanoma cell lines SK-MEL-28 and A375 were constructed. The experimental method was the same as that in Example 5.

[0131] The results showed that in the skin melanoma cell line SK-MEL-28 with a TP53 missense mutation (p.L145R), knocking out TDG using the CRISPR-Cas9 system could inhibit tumor cell proliferation ( Figure 8a). TP53 wild-type A375 cells used as controls are insensitive to TDG knockout ( Figure 8 b).

[0132] Example 7

[0133] Effects of Tdg gene knockout, Trp53 gene knockout, Tdg / Trp53 double gene knockout, and Tdg / Trp53 / Mavs triple gene knockout on the subcutaneous tumorigenicity of mouse melanoma cell line B16. The method for constructing the gene knockout mouse melanoma cell line B16 is the same as in Example 5. C57 fully immune mice were used in the mouse subcutaneous tumorigenicity experiment. The tumor size was recorded from the 6th day after cell inoculation. The tumor size of the control group was close to 3000mm 3 The mice were killed at the end of the experiment.

[0134] The results showed that in the mouse melanoma cell line B16, knocking out Tdg or Trp53 alone using the CRISPR-Cas9 system had little effect on subcutaneous tumorigenesis, while knocking out both Tdg and Trp53 greatly reduced its tumorigenicity ( Fig. 9 ), this model simulates the inhibition of tumor cell proliferation by inhibiting TDG under the condition of TP53 gene deletion in melanoma cells. After double knockout of Tdg and Trp53 genes, further knockout of Mavs, a key node gene for innate immune antiviral signal transduction, can completely restore the subcutaneous tumorigenic ability of B16 cells ( Fig. 9 ). Analysis of differentially expressed genes in RNAseq results of B16 cells with different gene knockouts showed that simultaneous knockout of Tdg and Trp53 had a significant effect on the expression of genes related to innate immunity. After further knockout of Mavs, the changes in gene expression were partially reversed ( Fig.10 ). The above results further prove that the mechanism of Tdg knockout in suppressing tumors is through activating innate immunity.

[0135] Example 8

[0136] TDG can be knocked down in A549 cells, a human non-small cell lung cancer cell line, using 21 siRNAs targeting different sites of human TDG. A549 cells were transfected with different siRNAs after attachment, and samples were collected 72 hours later. Western blot was used to verify that siRNAs would reduce TDG protein levels to varying degrees (e.g. Fig.11). The siRNA transfection reagent used was Lipofectamine RNAiMAX kit, catalog number: Invitrogen #13778, and the operation was performed according to the instructions. The TDG siRNA used was si-1 to 21. NTC was a negative control, and the sequence was: NTC: UUUGUACUACACAAAAGUACUG. The TDG monoclonal antibody catalog number used in the Western blot experiment was: Abcam #ab154192, the secondary antibody catalog number: Cell signaling #7074, and the GAPDH monoclonal antibody catalog number: Cell Signaling #2118.

[0137] Example 9

[0138] Si-2 and si-3, which have higher TDG knockdown efficiency, can inhibit the proliferation of various tumor cells in vitro ( Fig.12 ). The tumor cell siRNA transfection experiment used the Lipofectamine RNAiMAX kit, catalog number: Invitrogen #13778, and followed the instructions. Tumor cells were transfected with siRNA NTC (negative control), si-2, and si-3, respectively, and then cultured for 72 hours. After 72 hours, NTC, si-2, and si-3 were transfected again, and cell viability was detected after another 72 hours of culture. The cell viability was detected using the CellTiter Glo kit, catalog number: Promega #G7570, and followed the instructions. Each experiment was repeated 6 times, and the cell viability of NTC was used as the control (100%) to calculate the relative cell viability after siRNA treatment (the average of the two siRNAs). The results are shown in the figure. Fig.12 as shown in .

[0139] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A use of a TDG inhibitor, characterized in that: For preparing a pharmaceutical composition for treating TP53 gene mutation-related tumors; The pharmaceutical composition comprises: a therapeutically effective amount of a TDG inhibitor and a pharmaceutically acceptable carrier auxiliary component thereof.

2. The use according to claim 1, characterized in that The TP53 gene mutation is selected from the following group: missense mutation, gene deletion, frameshift mutation, splice site mutation, and truncation mutation.

3. The use according to claim 1, characterized in that The TDG inhibitor is an inhibitor against human TDG (GENE ID: 6996).

4. The use according to claim 1, characterized in that The TDG inhibitor is selected from the following group: small molecule inhibitors, polypeptide drugs, sgRNA compositions targeting human TDG used in CRISPR-Cas9 gene knockout technology, siRNA or a combination thereof targeting human TDG sequences used in RNA interference technology, and shRNA or a combination thereof targeting human TDG sequences used in RNA interference technology.

5. The use according to claim 1, characterized in that The TDG inhibitor is an sgRNA targeting a human TDG sequence used in CRISPR-Cas9 gene knockout technology, and the sgRNA is selected from the following group (each nucleotide sequence is 5'-3'):

6. The use according to claim 1, characterized in that The TDG inhibitor is an siRNA targeting the human TDG sequence used in RNA interference technology, and the siRNA is selected from the following group (each nucleotide sequence is 5'-3'): In the above nucleic acid sequences, U nucleotides and T nucleotides are interchangeable.

7. The use according to claim 1, characterized in that The TDG inhibitor is a shRNA targeting the human TDG sequence used in RNA interference technology, and the shRNA is selected from the following group (each nucleotide sequence is 5'-3'):

8. The use according to claim 1, characterized in that The pharmaceutical composition also includes a second therapeutically active ingredient, and the second therapeutically active ingredient is an immune checkpoint inhibitor.

9. A drug combination, characterized in that The combinations include: (1) a first therapeutically active ingredient, wherein the first therapeutically active ingredient is a TDG inhibitor; (2) A second therapeutically active ingredient, wherein the second therapeutically active ingredient is an immune checkpoint inhibitor.

10. An sgRNA targeting a human TDG sequence used in CRISPR-Cas9 gene knockout technology, characterized in that: The sgRNA is selected from the following group (each nucleotide sequence is 5'-3'):

11. A siRNA targeting a human TDG sequence, characterized in that: The siRNA has a sequence selected from the following group (each nucleotide sequence is 5'-3'): In the above nucleic acid sequences, U nucleotides and T nucleotides are interchangeable.

12. A shRNA targeting a human TDG sequence, characterized in that: The shRNA has a sequence selected from the following group (each nucleotide sequence is 5'-3'):

13. A sgRNA sequence for constructing a Trp53 knockout mouse model, characterized in that: The sequence (5'-3') includes: 95 mTrp53_sg-1:AGTGAAGCCCTCCGAGTGTC; 96 mTrp53_sg-2:GACCCTGTCACCGAGACCCC.

14. A sgRNA sequence for constructing a Tdg knockout mouse model, characterized in that: The sequence comprises: 97 mTdg_sg-1:TTCTAGATTGGCATTAACCC; 98 mTdg_sg-2:CCGGGAAGGAGGGCGCATCC.

Images