GbUBC23 gene and application thereof in regulating and controlling drought stress resistance of island cotton

Abstract

The invention provides a GbUBC23 gene and application thereof in regulating and controlling drought stress resistance of island cotton, and belongs to the technical field of gene engineering. The core nucleotide sequence of the gossypium barbadense GbUBC23 gene is as shown in SEQ ID NO: 1. Through PEG simulated drought and drought stress phenotype observation, it is found that silence of the GbUBC23 gene can reduce the drought resistance of a complex plant, and therefore it is deduced that the GbUBC23 gene is a positive regulatory factor for coding drought reaction, and the drought resistance of island cotton can be reduced by inhibiting expression of the GbUBC23 gene. The method is of great significance in exploring a new mechanism of drought resistance of the sea island cotton and accelerating the breeding process of the drought-resistant variety of the sea island cotton.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and in particular relates to a GbUBC23 gene and application thereof in regulating drought stress resistance of sea island cotton. Background Art

[0002] Plants are subject to several abiotic stresses, such as drought, excessive salinity, and low temperature. These abiotic stresses disturb the water balance of cells, which in turn affects plant growth and ultimately crop yield. The presence of abiotic stresses causes many physiological and biochemical responses in plants. These responses include promoting stomatal closure, altering cell division and elongation, changing cell wall elasticity, inhibiting photosynthesis, and activating respiration, thus affecting plant growth and development.

[0003] Cotton is an important strategic material related to the national economy and people's livelihood, and it is also the second largest crop after grain. It involves two major industries, agriculture and textile industry, and is a necessity for the people. Sea Island cotton is a type of cotton with long, thin and strong fibers, making it a top-quality textile fiber. A series of abiotic stress factors such as drought, high salt and low temperature pose a serious threat to the growth, development and yield of Sea Island cotton. Ubiquitination is one of the most common post-translational modifications of proteins and plays a vital role in the selective protein degradation process of plants. Ubiquitin conjugating enzymes are key enzymes in the ubiquitination process and play a key role in regulating plant growth and development and abiotic stress. However, the role of ubiquitin conjugating enzymes in cotton's response to abiotic stress is not fully understood. Therefore, in-depth research on the function and mechanism of ubiquitin conjugating enzymes is critical for studying the stress resistance of Sea Island cotton. This is of great significance for exploring new mechanisms of drought resistance in Sea Island cotton and accelerating the breeding process of drought-resistant varieties of Sea Island cotton. Summary of the invention

[0004] The present invention provides a GbUBC23 gene and its application in regulating drought stress resistance of sea island cotton. Through PEG simulation of drought and drought stress phenotype observation, it is found that silencing the GbUBC23 gene will reduce the drought resistance of the complex plant, thereby inferring that the GbUBC23 gene is a positive regulatory factor encoding drought response, and inhibiting its expression can reduce the drought resistance of sea island cotton. This is of great significance for exploring new mechanisms of drought resistance of sea island cotton and accelerating the breeding process of drought-resistant sea island cotton varieties.

[0005] In order to achieve the above object, the present invention provides a sea island cotton GbUBC23 gene, the core nucleotide sequence of the sea island cotton GbUBC23 gene is shown in SEQ ID NO:1.

[0006] The present invention provides a 3'UTR region containing the core nucleotide sequence of the GbUBC23 gene of the sea island cotton described in the above technical solution, and the nucleotide sequence of the 3'UTR region is shown in SEQ ID NO:2.

[0007] The present invention provides an application of the GbUBC23 gene of Sea Island cotton according to the above technical scheme in positively regulating drought stress response of Sea Island cotton. The core nucleotide sequence of the GbUBC23 gene of Sea Island cotton is shown in SEQ ID NO:1.

[0008] The present invention provides a method for preparing drought-intolerant Sea Island cotton, wherein the core nucleotide sequence of the Sea Island cotton GbUBC23 gene in the 3'UTR region described in the above technical solution is silenced to obtain drought-intolerant Sea Island cotton;

[0009] The nucleotide sequence of the 3'UTR region is shown in SEQ ID NO:2, and the core nucleotide sequence of the GbUBC23 gene of Gossypium barbadense is shown in SEQ ID NO:1.

[0010] The present invention provides a method for preparing a drought-intolerant sea island cotton complex plant, comprising the following steps:

[0011] Using the pTRV2 viral silencing vector, the 3'UTR region containing the core nucleotide sequence of the GbUBC23 gene of the sea island cotton described in the above technical solution was connected to the pTRV2 viral silencing vector by homologous recombination, and then transferred into Agrobacterium GV3101 by freeze-thaw method to obtain GbUBC23-pTRV2;

[0012] Agrobacterium cultures of pTRV1 and GbUBC23-pTRV2 were mixed in a ratio of 1:1 and infiltrated into two intact cotyledons of cotton seedlings at the two-leaf one-heart stage using a needleless syringe to obtain drought-intolerant sea island cotton complex plants.

[0013] The present invention provides an application of a core nucleotide sequence of the GbUBC23 gene of the G. barbadense in the 3'UTR region of the above technical solution in silencing the G. barbadense in the preparation of drought-intolerant G. barbadense, wherein the nucleotide sequence of the 3'UTR region is shown in SEQ ID NO: 2, and the core nucleotide sequence of the GbUBC23 gene of the G. barbadense is shown in SEQ ID NO: 1.

[0014] The present invention provides a PCR method for extracting and amplifying the 3'UTR region containing the core nucleotide sequence of the GbUBC23 gene of the sea island cotton described in the above technical solution, comprising the following steps:

[0015] RNA was extracted from true leaves of sea island cotton and reverse transcribed into cDNA;

[0016] Using the cDNA of true leaves of sea island cotton as a template, PCR amplification was performed using cloning primers and LA-Taq polymerase; wherein:

[0017] PCR reaction system: template cDNA 1.0 μL, forward primer 1.0 μL, reverse primer 1.0 μL, 10×PCR buffer 5.0 μL, dNTPs 4.0 μL, LA-Taq polymerase 1 μL and ddH2O 36 μL, total volume 50 μL.

[0018] Preferably, the cloning primers used are:

[0019] GbUBC23-F: 5'-ATGGAAGTCCGACCCAATC-3',

[0020] GbUBC23-R: 5'-CTAGTAGGGATGAGCTAGCAGACC-3'.

[0021] Preferably, the PCR amplification procedure is:

[0022] Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s; extension at 72°C for 60 s; 35 PCR cycles, extension at 72°C for 10 min.

[0023] Compared with the prior art, the advantages and positive effects of the present invention are:

[0024] 1. The present invention provides a GbUBC23 gene of sea island cotton. The 3'UTR region of the GbUBC23 gene is connected to the pTRV2 virus silencing vector through homologous recombination, and then transferred into Agrobacterium GV3101 based on the freeze-thaw method to obtain GbUBC23-pTRV2. The Agrobacterium cultures of pTRV1 and GbUBC23-pTRV2 are further mixed in a ratio of 1:1, and infiltrated into two complete cotyledons of cotton seedlings with two leaves and one heart using a needle-free syringe, thereby obtaining a transgenic sea island cotton complex plant.

[0025] 2. The expression of GbUBC23 gene in true leaves was significantly lower than that in control plants by qPCR detection. The phenotypes of drought and drought stress simulated by PEG were observed, and it was found that silencing GbUBC23 would reduce the drought resistance of the complex plants, and there was a positive correlation. It can be inferred that the GbUBC23 gene is a positive regulatory factor encoding drought response, and inhibiting its expression will reduce the drought resistance of sea island cotton. This is of great significance for exploring new mechanisms of drought resistance in sea island cotton and accelerating the breeding process of drought-resistant sea island cotton varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 A schematic diagram of the expression level of the GbUBC23 gene provided in an embodiment of the present invention, wherein a: expression levels in different tissues; b: expression levels in different time periods under drought stress;

[0027] Figure 2The virus-induced silencing vector provided in the embodiment of the present invention is constructed, wherein, M: DL2000; a: GbUBC23-pTRV2 silencing gene amplification; b: 1-6: GbUBC23-pTRV2 silencing vector PCR detection;

[0028] Figure 3 PCR detection of Agrobacterium transformation of the GbUBC23-pTRV2 silencing vector provided in the embodiment of the present invention, wherein M: DL2000, 1-8: PCR detection of GbUBC23-pTRV2 Agrobacterium transformation;

[0029] Figure 4 Schematic diagram of the phenotype after injection of GbUBC23-pTRV2 (target gene), GbCLA-pTRV2 (positive control) and pTRV2 (negative control) provided in the embodiments of the present invention;

[0030] Figure 5 A schematic diagram of qPCR detection of GbUBC23-pTRV2 silencing cotton provided in an embodiment of the present invention;

[0031] Figure 6 This is a diagram of drought resistance detection of GbUBC23-pTRV2 silenced cotton provided in an embodiment of the present invention, wherein a: GbUBC23-pTRV2 silenced cotton and control cotton grow normally for 15 days, and phenotype observation after 1 week of drought stress; b: statistics of survival rate of GbUBC23-pTRV2 silenced cotton and control cotton; the experiment was repeated 3 times independently;

[0032] Figure 7 Schematic diagram of PEG stress of GbUBC23-pTRV2 silenced cotton and control cotton provided in the embodiments of the present invention;

[0033] Figure 8 Schematic diagram of the measurement of physiological indicators of GbUBC23-pTRV2 silenced cotton and control cotton before and after drought stress provided in the embodiments of the present invention, wherein a: measurement of H2O2 content; b: measurement of MDA content; c: measurement of Pro content; d: measurement of SOD content (*P<0.05, **P<0.01). DETAILED DESCRIPTION

[0034] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] Example 1 Bioinformatics analysis of GbUBC23

[0036] Firstly, the coding sequence of GbUBC23 and the 2000bp sequence of the upstream promoter were obtained using the cotton omics database (http: / / cotton.zju.edu.cn / ), and the molecular weight, isoelectric point, aliphatic index and hydrophilicity of the GbUBC23 protein were analyzed and predicted using an online analysis website (https: / / www.expasy.org / ).

[0037] The results showed that the GbUBC23 gene was 483 bp in length, with its core nucleotide sequence as shown in SEQ ID NO: 1, encoding 161 amino acids (amino acid sequence as shown in SEQ ID NO: 3), with a molecular weight of 17.65 kD, an isoelectric point of 5.65, and an aliphatic index of 73.75, indicating that it was a hydrophilic protein.

[0038] Example 2 Expression patterns in different tissues and under drought stress

[0039] Seeds of the sea island cotton variety Xinhai 61 (XH61) were sown in black soil, and when they grew to the 3-leaf stage, different tissues (roots, stems, leaves and cotyledons) were collected and stored in a -80°C refrigerator for later use. The remaining healthy 3-leaf stage cotton with consistent growth was transferred to hydroponics, and after 2 days of recovery, it was transferred to Hoagland's nutrient solution and treated with 15% (mass fraction) PEG 6000. Cotton leaves were collected at 0h, 2h, 4h, 6h, 12h and 24h after treatment, and the total RNA of different tissues of cotton and leaves treated with PEG 6000 stress was extracted using a plant total RNA extraction kit (Tiangen Reagent Company). The extracted total RNA of different tissues of cotton and leaves treated with PEG6000 stress were reverse transcribed to synthesize the first chain of cDNA, wherein the reverse transcription synthesis system is shown in Table 1.

[0040] Table 1 Reverse transcription system

[0041]

[0042] After mixing, centrifuge briefly, and then place it in a constant temperature water bath for incubation at 25°C for 5 min, followed by incubation at 42°C for 60 min, and finally at 70°C for 5 min to terminate the reaction. Store in a -80°C refrigerator for subsequent experiments.

[0043] Real-time fluorescence quantitative PCR

[0044] The TransStart TipGreen qPCR SuperMix (+DyeⅡ) kit ordered by Beijing Quanshijin Biotechnology Co., Ltd. was used to quantitatively analyze GbUBC23 in different tissues of cotton and leaves after PEG 6000 stress treatment. To ensure the credibility of the test results, the concentration of the extracted RNA was adjusted to 2 μg / μL before reverse transcription.

[0045] According to the CDS sequence of GbUBC23, the primer software DNAMAN was used to design and synthesize the fluorescent quantitative primers GbUBC23-qF: CAGCTGCCGCTTCATCTAAAC; GbUBC23-qR: CCGACACTCCAAGATCACCT. The amplification system is shown in Table 2.

[0046] Table 2 Fluorescence quantitative amplification system

[0047]

[0048] Adoption 2 -△△Ct The relative expression of the target gene was analyzed by the method, and three biological replicates were set.

[0049] The results showed that the GbUBC23 gene of G. barbadense was expressed in roots, stems, leaves and cotyledons, with the highest expression level in cotyledons ( Figure 1 a). After 24h of drought stress, the expression level of GbUBC23 gene in the leaves of G. barbata significantly increased ( Figure 1 b).

[0050] Example 3 Construction of virus-induced gene silencing vector for GbUBC23 gene

[0051] Gene silencing vector

[0052] Use Quanshijin -Basic Seamless Cloning and Assembly Kit was used to complete the vector construction. The following primers were designed in the 3'UTR region containing the core nucleotide sequence of the GbUBC23 gene of G. barbadense (nucleotide sequence as shown in SEQ ID NO: 2):

[0053] GbUBC23-pTRV2-F:

[0054] tgagtaaggttaccgaattcTTTTGGTGGAAAAGCGTATGAGA,

[0055] GbUBC23-pTRV2-R:

[0056] gcgtgagctcggtaccTCTACCATATCAATATCATGCT,

[0057] PCR amplification was performed using DNA from XH61 leaves as a template. The amplification system was as follows:

[0058]

[0059]

[0060] The PCR reaction program was: 94°C, 3 min; 94°C, 30 s, 58°C, 30 s, 72°C, 30 s, 34 cycles; 72°C, 10 min; 5 μl of PCR product was taken and detected by 1% agarose gel electrophoresis. The pTRV2 empty vector was double-digested and then mixed with the PCR product ( Figure 2 a, PCR product size is between 250bp-500bp (318bp in the database) for ligation, transformation to DH5α competent cells, bacterial solution PCR detection ( Figure 2 b, about 500 bp) and then sequenced and verified, and named the recombinant plasmid GbUBC23-pTRV2.

[0061] Example 4 GbUBC23 gene Agrobacterium transformation and cotton transformation

[0062] Preparation of Agrobacterium GV3101 competent cells

[0063] Activation of GV3101 bacterial solution: In a clean bench, use a sterilized inoculation loop to pick up a small amount of GV3101 bacterial solution and streak it continuously on a previously prepared LB solid culture medium plate containing rifampicin resistance. Then seal the plate and place it upside down in a constant temperature incubator at 28°C for about 2 days;

[0064] Pick a single colony and inoculate it into 5 ml of LB liquid medium supplemented with 50 mg / L rifampicin, and culture it overnight at 28°C in a shaker (speed 200 rpm);

[0065] Add 1 ml of the culture to 100 ml (two 50 ml bottles) of liquid LB and continue to culture on a shaker at 28°C until the OD600 is about 0.8-1;

[0066] Place the culture on ice and shake it to cool the culture rapidly. Keep it on ice for at least 15 minutes.

[0067] The bacterial suspension was divided into 80 ml centrifuge tubes, centrifuged at 4000 g for 5 min at 4°C, the supernatant was discarded, 50 ml of ice-cold 10% glycerol (ddH2O) was added to suspend the bacteria, and centrifuged at 4000 g for 5 min;

[0068] The supernatant was discarded, 25 ml of ice-cold 10% glycerol (ddH2O) was added to suspend the bacteria, and centrifuged at 4000 g for 5 min;

[0069] The supernatant was discarded, 10 ml of ice-cold 10% glycerol (ddH2O) was added to suspend the bacteria, and centrifuged at 4000 g for 5 min;

[0070] Discard the supernatant, resuspend the cells with 10% glycerol to a final volume of 2-3 ml, and dispense into 100 μL / tubes. Freeze in liquid nitrogen and store at -70°C.

[0071] Heat shock transformation of Agrobacterium GV3101 competent cells

[0072] Take out GV3101 Agrobacterium competent cells from the -80°C refrigerator and quickly insert them into an ice box to dissolve them.

[0073] Add the DNA sample and mix gently, then place on an ice box for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes.

[0074] Add 900 μL of YEB liquid medium without antibiotics, mix well, and culture at 28°C with shaking for 2-3 hours.

[0075] Collect the bacteria by centrifugation at 6000 rpm for one minute, retain about 100 liters of supernatant, gently blow to resuspend the bacteria, spread it on the LB plate containing rifampicin and kanamycin resistance, and invert it in a 28°C incubator for 2-3 days.

[0076] Agrobacterium culture PCR detection ( Figure 3 ) band size and E. coli culture PCR ( Figure 2 b) consistent, and then used for cotton transformation.

[0077] Cotton conversion

[0078] (1) Soak cotton seeds in water for 1 h and sow them in black soil (the volume ratio of black soil to vermiculite is 2:1), with 2 plants per pot, and culture them in a greenhouse (28°C, 16 h light / 8 h dark).

[0079] (2) When cotton has grown to the two-leaf and one-heart stage, take freshly cultured Agrobacterium colonies carrying recombinant plasmids of pTRV1 (helper virus silencing vector), GbUBC23-pTRV2 (target gene), GbCLA-pTRV2 (positive control) and pTRV2 (negative control), and inoculate them into 3 ml LB (kanamycin, 50 ug / ml; rifampicin, 50 ug / ml), respectively. After culturing at 28°C, 170 rpm for 16 h, add 1% of the accession amount into 50 ml LB (kanamycin, 100 ug / ml; rifampicin, 50 ug / ml), and culture at 28°C, 170 rpm for 12 h. When the OD600 of the bacterial solution is about 1.0, centrifuge at 4000 rpm for 10 minutes to collect the bacterial cells, and add an appropriate volume of resuspension solution (10 mM MgCl2, 10 mM MES and 200uM acetosyringone) were resuspended to a final concentration of 2.0, and the resuspension was placed at 28°C in the dark for 3h. The pTRV1 resuspension was mixed with the Agrobacterium resuspensions of the GbUBC23-pTRV2 and GbCLA-pTRV2 recombinant plasmids at a ratio of 1:1 (v / v) and used for inoculation.

[0080] (3) Using the leaf syringe infiltration method, first use the syringe needle to gently puncture the back of the cotyledon to create a microwound, and then use a syringe without the needle to inject the bacterial solution (pTRV1+pTRV2 (negative control vector); pTRV1+GbCLA-pTRV2 (positive control); pTRV1+GbUBC23-pTRV2 (target gene)) from the wound on the back.

[0081] Example 5 Identification of Silent Plants

[0082] After the mixed bacterial solution of pTRV1 (helper virus silencing vector) and GbUBC23-pTRV2 (target gene), GbCLA-pTRV2 (positive control) and pTRV2 (negative control) was injected into the leaves of sea island cotton seedlings, the leaves of sea island cotton injected with GbCLA-pTRV2 began to bleach after 7 days, indicating that the silencing of GbUBC23-pTRV2 (target gene) and pTRV2 (negative control) genes may also be successful. The silencing efficiency of the silencing injection was then identified.

[0083] like Figure 4 As shown, the leaves of the sea island cotton injected with the bacterial solution of GbCLA-pTRV2 (positive control) showed whitening, while the leaves of the sea island cotton injected with the bacterial solution of GbUBC23-pTRV2 (target gene) and pTRV2 (negative control) did not show whitening.

[0084] Three GbUBC23-pTRV2 transgenic cotton plants and pTRV2 control cotton plants were randomly selected, and the plant total RNA extraction kit (Tiangen Reagent Company) was used to extract RNA from the leaves of transgenic cotton plants. The extracted total RNA from the leaves was reverse transcribed to synthesize the first chain of cDNA, and the reverse transcription synthesis system is shown in Table 1. After mixing, it was briefly centrifuged and then placed in a constant temperature water bath for incubation at 25°C for 5 minutes, followed by incubation at 42°C for 60 minutes, and finally 70°C for 5 minutes to terminate the reaction. It was stored in a -80°C low-temperature refrigerator for subsequent experiments. The quantitative analysis of GbUBC23 in transgenic cotton leaves and control cotton leaves was performed using the TransStart TipGreen qPCR SuperMix (+DyeⅡ) kit ordered by Beijing Quanshijin Biotechnology Co., Ltd. To ensure the credibility of the test results, the extracted RNA concentration was adjusted to 1μg / μL before reverse transcription. The fluorescent quantitative primers GbUBC23-qF: TTGCAAACTCGGAACCAGGA; GbUBC23-qR: CGAATCTTGCAAGGGACCGA were used, and the amplification system was shown in Table 2. -△△Ct The relative expression of the target gene was analyzed by the method, and three biological replicates were set.

[0085] like Figure 5 As shown, the expression level of GbUBC23-pTRV2 transgenic cotton was significantly lower than that of pTRV2 control cotton, and the silencing efficiency was 55.1%, indicating that the GbUBC23 gene of sea island cotton was successfully silenced.

[0086] Example 6 Functional analysis of GbUBC23-silenced cotton after drought stress

[0087] GbUBC23-pTRV2 transgenic cotton and pTRV2 control cotton were used as subsequent experimental materials.

[0088] Drought resistance testing of transgenic cotton

[0089] GbUBC23-pTRV2 transgenic cotton plants and control cotton were planted in the same pot, and all cotton plants were regularly watered for 7 days. Watering was stopped for 7 days, and the phenotypes were observed and photographed. The experiment was repeated 3 times (30 replicates for each strain).

[0090] PEG treatment of transgenic cotton

[0091] After 15 days of normal growth, GbUBC23-pTRV2 transgenic cotton plants and control cotton were transferred to water containing 15% PEG and cultured for 1 day under simulated drought stress, and the phenotypes were observed and the survival rate was calculated. The experiment was repeated 3 times (15 replicates for each line).

[0092] like Figure 6As shown, GbUBC23-pTRV2 transgenic cotton and pTRV2 control cotton plants were subjected to drought for 7 days. The results showed that the degree of wilting of GbUBC23-pTRV2 transgenic cotton plants was higher than that of pTRV2 control cotton plants ( Figure 6 a); The survival rate of GbUBC23-pTRV2 transgenic cotton plants was 27.04%, which was significantly lower than that of the control cotton (83.33%). Figure 6 b).

[0093] like Figure 7 As shown, after PEG stress was applied to GbUBC23-pTRV2 transgenic cotton and pTRV2 control cotton plants for 1 day, it was found that the wilting degree of GbUBC23-pTRV2 transgenic cotton plants was also higher than that of pTRV2 control cotton plants.

[0094] Example 7 Analysis of the physiological mechanism of GbUBC23 under drought stress

[0095] The kit provided by Nanjing Jiancheng Biotechnology was used to detect the contents of H2O2, MDA, Pro and SOD in GbUBC23-pTRV2 transgenic cotton and control pTRV2 cotton under drought stress. The specific method is referred to the kit instructions.

[0096] like Figure 8 As shown in the figure, before drought stress, the contents of hydrogen peroxide (H2O2), malondialdehyde (MDA), proline (Pro) and superoxide dismutase (SOD) in GbUBC23-pTRV2 transgenic cotton and control pTRV2 cotton were no different from those in the control. After 7 days of drought stress, the contents of H2O2 and MDA in GbUBC23-pTRV2 transgenic cotton and control pTRV2 cotton increased compared with those before drought stress, but the contents of H2O2 and MDA in GbUBC23-pTRV2 transgenic cotton after drought were significantly higher than those in control pTRV2 cotton; similarly, the contents of Pro and SOD in GbUBC23-pTRV2 transgenic cotton and control pTRV2 cotton increased compared with those before drought stress, but the contents of Pro and SOD in GbUBC23-pTRV2 transgenic cotton after drought were significantly lower than those in control pTRV2 cotton. This indicates that silencing GbUBC23 aggravates the damage of cell membranes, thereby enhancing the damage of drought stress to transgenic plants.

Claims

1. The GbUBC23 gene of sea island cotton is characterized by: The core nucleotide sequence of the GbUBC23 gene of sea island cotton is shown in SEQ ID NO:

1.

2. A 3'UTR region containing the core nucleotide sequence of the GbUBC23 gene of Gossypium barbadense according to claim 1, characterized in that: The nucleotide sequence of the 3'UTR region is shown in SEQ ID NO:

2.

3. The use of the GbUBC23 gene of sea island cotton in positively regulating drought stress response of sea island cotton according to claim 1, characterized in that: The core nucleotide sequence of the GbUBC23 gene of sea island cotton is shown in SEQ ID NO:

1.

4. A method for preparing drought-intolerant Sea Island cotton, characterized in that: Obtaining drought-intolerant Sea Island cotton by silencing the core nucleotide sequence of the Sea Island cotton GbUBC23 gene in the 3'UTR region of claim 2; The nucleotide sequence of the 3'UTR region is shown in SEQ ID NO:2, and the core nucleotide sequence of the GbUBC23 gene of Gossypium barbadense is shown in SEQ ID NO:

1.

5. A method for preparing drought-intolerant sea island cotton complex plants, characterized in that: The following steps are involved: Using the pTRV2 viral silencing vector, the 3'UTR region containing the core nucleotide sequence of the GbUBC23 gene of the sea island cotton described in claim 2 is connected to the pTRV2 viral silencing vector by homologous recombination, and then transferred into Agrobacterium GV3101 by freeze-thaw method to obtain GbUBC23-pTRV2; Agrobacterium cultures of pTRV1 and GbUBC23-pTRV2 were mixed in a ratio of 1:1 and infiltrated into two intact cotyledons of cotton seedlings at the two-leaf one-heart stage using a needleless syringe to obtain drought-intolerant sea island cotton complex plants.

6. Use of the core nucleotide sequence of the GbUBC23 gene of the Gossypium barbadensis in the 3'UTR region of claim 2 in silencing the GbUBC23 gene of the Gossypium barbadensis in the 3'UTR region of claim 2 in preparing the Gossypium barbadensis that is not tolerant to drought stress, characterized in that: The nucleotide sequence of the 3'UTR region is shown in SEQ ID NO:2, and the core nucleotide sequence of the GbUBC23 gene of Gossypium barbadense is shown in SEQ ID NO:

1.

7. A PCR method for extracting and amplifying the 3'UTR region containing the core nucleotide sequence of the GbUBC23 gene of Gossypium barbadense according to claim 2, characterized in that: The following steps are involved: RNA was extracted from true leaves of sea island cotton and reverse transcribed into cDNA; Using the cDNA of true leaves of sea island cotton as a template, PCR amplification was performed using cloning primers and LA-Taq polymerase; wherein: PCR reaction system: template cDNA 1.0 μL, forward primer 1.0 μL, reverse primer 1.0 μL, 10×PCR buffer 5.0 μL, dNTPs 4.0 μL, LA-Taq polymerase 1 μL and ddH2O 36 μL, total volume 50 μL.

8. The method according to claim 7, characterized in that The cloning primers used were: GbUBC23-F: 5'-ATGGAAGTCCGACCCAATC-3', GbUBC23-R: 5'-CTAGTAGGGATGAGCTAGCAGACC-3'.

9. The method according to claim 7, characterized in that: The PCR amplification program is: Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s; extension at 72°C for 60 s; 35 PCR cycles, extension at 72°C for 10 min.

Images