DNA (deoxyribonucleic acid) aptamer for specifically recognizing natural CRP (C-reactive protein) and application

Abstract

The invention relates to the technical field of biomolecular engineering, in particular to a DNA aptamer capable of specifically recognizing natural CRP and application, and the DNA aptamer capable of specifically recognizing natural CRP contains at least one of the following sequences: (1) a nucleic acid sequence as shown in SEQ ID NO: 1 and a functional derivative thereof; and (2) a nucleic acid sequence as shown in SEQ ID NO: 2 and a functional derivative thereof. The DNA aptamer provided by the invention can be highly specifically combined with natural CRP in a complex biological sample, so that a novel biological detection method is provided; besides, compared with a traditional antibody method for recognizing the natural CRP, the DNA aptamer has the advantages of low cost, no immunogenicity, high in-vivo stability and the like, and is suitable for capturing the nCRP in a complex system, so that accurate detection, purification, in-vivo imaging, diagnosis, drug delivery and the like of the nCRP are realized.

Description

Technical Field

[0001] The present invention relates to the technical field of biomolecular engineering, and in particular to a DNA aptamer specifically recognizing natural CRP and its application. Background Art

[0002] Aptamers are a unique class of single-stranded oligonucleotides (DNA or RNA) that can specifically bind to target molecules (targets) through a specific three-dimensional conformation; the screening of aptamers is mainly achieved through the systematic evolution of ligands by exponential enrichment (SELEX) technology. Compared with traditional antibodies, aptamers have many advantages, such as simple screening process, chemical synthesis, easy modification, relatively low cost, good biocompatibility, and high long-term storage stability. The targets of aptamers are wide-ranging, including but not limited to metal ions, small molecules, peptides, proteins, etc., and can even be complete virus particles or cells. With these characteristics, aptamers show great application potential in target detection and purification, disease diagnosis, imaging, and drug delivery.

[0003] C-reactive protein (CRP) is an acute phase response protein. It is composed of five identical subunits covalently linked to form a disc-shaped pentamer structure and is mainly synthesized in the liver. The plasma concentration of CRP can rapidly increase from the basal level of about 1 μg / mL to more than 1000 times within 48 hours after inflammation or tissue damage. Due to its relevance to inflammation, CRP is often used as a biomarker for infection, tissue damage and the progression of certain inflammatory diseases, especially in the prediction and evaluation of cardiovascular disease. In addition, CRP is not only a biomarker, but also plays a role in the regulation of innate and adaptive immunity, and is involved in the occurrence of inflammation-related diseases, such as cardiovascular disease, autoimmune disease, infection, tissue damage, and nervous system diseases. After being synthesized in the liver, CRP exists in the blood in the form of a pentamer, which is called natural CRP (nCRP). In an inflammatory environment, nCRP can irreversibly dissociate into monomeric CRP (mCRP). Existing studies have shown that the conversion of nCRP to mCRP is the key to the regulation of CRP function, and this allosteric process plays a role in precise regulation in the inflammatory response. Currently, the detection of nCRP mainly relies on high-cost antibody methods, which are not sensitive and convenient enough.

[0004] Therefore, the prior art still needs to be improved and developed. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a DNA aptamer and application that specifically recognizes natural CRP, aiming to solve the problems of high cost, insufficient sensitivity and simplicity of the existing antibody method for detecting nCRP.

[0006] The technical solution of the present invention is as follows:

[0007] A DNA aptamer that specifically recognizes natural CRP, wherein the DNA aptamer contains at least one of the following sequences:

[0008] (1) The nucleic acid sequence shown in SEQ ID NO: 1 and its functional derivatives;

[0009] (2) The nucleic acid sequence shown in SEQ ID NO: 2 and its functional derivatives.

[0010] The DNA aptamer that specifically recognizes natural CRP, wherein the functional derivative includes at least one of the following:

[0011] A derivative obtained by modifying at least one base in the nucleic acid sequence shown in SEQ ID NO: 1;

[0012] A derivative obtained by modifying at least one base in the nucleic acid sequence shown in SEQ ID NO: 2;

[0013] A sequence having a homology of more than 60% with the nucleic acid sequence shown in SEQ ID NO: 1;

[0014] A sequence having a homology of more than 60% with the nucleic acid sequence shown in SEQ ID NO: 2;

[0015] A sequence that can hybridize with the nucleic acid sequence shown in SEQ ID NO: 1 under stringent conditions;

[0016] A sequence that can hybridize with the nucleic acid sequence shown in SEQ ID NO: 2 under stringent conditions;

[0017] A phosphorothioate backbone sequence derived from the nucleic acid sequence shown in SEQ ID NO: 1;

[0018] A phosphorothioate backbone sequence derived from the nucleic acid sequence shown in SEQ ID NO: 2;

[0019] A peptide nucleic acid converted from the nucleic acid sequence shown in SEQ ID NO: 1;

[0020] A peptide nucleic acid converted from the nucleic acid sequence shown in SEQ ID NO: 2;

[0021] Wherein, the functional derivative maintains the specific recognition function of natural CRP.

[0022] The DNA aptamer that specifically recognizes natural CRP, wherein the modification includes one or more of phosphorylation, methylation, amination, sulfhydrylation, and isotope labeling.

[0023] The DNA aptamer that specifically recognizes natural CRP, wherein the functional group in the functional derivative is selected from at least one of a fluorescent group, a radioactive group, a therapeutic drug, biotin, digoxin, a nanoluminescent material, a nucleic acid substance, and an enzyme marker.

[0024] A DNA aptamer that specifically recognizes natural CRP is used in detecting or purifying nCRP.

[0025] Application of a DNA aptamer that specifically recognizes natural CRP in the preparation of an in vivo imaging contrast agent for nCRP-related diseases.

[0026] The application of the DNA aptamer that specifically recognizes natural CRP, wherein the nCRP-related disease includes at least one of cardiovascular disease, autoimmune disease, infection, tissue damage, and nervous system disease.

[0027] A DNA aptamer that specifically recognizes natural CRP is used in the preparation of diagnostic or therapeutic drugs for nCRP-related diseases.

[0028] The application of the DNA aptamer that specifically recognizes natural CRP, wherein the nCRP-related disease includes at least one of cardiovascular disease, autoimmune disease, infection, tissue damage, and nervous system disease.

[0029] A product for identifying nCRP, comprising the DNA aptamer that specifically recognizes natural CRP.

[0030] Beneficial effects: The present invention provides a DNA aptamer and application that specifically recognizes natural CRP. The DNA aptamer that specifically recognizes natural CRP contains at least one of the following sequences: (1) the nucleic acid sequence shown in SEQ ID NO:1 and its functional derivatives; (2) the nucleic acid sequence shown in SEQ ID NO:2 and its functional derivatives. The DNA aptamer provided by the present invention can bind to natural CRP with high specificity in complex biological samples, thereby providing a new type of biological detection method; in addition, compared with the traditional antibody method, the use of DNA aptamers to identify natural CRP has the advantages of low cost, no immunogenicity, and high in vivo stability, and is suitable for the capture of nCRP in complex systems to achieve accurate detection, purification, in vivo imaging, diagnosis and drug delivery of nCRP. Therefore, the DNA aptamer has important application value for the detection, purification, in vivo imaging, diagnosis of nCRP and as a drug delivery system. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is a schematic diagram of the SELEX screening process of DNA aptamers that specifically recognize nCRP in Example 1 of the present invention;

[0032] Figure 2 is a schematic diagram of the predicted secondary structure of ApnCRP1 in Example 1;

[0033] Figure 3 is a schematic diagram of the predicted secondary structure of ApnCRP2 in Example 1;

[0034] Figure 4 This is a comparison of the binding effects of the DNA library enriched by SELEX with nCRP and mCRP in Example 1;

[0035] Figure 5 is a comparison diagram of the binding effects of nCRP and mCRP with the DNA library enriched by SELEX in Example 1;

[0036] Figure 6 This is a comparison diagram of the binding effects of the specific DNA aptamers screened in Example 1 with nCRP and mCRP;

[0037] Figure 7 This is a comparison chart of the binding effects of nCRP and mCRP with the specific DNA aptamers screened in Example 1. DETAILED DESCRIPTION

[0038] The present invention provides a DNA aptamer that specifically recognizes natural CRP and its application. In order to make the purpose, technical solution and effect of the present invention clearer and more specific, the present invention is further described in detail below. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0039] It will be understood by those skilled in the art that, unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as generally understood by those skilled in the art in the art to which the present invention belongs. It should also be understood that terms such as those defined in general dictionaries should be understood to have meanings consistent with the meanings in the context of the prior art, and will not be interpreted with idealized or overly formal meanings unless specifically defined as herein.

[0040] The present invention provides a DNA aptamer that specifically recognizes natural CRP, wherein the DNA aptamer contains at least one of the following sequences:

[0041] (1) The nucleic acid sequence shown in SEQ ID NO: 1 and its functional derivatives;

[0042] (2) The nucleic acid sequence shown in SEQ ID NO: 2 and its functional derivatives.

[0043] Specifically, the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2 are as follows:

[0044] SEQ ID NO:1:GTCCGACATTGGGAAGGCTTAATGGGCTGG

[0045] SEQ ID NO:2:AGCCGGTGCTATGGTAGCTGCTTGGCTCGG

[0046] In this embodiment, the provided DNA aptamer can bind to natural CRP with high specificity in complex biological samples, thereby providing a new type of biological detection method; in addition, compared with the traditional antibody method, the use of DNA aptamers to identify natural CRP has the advantages of low cost (aptamers can be solid-phase synthesized in vitro, which is a very mature and standardized method), no immunogenicity (will not stimulate immune cells to produce anti-antibodies), high in vivo stability (DNA aptamers can resist serum degradation compared to RNA aptamers), etc., and is suitable for the capture of nCRP in complex systems to achieve accurate detection, purification, in vivo imaging, diagnosis and drug delivery of nCRP. Therefore, the DNA aptamer has important application value for the detection, purification, in vivo imaging, diagnosis of nCRP and as a drug delivery system.

[0047] In some embodiments, the functional derivative includes but is not limited to at least one of the following:

[0048] 1) A derivative obtained by modifying at least one base in the nucleic acid sequence shown in SEQ ID NO: 1;

[0049] 2) A derivative obtained by modifying at least one base in the nucleic acid sequence shown in SEQ ID NO: 2;

[0050] 3) a sequence having a homology of more than 60% with the nucleic acid sequence shown in SEQ ID NO: 1;

[0051] 4) a sequence having a homology of more than 60% with the nucleic acid sequence shown in SEQ ID NO: 2;

[0052] 5) a sequence that can hybridize with the nucleic acid sequence shown in SEQ ID NO: 1 under stringent conditions;

[0053] 6) a sequence that can hybridize with the nucleic acid sequence shown in SEQ ID NO: 2 under stringent conditions;

[0054] 7) a phosphorothioate backbone sequence derived from the nucleic acid sequence shown in SEQ ID NO: 1;

[0055] 8) a phosphorothioate backbone sequence derived from the nucleic acid sequence shown in SEQ ID NO: 2;

[0056] 9) a peptide nucleic acid transformed from the nucleic acid sequence shown in SEQ ID NO: 1;

[0057] 10) a peptide nucleic acid transformed from the nucleic acid sequence shown in SEQ ID NO: 2;

[0058] Wherein, the functional derivatives all maintain the specific recognition function of natural CRP.

[0059] Specifically, a sequence having at least 60% homology with the nucleic acid sequence shown in SEQ ID NO: 1 may include a DNA sequence having a homology of 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% and capable of specifically identifying nCRP. Similarly, a sequence having at least 60% homology with the nucleic acid sequence shown in SEQ ID NO: 2 may include a DNA sequence having a homology of 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% and capable of specifically identifying nCRP.

[0060] Furthermore, phosphorothioate modification is used to improve the stability and nuclease resistance of oligonucleotide aptamers; peptide nucleic acid (PNA) is a class of nucleic acid analogs that replace the sugar-phosphate backbone in DNA with a neutral peptide chain amide bond, and peptide nucleic acid has a high degree of specific sequence recognition ability, is not easily hydrolyzed by nucleases and proteases, and can be used to effectively recognize and bind to DNA or RNA sequences to form a stable double helix structure. In the present invention, the phosphorothioate backbone sequence and peptide nucleic acid can be prepared according to conventional methods.

[0061] In some embodiments, the modification comprises one or more of phosphorylation, methylation, amination, sulfhydrylation, and isotope labeling.

[0062] In some embodiments, the functional group in the functional derivative is selected from at least one of a fluorescent group, a radioactive group, a therapeutic drug, biotin, digoxin, a nanoluminescent material, a nucleic acid substance, and an enzyme marker.

[0063] Specifically, the modification of the nucleic acid sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 and the connection of functional groups can be carried out by any known method, as long as these changes do not affect the basic function of the sequence, that is, specific recognition of nCRP. For example, the 3' end or 5' end of the sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2 can be modified or connected with functional groups. These modifications or functional groups can be used to improve the stability of the aptamer, provide a detection signal, or be used to connect the aptamer to other substances to form a complex.

[0064] In addition, the present invention also provides a use of a DNA aptamer that specifically recognizes natural CRP in detecting or purifying nCRP.

[0065] In addition, the present invention also provides a use of a DNA aptamer that specifically recognizes natural CRP in the preparation of an in vivo imaging contrast agent for nCRP-related diseases.

[0066] In some embodiments, the nCRP-related disease comprises at least one of cardiovascular disease, autoimmune disease, infection, tissue damage, and nervous system disease.

[0067] In addition, the present invention also provides a use of a DNA aptamer that specifically recognizes natural CRP in the preparation of diagnostic or therapeutic drugs for nCRP-related diseases.

[0068] In addition, the present invention also provides a product for identifying nCRP, comprising the DNA aptamer that specifically recognizes natural CRP.

[0069] In this embodiment, the DNA aptamer screened by SELEX technology has the advantages of low cost, non-immunogenicity, and high in vivo stability compared to traditional antibodies. It is suitable for capturing nCRP in complex systems to achieve biomedical applications such as accurate detection, purification, in vivo imaging, diagnosis and drug delivery of nCRP.

[0070] In some embodiments, the product for identifying nCRP includes but is not limited to a kit, a detection chip, and the like.

[0071] In this embodiment, the SELEX technology is used to screen out DNA aptamers that can specifically recognize nCRP, and the process includes: first synthesizing an initial DNA library containing 30 random nucleotides, and using nCRP as the target protein and mCRP as the control protein for SELEX screening. The core steps of the screening process design include the binding of aptamers to proteins, magnetic bead separation, PCR amplification, etc. After 16 rounds of screening, two aptamers, ApnCRP1 and ApnCRP2, were obtained. The secondary structures of the two aptamers were predicted using RNAstructure software, and it was found that the two aptamers formed unique stem-loop structures and hairpin structures, respectively.

[0072] The following examples are further given to illustrate the present invention in detail. It should also be understood that the following examples are only used to further illustrate the present invention and cannot be understood as limiting the scope of protection of the present invention. Some non-essential improvements and adjustments made by those skilled in the art based on the above content of the present invention belong to the scope of protection of the present invention.

[0073] Example 1

[0074] This example uses SELEX to screen DNA aptamers that specifically recognize nCRP, specifically including:

[0075] The initial random single-stranded DNA library chemically synthesized first has a sequence as shown in SEQ ID NO: 3, which is as follows:

[0076] TAGGGAAGAGAAGGACATTGAT-N(30)-TTGACTAGTACATGACC ACTTGA

[0077] Wherein, N(30) represents a region consisting of 30 random nucleotides.

[0078] Primer P1: 5′-TAGGGAAGAGAAGGACATATGAT-3′

[0079] Primer P2: 5'-phosphorylation-TCAAGTGGTCATGTACTAGTCAA-3'

[0080] In the Filter step, do the following:

[0081] 1. Heat 1 nmol of random single-stranded DNA library at 95°C for 5 minutes, then quickly cool in an ice bath for 10 minutes to ensure complete denaturation of the DNA library.

[0082] 2. Add 50 pmol of nCRP protein containing 6×His tag to the treated DNA library and incubate at 25°C for 1 hour to allow the DNA aptamer to bind to the target protein.

[0083] 3. Then introduce 50 μl of Mag-Beads His-Tag protein purification magnetic beads and incubate again at 25°C for 30 minutes. This step is intended to capture the complex through the His tag of the affinity magnetic beads.

[0084] 4. Wash the magnetic beads three times using washing buffer (phosphate buffered saline (PBS) containing 5 mM MgCl2, 5 mM imidazole, and 0.02% Tween-20), using 1 ml each time.

[0085] 5. Add 50 μl of 500 mM imidazole solution to the washed magnetic beads, let stand at room temperature for 1 minute, and then collect the magnetic bead supernatant, which contains the target aptamer DNA.

[0086] 6. Pre-amplify the adapter DNA in the supernatant in 500 μl PCR reaction system, set for 6 cycles.

[0087] 7. To determine the optimal number of amplification cycles, a cycle gradient experiment was used. Part of the pre-amplification product was used as a template and amplification was performed for 6, 9, 12, and 15 cycles in four groups of 50 μl PCR reaction systems.

[0088] 8. Separate the PCR products by gel electrophoresis and select the optimal cycle number for subsequent aptamer screening and double-stranded DNA preparation.

[0089] 9. Purify the obtained amplified product and perform quantitative analysis using Nanodrop photometer.

[0090] 10. For every 2 μg of amplified product, add 5 μl of 10× digestion buffer and 1 μl of lambda exonuclease to make up to 50 μl, and then digest at 37°C for 30 minutes to obtain single-stranded DNA.

[0091] 11. For negative screening, heat 1 nmol of single-stranded DNA at 95°C for 5 minutes and then place on ice for 10 minutes. Then add 100 pmol of mCRP protein containing 6×His tag and 50 μl of Mag-Beads His-Tag protein purification magnetic beads, incubate at 25°C for 30 minutes and collect the supernatant.

[0092] 12. Repeat the above PCR amplification steps, select the most appropriate number of cycles, amplify, purify, quantify and prepare single-stranded DNA of the screening product.

[0093] 13. Perform 16 rounds of screening and clone and sequence the PCR products from the last round, as shown in Figure 1 shown.

[0094] 14. The secondary structures of ApnCRP1 and ApnCRP2 obtained by screening were predicted using RNAstructure software, such as Figure 2 and Figure 3 As shown, ApnCRP1 and ApnCRP2 formed specific stem-loop structures and hairpin structures, respectively.

[0095] In the advanced optimization example of this embodiment, for the successfully screened nCRP-specific DNA aptamers, namely ApnCRP1 and ApnCRP2, a variety of improvement strategies are proposed to enhance their functionality and applicability. These improvements include but are not limited to phosphorylation, methylation, amination, thiolation or isotopeation of at least one base of the aptamer to produce a series of derivative forms.

[0096] In addition, the present embodiment also includes a method for attaching functional groups to ApnCRP1 and ApnCRP2. These functional groups can be fluorescent labels, radioisotopes, therapeutic drugs, biotin, digoxin, nano-scale luminescent materials, nucleic acid molecules or enzyme labels, etc. For example, a multifunctional drug delivery system can be constructed by introducing different chemical groups at the ends of ApnCRP1 and ApnCRP2 and combining them with drug carriers. Such a system may include a combination with polymers, inorganic nanoparticles, dendritic macromolecules, liposomes or micelles, etc. At the same time, ApnCRP1 and ApnCRP2 can also be used to connect to markers for use in the detection and identification of sample cells, tissues or biomacromolecules. By attaching markers to the 5' or 3' ends of ApnCRP1 and ApnCRP2 and introducing them into the sample to be tested, the binding of aptamers to samples can be evaluated by various detection methods such as flow cytometry, confocal microscopy or immunochemiluminescence. In addition, a facile and effective method for targeted drug delivery can be achieved by directly embedding drug molecules into ApnCRP1 or ApnCRP2, or by chemically modifying the drugs to form stable ester, amine, or disulfide bonds on the aptamer, or by covalently linking them through linkers.

[0097] This embodiment can also obtain DNA sequences with a homology of more than 60% based on ApnCRP1 and ApnCRP2, and these sequences can also specifically identify nCRP. These homologous sequences can hybridize with ApnCRP1 and ApnCRP2 under strict experimental conditions. Furthermore, the present invention also covers a method for transforming the skeleton of ApnCRP1 and ApnCRP2 into a phosphorothioate skeleton or a peptide nucleic acid.

[0098] Here, those skilled in the art should realize that based on ApnCRP1 and ApnCRP2, any known method can be used to obtain their derivatives, and all of these derivatives are within the protection scope of the present invention.

[0099] Example 2

[0100] The SELEX-enriched DNA library in Example 1 was verified to be able to specifically bind to nCRP, specifically including:

[0101] In this example, 100 pmol of each DNA library enriched in rounds 4, 6, 8, and 16 was taken and heated at 95°C for 5 minutes to melt the chain, and then immediately placed in an ice bath for 10 minutes to cool rapidly. After that, 25 pmol of nCRP and mCRP proteins with 6×His tags were added to each sample, respectively, and incubated at 25°C for 1 hour to promote the binding of DNA to protein. Next, 25 μl of Mag-Beads His-Tag protein purification magnetic beads were added to each sample, and incubated at 25°C for another 30 minutes to capture the DNA library bound to the target protein through the His tag of the magnetic beads.

[0102] Subsequently, the magnetic beads were washed three times with 1 ml of a washing buffer containing PBS, 5 mM MgCl2, 5 mM imidazole and 0.02% Tween-20. After washing, 25 μl of 500 mM imidazole solution was added to the magnetic beads and allowed to stand at room temperature for 1 minute to elute the bound DNA, and the supernatant was then collected.

[0103] For PCR amplification, the following specific primers were used:

[0104] Primer P1: 5′-TAGGGAAGAGAAGGACATATGAT-3′

[0105] Primer P3: 5'-TCAAGTGGTCATGTACTAGTCAA-3'

[0106] After PCR amplification, the products were analyzed by nucleic acid electrophoresis, and the brightness of the electrophoresis bands was quantitatively analyzed using Quantity One software. The experimental results showed that as the number of screening rounds increased, the binding ability of the DNA library to nCRP increased, while the binding to mCRP did not increase significantly (e.g. Figure 4 shown).

[0107] Furthermore, in order to obtain biotin-labeled single-stranded DNA, PCR amplification was performed on the DNA libraries enriched in the 4th, 6th, 8th, and 16th rounds, and the amplification primers were as follows:

[0108] Primer P4: 5′-biotin-TAGGGAAGAGAAGGACATATGAT-3′

[0109] Primer P2: 5'-phosphorylation-TCAAGTGGTCATGTACTAGTCAA-3'

[0110] After the amplified product was purified and quantified by Nanodrop, 5 μl of 10× digestion buffer and 1 μl of lambda exonuclease were added to every 2 μg of DNA, and the volume was made up to 50 μl with water, and digested at 37°C for 30 min.

[0111] Subsequently, 200 pmol of biotin-labeled single-stranded DNA was taken, and the aforementioned heating and ice bath steps were repeated, and incubated with 50 pmol of nCRP and mCRP proteins containing 6×His tags at 25°C for 1 hour. Streptavidin MagSepharose magnetic beads were used for enrichment experiments, and nCRP and mCRP proteins bound to DNA were detected by electrophoresis, and the electrophoresis bands were quantitatively analyzed using Quantity One software. The results showed that as the number of screening rounds increased, the binding ability of nCRP to the enriched DNA sequences increased, while no obvious binding was observed between mCRP and these DNA sequences (such as Figure 5 shown).

[0112] Example 3

[0113] The specific binding of the DNA aptamer screened and obtained in Example 1 to nCRP was verified, specifically including:

[0114] In this experiment, 200 pmol of ApnCRP1 and ApnCRP2 aptamers were first obtained, heated at 95°C for 5 minutes to unwind the DNA double helix, and then quickly placed in an ice water bath for 10 minutes. 50 pmol of nCRP and mCRP proteins with 6×His tags were added to each sample and incubated at 25°C for 1 hour to allow the aptamers to bind to the proteins. After the incubation was completed, 50 μl of Mag-Beads His-Tag protein purification beads were added to each mixture and incubated at 25°C for another 30 minutes to capture the His-tagged proteins using the beads.

[0115] Subsequently, the magnetic beads were washed three times with 1 ml of washing buffer containing PBS, 5 mM MgCl2, 5 mM imidazole and 0.02% Tween-20. After washing, 25 μl of 500 mM imidazole solution was added to the magnetic beads and allowed to stand at room temperature for 1 minute to elute the bound protein-DNA complex, and then the supernatant was collected. Subsequently, the collected samples were heated at 95°C for 10 minutes, and the samples were analyzed by nucleic acid electrophoresis, and the brightness of the electrophoresis bands was quantified using Quantity One software. The experimental results showed that ApnCRP1 and ApnCRP2 could bind to nCRP, but had no obvious binding to mCRP (such as Figure 6 shown).

[0116] In another part of the experiment, 200 pmol of biotin-labeled ApnCRP1 and ApnCRP2 aptamers were obtained, and they were also heated at 95°C for 5 minutes and then quickly placed on ice for 10 minutes. Then, 50 pmol of nCRP and mCRP proteins with 6×His tags were added to each sample and incubated at 25°C for 1 hour. The aptamers were enriched using Streptavidin Mag Sepharose beads, and nCRP and mCRP bound to DNA were detected by protein electrophoresis. Quantity One software was also used for quantitative analysis of the electrophoresis bands. The results showed that nCRP was able to bind to biotin-labeled ApnCRP1 and ApnCRP2, while mCRP had no obvious binding to these aptamers (such as Figure 7 shown).

[0117] In summary, the present invention provides a DNA aptamer and application that specifically recognizes natural CRP, and the DNA aptamer that specifically recognizes natural CRP contains at least one of the following sequences: (1) the nucleic acid sequence shown in SEQ ID NO:1 and its functional derivatives; (2) the nucleic acid sequence shown in SEQ ID NO:2 and its functional derivatives. The DNA aptamer provided by the present invention can bind to natural CRP with high specificity in complex biological samples, thereby providing a new type of biological detection method; in addition, compared with the traditional antibody method, the use of DNA aptamers to identify natural CRP has the advantages of low cost, no immunogenicity, and high in vivo stability, and is suitable for the capture of nCRP in complex systems to achieve accurate detection, purification, in vivo imaging, diagnosis and drug delivery of nCRP. Therefore, the DNA aptamer has important application value for the detection, purification, in vivo imaging, diagnosis of nCRP and as a drug delivery system.

[0118] It should be understood that the application of the present invention is not limited to the above examples. For ordinary technicians in this field, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. A DNA aptamer that specifically recognizes natural CRP, characterized in that: The DNA aptamer contains at least one of the following sequences: (1) The nucleic acid sequence shown in SEQ ID NO: 1 and its functional derivatives; (2) The nucleic acid sequence shown in SEQ ID NO: 2 and its functional derivatives.

2. The DNA aptamer that specifically recognizes natural CRP according to claim 1, characterized in that The functional derivatives include at least one of the following: A derivative obtained by modifying at least one base in the nucleic acid sequence shown in SEQ ID NO: 1; A derivative obtained by modifying at least one base in the nucleic acid sequence shown in SEQ ID NO: 2; A sequence having a homology of more than 60% with the nucleic acid sequence shown in SEQ ID NO: 1; A sequence having a homology of more than 60% with the nucleic acid sequence shown in SEQ ID NO: 2; A sequence that can hybridize with the nucleic acid sequence shown in SEQ ID NO: 1 under stringent conditions; A sequence that can hybridize with the nucleic acid sequence shown in SEQ ID NO: 2 under stringent conditions; A phosphorothioate backbone sequence derived from the nucleic acid sequence shown in SEQ ID NO: 1; A phosphorothioate backbone sequence derived from the nucleic acid sequence shown in SEQ ID NO: 2; A peptide nucleic acid converted from the nucleic acid sequence shown in SEQ ID NO: 1; A peptide nucleic acid converted from the nucleic acid sequence shown in SEQ ID NO: 2; Wherein, the functional derivative maintains the specific recognition function of natural CRP.

3. The DNA aptamer that specifically recognizes natural CRP according to claim 2, characterized in that: The modification includes one or more of phosphorylation, methylation, amination, sulfhydrylation, and isotope labeling.

4. The DNA aptamer that specifically recognizes natural CRP according to claim 1, characterized in that The functional group in the functional derivative is selected from at least one of a fluorescent group, a radioactive group, a therapeutic drug, biotin, digoxin, a nanoluminescent material, a nucleic acid substance, and an enzyme marker.

5. Use of the DNA aptamer that specifically recognizes natural CRP as claimed in any one of claims 1 to 4 in detecting or purifying nCRP.

6. Use of the DNA aptamer that specifically recognizes natural CRP as claimed in any one of claims 1 to 4 in the preparation of an in vivo imaging contrast agent for nCRP-related diseases.

7. The use of a DNA aptamer that specifically recognizes natural CRP according to claim 6, characterized in that: The nCRP-related diseases include at least one of cardiovascular diseases, autoimmune diseases, infections, tissue damage, and nervous system diseases.

8. Use of the DNA aptamer that specifically recognizes natural CRP as claimed in any one of claims 1 to 4 in the preparation of diagnostic or therapeutic drugs for nCRP-related diseases.

9. The use of a DNA aptamer that specifically recognizes natural CRP according to claim 8, characterized in that: The nCRP-related diseases include at least one of cardiovascular diseases, autoimmune diseases, infections, tissue damage, and nervous system diseases.

10. A product for identifying nCRP, characterized in that: The invention comprises a DNA aptamer that specifically recognizes natural CRP as described in any one of claims 1 to 4.

Images