Method for tracking and purifying pancreatic precursor cells by using SOX9 / PDX1 double reporter genes

Abstract

The invention provides a method for tracking and purifying pancreatic precursor cells by using SOX9 / PDX1 double reporter genes, which comprises the following steps: inserting eGFP and mCherry fluorescent proteins into the tail ends of endogenous SOX9 and PDX1 gene coding regions, and simultaneously inserting deletable selection marker puromycin to improve the monoclonal deletion efficiency; finally, a tracking system marked by double fluorescent proteins is obtained in the monoclonal cells of the human embryonic stem cells at the same time and is used for indicating and purifying pancreatic precursor cells. According to the method provided by the invention, the defects of cell karyotype errors and abnormal expression of embryonic stem cell marker genes which are easily caused by double markers are overcome, and all differentiation lineages of pancreatic precursor cells can be more comprehensively covered through double gene markers and purification; a rigorous, fine and convenient technical means is provided for tracking and researching the differentiation potential of the pancreatic precursor cells.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for tracking and purifying pancreatic precursor cells with the potential to differentiate into multiple lineages by using SOX9 / PDX1 dual reporter genes. Background Art

[0002] The pancreas is an important organ and gland in the human body. It has both exocrine functions to help digestion and endocrine functions to regulate blood sugar. The mature pancreas mainly contains ductal cells, acinar cells, and endocrine cells (β cells, α cells, δ cells, ε cells, and PP cells). Pancreatic diseases mainly include diabetes and pancreatic cancer. The damage and dysfunction of β cells among endocrine cells are the main causes of diabetes. At the same time, pancreatic cancer has become the fourth most lethal cancer in the world, of which pancreatic ductal adenocarcinoma accounts for 85% of all pancreatic cancers, and the incidence of pancreatic cancer is increasing rapidly. During the development of the pancreas, pancreatic precursor cells have the potential to differentiate and develop into all types of cells in the pancreas. The differentiation efficiency, quality, and function of pancreatic precursor cells directly affect the quality and function of terminally differentiated β cells and ductal cells. Therefore, pancreatic precursor cells that have the ability to differentiate into multiple lineages and obtain homogeneity are crucial.

[0003] The transcription factor PDX1 has been shown to play an important role in the development and formation of pancreatic progenitor cells, and is therefore often considered a unique marker for pancreatic progenitor cells. However, in recent years, experiments with PDX1 knockout mice have confirmed that PDX1 is not only an important transcription factor for pancreatic formation, but is also highly expressed in the pancreatic primordium and its adjacent gastric antrum and anterior region of the small intestine. Thereafter, SOX9 drives PDX1-positive cells to differentiate into all cells of the pancreas. Because PDX1 and SOX9 jointly determine the development and fate of the pancreas, this group of PDX1 + SOX9 +Double positive cells are the progenitor cells of the pancreas (Shih HP, Seymour PA, Patel NA, Xie R, Wang A, Liu PP, Yeo GW, Magnuson MA, Sander MA Gene Regulatory Network Cooperatively Controlled by Pdx1 and Sox9 Governs Lineage Allocation of Foregut Progenitor Cells. Cell Rep. 2015 Oct 13; 13(2): 326-36; Seymour PA. Sox9: a master regulator of the pancreatic program. Rev Diabet Stud. 2014 Spring; 11(1): 51-83.). However, in current pancreatic research, PDX1 is mainly used as a marker gene for pancreatic progenitor cells. In fact, PDX1 itself mainly indicates the endocrine lineage of the pancreas, and there are limitations on the development of the ductal and acinar lineages of the pancreas. However, the current double labeling of human embryonic stem cells can easily lead to errors in the cell karyotype and abnormal expression of embryonic stem cell marker genes. At the same time, the knock-in efficiency of multiple endogenous genes is low. The double labeling of SOX9 / PDX1 dual reporter genes has multiple uncertainties. No suitable method for tracking and purifying pancreatic precursor cells with this dual reporter gene has been disclosed in research. Summary of the invention

[0004] The purpose of the present invention is to provide a method for tracking and purifying pancreatic precursor cells using SOX9 / PDX1 dual reporter genes, thereby overcoming the defects that dual labeling easily leads to cell karyotype errors and abnormal expression of embryonic stem cell marker genes. Dual gene labeling and purification can more comprehensively cover all differentiation lineages of pancreatic precursor cells.

[0005] In order to achieve the above object, the present invention provides a method for tracking and purifying pancreatic precursor cells using SOX9 / PDX1 dual reporter genes, comprising the following steps:

[0006] 1) Insert the fluorescent gene mCherry and eGFP elements into the end of the coding region of human PDX1 and SOX9 genes, before the stop codon, design a deletable selection marker gene puromycin containing a loxp site after the fluorescent gene eGFP and mCherry elements, and design a 3XFlag tag before the fluorescent gene eGFP and mCherry elements;

[0007] 2) The fluorescent reporter plasmid was transferred into the human embryonic stem cell line, which was first cultured in Vitronectin gel and then transferred to Matrigel matrix gel for culture;

[0008] 3) differentiating the transferred cells into definitive endoderm cells, primitive gut tube cells, posterior foregut cells and pancreatic progenitor cells in sequence;

[0009] 4) Purification of dual-fluorescent pancreatic progenitor cells with the potential to differentiate into ductal cells, acinar cells, and endocrine cells.

[0010] eGFP and mCherry fluorescent proteins were inserted into the end of the endogenous SOX9 and PDX1 gene coding regions, and the deletable screening marker puromycin was inserted at the same time to improve the efficiency of monoclonal selection. The screening marker puromycin can be deleted at any time later to turn the cells into cells without screening markers.

[0011] As a preferred embodiment, the sgRNA recognition sequences corresponding to the insertion sites at the ends of the coding regions of the human SOX9 and PDX1 genes are PDX1-sgRNA1: CAGAGGGCCTAGGAGGACCC (SEQ ID NO.1), PDX1-sgRNA2: AGGGCGGGTGGTCCACGCCC (SEQ ID NO.2), SOX9-sgRNA1: CTTGAGGAGGCCTCCCACGA (SEQ ID NO.3), SOX9-sgRNA2: CGGCCATCTTCGCCCTTCGT (SEQ ID NO.4).

[0012] As a preferred embodiment, the recognition sequence is installed on the pSpCas9(BB)-2A-GFP(PX458) plasmid.

[0013] As a preferred solution, the PDX1 fluorescent reporter plasmid, PDX1-sgRNA1 plasmid and PDX1-sgRNA2 plasmid are mixed and transferred into human embryonic stem cells by electroporation, cells in which the sgRNA plasmid transiently expresses GFP are flow-sorted, drug-resistant positive monoclonal clones are selected after treatment with puromycin, and monoclonal clones that are accurately inserted into the terminal position of the gene coding region and fully inserted are selected by PCR and sequencing; SOX9 fluorescent reporter plasmid, SOX9-sgRNA1 plasmid and SOX9-sgRNA2 plasmid are transferred into PDX1-mCherry cells to obtain SOX9-eGFP positive clones with correct insertion sites and integrity, and the resulting cell line is a dual fluorescent reporter system containing both SOX9-eGFP and PDX1-mCherry.

[0014] As a preferred embodiment, the left arm of homologous recombination of the SOX9 gene is shown as SEQ ID NO.5, the right arm of homologous recombination of the SOX9 gene is shown as SEQ ID NO.7, the left arm of homologous recombination of the PDX1 gene is shown as SEQ ID NO.6, and the right arm of homologous recombination of the PDX1 gene is shown as SEQ ID NO.8.

[0015] As a preferred embodiment, the eGFP element sequence is shown as SEQ ID NO.9, and the mCherry element sequence is shown as SEQ ID NO.10.

[0016] As a preferred solution, in step (2), the cells are first cultured on Vitronectin matrix gel using serum-free medium, and passaged every 3-4 days, during which 10uM Y27632 inhibitor is added; when the number of cells is sufficient, the digested dual-fluorescence reporter cells are plated on Matrigel matrix gel, and the medium is replaced with mTeSR and Y27632, and differentiation experiments can be performed after culture. It was found that the differentiation quality of pancreatic in vitro differentiation on Matrigel matrix gel is much higher than that on Vitronectin matrix gel.

[0017] As a preferred embodiment, the digested dual fluorescence reporter cells are expressed as 1.56×10 4 / cm 2 The cells were plated on Matrigel at a density of 100 μg / cm2 and the culture medium was replaced with mTeSR and Y27632. The differentiation experiment was then carried out after culturing for 6.5 h.

[0018] As a preferred embodiment, the human embryonic stem cell line is an H1 human embryonic stem cell line. In step (2), the dual fluorescence reporter system plasmid is transferred into the H1 human embryonic stem cell, which has a higher differentiation efficiency than the H9 human embryonic stem cell line.

[0019] As a preferred embodiment, the dual-fluorescence reporter cells plated on Matrigel are differentiated into pancreatic progenitor cells according to the following four stages.

[0020] Stage 1: The cells were differentiated using the Definitive Endoderm Differentiation Kit (Stem cell #05110) for 4 days, during which CJ and MR supplements were added for 24 hours and then the culture medium was replaced with the medium containing only CJ supplements for another 3 days to obtain definitive endoderm cells.

[0021] Stage 2: The culture medium was replaced with RPMI-1640 (thermo#61870036), B27 was added at 50X, and dual antibody was added at 100X, basal culture medium was prepared, 50 ng / ml KGF (R&D251-KG-050) was added thereto, and stage 1 cells were cultured for 2 days to obtain stage 2 cells.

[0022] Stage 3: Replace the culture medium with high-glucose DMEM (thermo#10569044), add 50X B27, 100X bispecific antibody, prepare stage 3 basal culture medium, add 0.25uM KAAD (Stemgent#04-0028), 2uM RA (Stemgent#04-0021) and 0.25uM LDN (Stemgent#04-0074), and use this culture medium to differentiate for 2 days to obtain stage 3 cells.

[0023] Stage 4: Add 25 ng / ml KGF and 50 ng / ml EGF (R&D#236-EG-01M) to the basal medium of stage 3, and obtain pancreatic progenitor cells after culturing for 4 days.

[0024] Pancreatic progenitor cells were divided into four quadrants using eGFP and mCherry, and double-positive cells and double-negative cells were sorted for comparison.

[0025] The advantages of the present invention are that, by using the Crispr-Cas9 homologous recombination principle, eGFP and mCherry fluorescent proteins are inserted into the end of the endogenous SOX9 and PDX1 gene coding regions, and a deletable screening marker puromycin is inserted to improve the efficiency of monoclonal selection, and finally a dual fluorescent protein-labeled tracking system is obtained in human embryonic stem cell monoclonal cells to indicate and purify pancreatic precursor cells. The method of the present invention overcomes the defects that dual labeling easily leads to cell karyotype errors and abnormal expression of embryonic stem cell marker genes. Through dual gene labeling and purification, all differentiation lineages of pancreatic precursor cells can be more comprehensively covered, providing more rigorous, sophisticated and convenient technical means for tracking and studying the differentiation potential of pancreatic precursor cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a schematic diagram of the construction of the human PDX1-mCherry and SOX9-eGFP reporter system and the karyotype results.

[0027] Figure 2 Schematic diagram of in vitro differentiation of human pancreatic precursor cells and the differentiation results of different matrix gels and different human embryonic stem cells.

[0028] Figure 3 For H1 PDX1-mCherry；SOX9-eGFPqPCR analysis results of cell lines at different stages of in vitro differentiation.

[0029] Figure 4 For H1 PDX1-mCherry；SOX9-eGFP Dual fluorescence reporter of cell lineage differentiation outcomes. DETAILED DESCRIPTION

[0030] The technology of the present invention is described in detail below in conjunction with specific embodiments. It should be noted that the following specific embodiments are only used to help those skilled in the art understand the present invention, and are not intended to limit the present invention.

[0031] Example 1. Basic methods for identification at the genotype and transcriptome levels

[0032] 1. Rapid DNA extraction and PCR

[0033] Add the fast lysis solution (Lucigen) to the cells, and after rapid pipetting several times, put the lysate containing the cells into the PCR instrument, follow the program 68°C, 15min, then 95°C, 8min, and the product obtained can be directly used for PCR. Because the length of the SOX9 insert fragment is 5061bp (SEQ ID NO.9) and the length of the PDX1 insert fragment is 5143bp (SEQ ID NO.10), a high-fidelity DNA polymerase herculase (Agilent #600675) is used, and the extension temperature is adjusted to 55°C, and the extension time is changed to 5min. The primers for amplifying the insertion site and fragments are shown in Table 1.

[0034] Table 1 Primer sequences for knock-in site detection

[0035] Gene Forward primer 5'-3' Reverse primer 5'-3' PDX1 AACTGACCTGCAGTGTCCGTGTG AGCACAGGGACTCTTGCACT SOX9 TAAGACTAGGGCGTCTGCACAGC ATTGGCTGCTGAAACATTCC

[0036] 2. RNA Extraction and Fluorescence Quantitative qPCR

[0037] The cells were lysed with RNA lysis buffer NucleoZol (MN), and total RNA was obtained by liquid phase separation. 1 μg RNA was taken and used All-in-One First-Strand cDNA Synthesis SuperMix reagent removes genomic DNA contamination and reverse transcribes it into cDNA, using the program of incubation at 42°C for 15 minutes and incubation at 85°C for 5 seconds.

[0038] The obtained cDNA was diluted to 5 ng / ul, 2.5ul was taken as template, 1uM forward and reverse primers were used, and PowerUp TM SYBR TMGreen Master Mix was used for fluorescence quantitative qPCR, and the program used was pre-denaturation at 95°C for 2 min, denaturation at 95°C for 5 s, annealing at 60°C for 30 s, and a total of 39 cycles from denaturation to annealing. The data obtained were based on the level of GAPDH gene expression according to 2 -ΔΔCt Calculation method All experiments were performed with three independent biological replicates. The primers for qPCR are shown in Table 2.

[0039] Table 2 Fluorescence quantitative PCR primer sequences

[0040] Gene Forward primer 5'-3' Reverse primer 5'-3' Oct4 CTTGAATCCCGAATGGAAAGGG GTGTATATCCCAGGGTGATCCTC SOX2 GCCGAGTGGAAACTTTTGTCG GGCAGCGTGTACTTATCCTTCT SOX17 GGCGCAGCAGAATCCAGA CCACGACTTGCCCAGCAT FOXA2 GGGAGCGGTGAAGATGGA TCATGTTGCTCACGGAGGAGTA PDX1 TGGAGCTGGCTGTCATGTTGA CGCTTCTTGTCCTCCTCCTTTT SOX9 AGCTCTGGAGACTTCTGAACGAGAG CGTTCTTCACCGACTTCCTCCGC eGFP CACGACTTCTTCAAGTCCGC TGTTGCCGTCCTCCTTGAAG mCherry GCCAAGCTGAAGGTGACCAA CCTTGTAGATGAACTCGCCG GFPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG

[0041] 3. Karyotype Analysis

[0042] When the cell density was about 70%, colchicine was added to the cells and incubated for 3 hours. The cells were digested and washed with PBS. 8 ml of hypotonic solution preheated at 37°C was added dropwise and the cells were blown away. The cells were incubated at 37°C for 15 minutes. Then 1 ml of fixative was added to the above liquid for pre-fixation. After mixing, the cells were incubated at room temperature for 5 minutes. After centrifugation at 200g for 6 minutes, the supernatant was discarded, and 8 ml of fixative was added dropwise to the cells. The cells were incubated at 37°C for 30 minutes. The cells were centrifuged at 200g for 8 minutes. Finally, 6 ml of fixative was added and the cells were sent to the Medical Testing Center for karyotype analysis.

[0043] 4. Flow Cytometry Sorting

[0044] After digesting the cells, add 5% serum to stop digestion, wash once with PBS, filter with a 0.45um filter, and then sort on a machine to collect double-positive and double-negative cells.

[0045] Example 2. Construction of dual fluorescence reporter cell line and detection of differentiation ability

[0046] 1. Construction of human SOX9-eGFP and PDX1-mCherry targeting plasmids and cell lines

[0047] When constructing the dual fluorescence reporter vector plasmid, the pZG plasmid was first digested with BglII and XhoI to obtain the backbone elements, and then the PDX1 and SOX9 homologous recombination left arms (SEQ ID NO.5, SEQ ID NO.6), homologous recombination right arms (SEQ ID NO.7, SEQ ID NO.8) and eGFP, mCherry fluorescent reporter elements (SEQ ID NO.9, SEQ ID NO.10) were amplified using high-fidelity DNA polymerase, and the above three fragments were recovered using a gel recovery kit, and then Gibson Master Mix connects the PCR fragments to the backbone elements, ultimately obtaining a fluorescent reporter vector.

[0048] When constructing the sgRNA vector plasmid, the sgRNA sequence was first amplified by PCR, and then digested with BbsI and connected with T4 ligase to construct the sgRNA sequence on the pSpCas9(BB)-2A-GFP plasmid to obtain the sgRNA vector.

[0049] The constructed fluorescent vector plasmid and sgRNA plasmid were transferred into H1 human embryonic stem cells according to the instructions of the Lonza electroporator (Lonza # VPH-5012). The cells transiently expressing GFP in the sgRNA plasmid were selected by flow cytometry after 36 hours using the A023 program. After 48 hours of culture, the cells were treated with 1vg / ml puromycin for 5 days to select drug-resistant positive monoclonal clones. The accuracy and completeness of the insertion into the end of the gene coding region were detected by sequencing, and the correct clones were selected ( Figure 1 A), and then the karyotype of the single clone was detected. The results showed that both wild-type human embryonic stem cells and cells with dual fluorescent reporter system inserted had correct karyotypes, which were 46 in number and 23 in number.

[0050] Figure 1 Schematic diagram of the construction of the human PDX1-mCherry and SOX9-eGFP reporter system and the karyotype results. (A) Schematic diagram of the human PDX1-mCherry and SOX9-eGFP reporter system plasmids. The system contains mCherry and eGFP fluorescent elements, loxp-encapsulated puromycin elements and 3xFlag elements. Cell sequencing results show that the mCherry fluorescent reporter system was successfully inserted into the end of the PDX1 gene coding region, and the eGFP fluorescent reporter system was successfully inserted into the end of the SOX9 gene coding region; (B) H1 PDX1-mCherry；SOX9-eGFP The karyotype of the dual fluorescence reporter cell line is consistent with that of wild-type WT human embryonic stem cells, both of which have 46 chromosomes and 23 pairs of chromosomes.

[0051] 2. Different Matrigel and Different Human Embryonic Stem Cell Lines for Pancreatic Differentiation

[0052] According to the in vitro pancreatic directed differentiation process, human embryonic stem cells were differentiated into pancreatic progenitor cells. The differentiation process took about 12 days in total, including the definitive endoderm stage, primitive gut stage, posterior foregut stage and pancreatic progenitor cell stage ( Figure 2 A). First, human embryonic stem cells labeled with double fluorescence were placed on Vitronectin for incubation until the number of cells was sufficient, and then the stage 1 medium was directly added to induce differentiation. The results showed that the differentiation efficiency was low. However, when a sufficient number of cells were transferred from Vitronectin to Matrigel and cultured for 6.5 hours, differentiation began immediately. By comparison, it was found that the expression levels of SOX9 and PDX1 after transfer were significantly higher than those without transfer ( Figure 2B), indicating that Matrigel matrix gel is more conducive to the in vitro differentiation of pancreatic progenitor cells. At the same time, H1 and H9 human embryonic stem cells were subjected to in vitro pancreatic directed differentiation, and it was found that H1 cells had better differentiation results, indicating that H1 cells have better pancreatic in vitro differentiation efficiency than H9 cells ( Figure 2 C). H1 human embryonic stem cells were donated by Danwei Huangfu's laboratory, and H9 human embryonic stem cells were donated by the Stem Cell Bank of Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences.

[0053] Figure 2 Schematic diagram of in vitro differentiation of human pancreatic progenitor cells and the results of differentiation of different matrix gels and different human embryonic stem cells. (A) Flow chart of in vitro differentiation of human embryonic stem cells. After incubating human embryonic stem cells in stage 1 medium for 4 days, they are incubated in stage 2 medium for 2 days, then treated with stage 3 medium for 2 days, and finally treated with stage 4 medium for 4 days to reach the pancreatic progenitor cell stage. progenitor, pancreatic progenitor cell; (B) The results of in vitro pancreatic progenitor cell differentiation on Matrigel and Vitronectin matrix gel, PDX1 / SOX9 is the marker gene of pancreatic progenitor cell stage, and the expression level is standardized by GAPDH gene expression. The results of three independent biological repetitions showed that the quality of pancreatic progenitor cells differentiated on Matrigel was significantly higher than that cultured on Vitronectin, ***P<0.001, ****P<0.0001; (C) The results of in vitro pancreatic progenitor cell differentiation of H1 and H9 human embryonic stem cells, the expression level is standardized by GAPDH gene expression, and the results of three independent biological repetitions showed that the differentiation quality of H1 human embryonic stem cells was significantly higher than that of H9 human embryonic stem cells, ***P<0.001, ****P<0.0001.

[0054] 3.H1 PDX1-mCherry；SOX9-eGFP Dual fluorescence reporter cell differentiation ability detection

[0055] The quality of dual fluorescence reporter cells can be evaluated by detecting the marker genes specific to the three nodes: pluripotency stage, definitive endoderm stage, and pancreatic precursor cells. The expression of specific marker genes at each differentiation stage was detected by fluorescence quantitative qPCR. It was found that the dual fluorescence system cell line can accurately activate the expression of specific markers at each stage after differentiation: in the pluripotency period, the dual fluorescence reporter cell line is consistent with the wild-type cells, and both normally express the pluripotency genes OCT4 and SOX2; when differentiated to the definitive endoderm, the expression of SOX17 and FOXA2 is not affected; mCherry and eGFP are only activated and co-expressed in the pancreatic precursor cell stage, which is consistent with the expression characteristics of the endogenous PDX1 and SOX9 genes marked by them. The above shows that the dual fluorescence reporter cell line has normal differentiation ability ( Figure 3 ).

[0056] Figure 3 For H1 PDX1-mCherry；SOX9-eGFP qPCR analysis results of cell lines at different stages of in vitro differentiation

[0057] OCT4 / SOX2 is a pluripotency marker gene, SOX17 / FOXA2 is a definitive endoderm marker gene, PDX1 / SOX9 is a pancreatic precursor cell stage marker gene, mCherry / eGFP is a fluorescent protein gene, WT is the wild-type group, PS#147, PS#165 and PS#166 represent three established dual-fluorescence reporter cell lines, and the expression levels are standardized based on GAPDH gene expression. All experiments contain three independent biological replicates.

[0058] 4. Purified dual fluorescent reporter cell line differentiated pancreatic progenitor cells contain all lineages

[0059] In addition to the transcriptome results, the dual fluorescence reporter cell line was differentiated into pancreatic progenitor cells. Fluorescence microscopy and flow cytometry analysis revealed that the expression activation of eGFP and mCherry could be tracked simultaneously in the differentiated pancreatic progenitor cells. The cells with dual positive expression of eGFP and mCherry accounted for about 75% of the differentiated cells ( Figure 4 AB), which indirectly verified that most of the cells differentiated in vitro for 12 days were double positive for SOX9 and PDX1. Double positive and double negative cells were sorted out using eGFP and mCherry to detect the expression of each lineage, and it was found that the purified double positive cells highly expressed the marker genes of the ductal lineage (KRT13+), acinar cell lineage (GP2+) and endocrine lineage (PAX6+).

[0060] Figure 4 For H1 PDX1-mCherry；SOX9-eGFP Dual fluorescence reporter cell lineage differentiation results, (A) H1 PDX1 -mCherry；SOX9-eGFPFluorescence expression of the dual reporter system during differentiation to pancreatic progenitor cells; (B) H1 PDX1-mCherry；SOX9-eGFP Flow cytometry analysis results of cells differentiated to pancreatic progenitor stage; (C) Expression of genes of each lineage in dual fluorescent reporter cells, KRT13 is a ductal lineage marker gene, GP2 is an acinar cell marker gene, and PAX6 is an endocrine lineage marker gene. The expression levels were normalized based on GAPDH gene expression. All experiments contained three independent biological replicates.

[0061] The above results indicate that we have obtained a method to purify purer and more extensive pancreatic progenitor cells through dual-gene dual-fluorescence of SOX9 and PDX1.

[0062] The above is only a preferred embodiment of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and modifications without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for tracking and purifying pancreatic progenitor cells using SOX9 / PDX1 dual reporter genes, characterized in that: The steps include: 1) Insert the fluorescent gene mCherry and eGFP elements into the end of the coding region of the human PDX1 gene and SOX9 gene, before the stop codon, design a deletable selection marker gene puromycin containing a loxp site after the fluorescent gene eGFP and mCherry elements, and design a 3XFlag tag before the fluorescent gene eGFP and mCherry elements; 2) The fluorescent reporter plasmid was transferred into the human embryonic stem cell line, which was first cultured in Vitronectin matrix gel and then transferred to Matrigel matrix gel for culture; 3) differentiating the transferred cells into definitive endoderm cells, primitive gut tube cells, posterior foregut cells and pancreatic progenitor cells in sequence; 4) Purification of dual-fluorescent pancreatic progenitor cells with the potential to differentiate into ductal cells, acinar cells, and endocrine cells.

2. The method for tracking and purifying pancreatic precursor cells using the SOX9 / PDX1 dual reporter gene according to claim 1, characterized in that: The sgRNA recognition sequences corresponding to the insertion sites at the ends of the coding regions of the SOX9 and PDX1 genes are: PDX1-sgRNA1: CAGAGGGCCTAGGAGGACCC, PDX1-sgRNA2: AGGGCGGGTGGTCCACGCCC, SOX9-sgRNA1: CTTGAGGAGGCCTCCCACGA, SOX9-sgRNA2: CGGCCATCTTCGCCCTTCGT.

3. The method for tracking and purifying pancreatic precursor cells using SOX9 / PDX1 dual reporter genes according to claim 2, characterized in that: The recognition sequence was installed on the pSpCas9(BB)-2A-GFP (PX458) plasmid.

4. The method for tracking and purifying pancreatic precursor cells using SOX9 / PDX1 dual reporter genes according to claim 3, characterized in that: The PDX1 fluorescent reporter plasmid, PDX1-sgRNA1 plasmid and PDX1-sgRNA2 plasmid were mixed and transferred into human embryonic stem cells by electroporation. The cells in which the sgRNA plasmid transiently expressed GFP were selected by flow cytometry. The drug-resistant positive monoclonal clones were selected after treatment with puromycin. The monoclonal clones that were accurately inserted into the terminal position of the gene coding region and fully inserted were selected by PCR and sequencing. The SOX9 fluorescent reporter plasmid, SOX9-sgRNA1 plasmid and SOX9-sgRNA2 plasmid were transferred into the PDX1-mCherry cells to obtain SOX9-eGFP positive clones with correct insertion sites and integrity. The resulting cell line is a dual fluorescent reporter system containing both SOX9-eGFP and PDX1-mCherry.

5. The method for tracking and purifying pancreatic precursor cells using SOX9 / PDX1 dual reporter genes according to claim 1, characterized in that: The left arm of homologous recombination of the SOX9 gene is shown as SEQ ID NO.5, the right arm of homologous recombination of the SOX9 gene is shown as SEQ ID NO.7, the left arm of homologous recombination of the PDX1 gene is shown as SEQ ID NO.6, and the right arm of homologous recombination of the PDX1 gene is shown as SEQ ID NO.

8.

6. The method for tracking and purifying pancreatic precursor cells using SOX9 / PDX1 dual reporter genes according to claim 1, characterized in that: The eGFP element sequence is shown in SEQ ID NO.9, and the mCherry element sequence is shown in SEQ ID NO.

10.

7. The method for tracking and purifying pancreatic precursor cells using SOX9 / PDX1 dual reporter genes according to claim 1, characterized in that: In the step (2), the cells are first cultured on Vitronectin matrix gel using serum-free culture medium, and passaged every 3-4 days, during which 10uM Y27632 inhibitor is added; when the number of cells is sufficient, the digested dual-fluorescence reporter cells are plated on Matrigel matrix gel, and the culture medium is replaced with mTeSR and Y27632, and differentiation experiments can be performed after culture.

8. The method for tracking and purifying pancreatic precursor cells using SOX9 / PDX1 dual reporter genes according to claim 7, characterized in that: The digested dual fluorescence reporter cells were expressed at 1.56×10 4 / cm 2 The cells were plated on Matrigel at a density of 100 μg / ml and cultured for 6.5 h before the differentiation experiment.

9. The method for tracking and purifying pancreatic precursor cells using SOX9 / PDX1 dual reporter genes according to claim 1, characterized in that: The human embryonic stem cell line is the H1 human embryonic stem cell line.

Images