Molecular marker, method, primer pair, kit for identifying seed size trait of c. moschata and application thereof
By developing InDel molecular markers closely linked to the seed size of thin-skinned melons and using PCR amplification and electrophoresis detection technology, molecular marker identification of thin-skinned melon seed size in the seedling stage was achieved, which solved the problem of rapid and accurate identification of seed size and improved breeding efficiency and accuracy.
Patent Information
- Application Number
- CN202411691341.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-25
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2044-11-25
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify the seed size of thin-skinned melons, affecting breeding efficiency and accuracy.
Develop InDel molecular markers that are closely linked to the seed size of thin-skinned melons. Use PCR amplification technology combined with polyacrylamide gel electrophoresis detection to design primer pairs and provide kits to achieve molecular marker-assisted identification of seed size in the seedling stage.
The breeding accuracy and efficiency of thin-skinned melon seed size were improved, the breeding process was simplified, and the breeding time was shortened.
Smart Images

Figure CN119320842B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and in particular relates to molecular markers, methods, primer pairs, kits and applications thereof for identifying the size traits of thin-skinned melon seeds. Background Art
[0002] melon( Cucumis melo Muskmelon L. is an annual climbing herbaceous plant of the genus Cucurbitaceae, widely cultivated in my country and around the world, and is an important economic crop worldwide. Morphological indicators of melon seeds include seed shape, size, and smoothness. Seed size (primarily referring to seed length and width) is an important factor influencing yield formation, stress resistance, and fruit quality. Larger seeds generally store more nutrients and endogenous hormones, which is beneficial for seed germination and seedling growth, forming strong plants, and thus improving fruit quality and yield. Small seeds, due to their small size and light weight, have more advantages in reproduction and natural dispersal. The rich variation in melon seed size is the result of both natural and artificial selection. Identifying the key major effect loci for petal size in thin-skinned melons and applying them to germplasm resource screening and molecular breeding processes is of great significance.
[0003] InDel molecular markers are polymorphic markers formed by base deletions and insertions in chromosomal sequences. These markers are widely distributed across the genome, are easy to use, yield easily observable results, and are universally applicable across different germplasm resources of the same species. Therefore, discovering InDel molecular markers that can be used to identify seed size traits in thin-skinned melons and applying them to melon germplasm screening and molecular breeding is of great significance. Summary of the Invention
[0004] The purpose of the present invention is to apply molecular markers to the screening and gene aggregation of muskmelon germplasm resources with different seed sizes, obtain chromosome segments and molecular markers that are closely linked to the seed size of muskmelon, and then more quickly and accurately identify the seed size of muskmelon in the seedling stage.
[0005] The present invention provides a molecular marker for identifying the seed size trait of thin-skinned melon. The molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2.
[0006] The present invention provides a primer pair for amplifying and identifying molecular markers for the size trait of thin-skinned melon seeds. The sequences of the primer pair are shown as SEQ ID NO.3 and SEQ ID NO.4.
[0007] The invention provides a kit for identifying the size trait of muskmelon seeds. The kit comprises the above primer pair.
[0008] The application provides application of the molecular marker, the primer pair or the kit in identification of the seed size trait of the muskmelon.
[0009] The application provides application of the molecular marker, the primer pair or the kit in identification, assisted breeding and screening of the seed size trait of the muskmelon.
[0010] Further limitation, the seed length range of the large seed trait is 8.16 mm-5.20 mm, the seed width range is 3.64 mm-2.65 mm, the seed length range of the small seed trait is 4.76 mm-3.15 mm, and the seed width range is 2.06 mm-1.72 mm.
[0011] The application provides a method for identifying the seed size trait of the muskmelon, and the method is as follows:
[0012] Step 1: extracting the genomic DNA of the muskmelon to be detected;
[0013] Step 2: taking the DNA obtained in step 1 as a template, performing PCR amplification by using the primer pair, and obtaining a PCR product to determine the seed size trait of the muskmelon.
[0014] Further limitation, the seed length range of the large seed trait is 8.16 mm-5.20 mm, the seed width range is 3.64 mm-2.65 mm, the seed length range of the small seed trait is 4.76 mm-3.15 mm, and the seed width range is 2.06 mm-1.72 mm.
[0015] Further limitation, if the amplification product contains a 194 bp fragment, it is determined as the large seed type; if the amplification product contains a 184 bp fragment, it is determined as the small seed type.
[0016] Further limitation, the seed length range of the large seed trait is 8.16 mm-5.20 mm, the seed width range is 3.64 mm-2.65 mm, the seed length range of the small seed trait is 4.76 mm-3.15 mm, and the seed width range is 2.06 mm-1.72 mm.
[0017] Beneficial effects: In the early stage of the application, a genetic population was constructed with large seeds (cultivated species of C. melo) and small seeds (wild species of C. melo) as parents, and a chromosome segment closely linked to the seed size trait of C. melo was obtained by using genome resequencing and BSA-seq (Bulked Segregation Analysis) technology. Through one-year two-season phenotypic identification and QTL (Quantitative Trait Loci) analysis in the genetic population, a stable major effective positioning interval was obtained, which was named Cmss2.1. An InDel molecular marker was developed in the major effective chromosome segment, which was located in the Cmss2.1 positioning interval of the key site of the seed size trait of C. melo. A common interval of about 1.43 Mb was obtained in spring and autumn, which was closely linked to the seed size (seed length and seed width) trait. Through the method of molecular marker assisted selection, the seed size of C. melo can be selected by extracting the genomic DNA of the sample to be tested at the seedling stage of C. melo, which improves the accuracy and efficiency of breeding. The molecular marker can be applied to the molecular breeding of C. melo, and provides an efficient molecular breeding tool for the molecular identification of the seed size of C. melo.
[0018] The application utilizes the primer pair designed by the molecular marker closely linked to the seed size trait of C. melo developed and obtained by parent resequencing data. Due to the polymorphism of short sequence insertion and deletion of the molecular marker fragment in different C. melo materials, the genomic DNA of C. melo seedlings is amplified by the obtained primer pair, and the size of the PCR product is detected by polyacrylamide gel electrophoresis, so that the seed size of C. melo can be identified at the seedling stage. The identification method can realize the identification of the seed size of C. melo by extracting the genomic DNA of the sample to be tested at the seedling stage, which is simple to operate, high in accuracy and efficiency, and provides an effective breeding tool and technology for the molecular marker assisted selection breeding of the seed size of C. melo. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 For the major effective site of the seed size of C. melo in Example 1 Cmss2.1 The positioning results in spring and autumn; Fig. A is the result in spring; Fig. B is the result in autumn;
[0020] Figure 2 For the result of polyacrylamide gel electrophoresis detection of the amplification product obtained by PCR amplification of the large seed and small seed materials in the natural population using the primer pair described in Example 2. DETAILED DESCRIPTION
[0021] The application is further described in detail below in connection with specific embodiments and drawings. The process, conditions, experimental methods and reagents used in the implementation of the application are generally known in the art and are commercially available, unless otherwise specified. The application is not particularly limited.
[0022] The method for extracting genomic DNA is as follows:
[0023] The method for extracting genomic DNA is based on the method of Murray et al. (1980) (Murray M., Thompson W. F., Rapid isolation of high molecular weight plant DNA [J]. Nucl. Acid. Res., 1980, 8: 668-673.) and is improved thereon.
[0024] The specific steps are as follows:
[0025] ① After the collected young true leaves are washed with sterile water and dried, 0.2 g of the leaves are placed in a 1.5 mL centrifuge tube, liquid nitrogen is added for grinding to white powder, 800 μL of 65℃ preheated 2% CTAB solution (2% CTAB, 100 mmol / L Tris-HCl pH=8.0, 1.4 mol / L NaCl, 20 mmol / L EDTA pH=8.0, 2% β-mercaptoethanol) is added, and the mixture is thoroughly mixed and incubated at 65℃ for 1 h, with gentle shaking every 10 min.
[0026] ② The centrifuge tube is taken out and cooled to room temperature, and centrifuged at 13000 rpm for 10 min. The supernatant is aspirated and placed in a new centrifuge tube to prevent mechanical shear force from damaging the DNA. The tip of the gun used for transfer is removed with scissors in advance to enlarge the liquid suction port.
[0027] ③ 750 μL of chloroform:isopropyl alcohol (24:1, V / V) solution is added to the wall of the centrifuge tube, and the mixture is thoroughly mixed and incubated for 10 min, and then centrifuged at 13000 rpm for 10 min.
[0028] ④ The centrifuge tube is taken out and the same treatment method as above is used to aspirate 700 μL of the supernatant from the wall of the centrifuge tube with a gun and place it in a new centrifuge tube.
[0029] ⑤ 700 μL of chloroform:isopropyl alcohol (24:1, V / V) solution is added to the wall of the centrifuge tube, and the mixture is gently shaken to mix thoroughly, and then incubated for 10 min, and then centrifuged at 13000 rpm for 10 min.
[0030] (6) Wall suction 650 μL supernatant into a new tube, add 2 μL RNase (10 mg / mL) mixed, placed in 37℃ water bath for 2 h.
[0031] (7) Wall suction 650 μL chloroform: isopropyl alcohol (24:1, V / V) solution, mix well, after 10 min at 13000 rpm centrifugation for 10 min.
[0032] (8) Wall suction 550 μL supernatant into a new tube, add 550 μL isopropanol pre-cooled at -20℃ (wall suction), tightly cover the centrifuge tube cover, upside down several times after placed in -20℃ refrigerator for 60 min.
[0033] (9) Take out the centrifuge tube, in the centrifuge at 13000 rpm for 10 min, carefully discard the supernatant, keep the precipitate at the bottom of the centrifuge tube.
[0034] (10) The precipitate was washed with pre-cooled 70% ethanol three times, and the centrifuge tube was placed in a clean bench, and the sterile wind was dried, and 200 μL ddH2O was added to dissolve, and stored at -20℃ for standby.
[0035] Example 1: A molecular marker closely linked to the size of the seed of C. pepo and its obtaining method
[0036] The present embodiment provides a key gene linkage site of the seed size trait of C. pepo, an InDel marker, and an obtaining method of the marker.
[0037] (1) Selection of test materials:
[0038] The test materials include maternal, paternal, F1 and F2 populations;
[0039] The paternal material is m1-15, a cultivated species of C. pepo, with a seed length of 6.92±0.39 mm and a seed width of 2.98±0.22 mm;
[0040] The maternal material is 1190wd, a wild C. pepo, with a seed length of 3.02±0.16 mm and a seed width of 1.53±0.09 mm;
[0041] Both the female and male parents are disclosed in Liu Shi, Gao Peng, Zhu Qianglong, Zhu Zicheng, Liu Hongyu, Wang Xuezheng, Weng Yiqun, Gao Meiling and Luan Feishi*. Resequencing of 297 melon accessions reveals the genomic history of improvement and loci related to fruit traits in melon. 2020, 18, 2545-2558, Plant Biotechnology Journal.
[0042] The F1 generation is obtained by crossing the above two materials as parents;
[0043] The F2 generation population is obtained by selfing the F1 generation, and 650 and 153 F2 generation populations are sowed in spring and autumn of 2023, respectively.
[0044] (2) Seed size phenotype identification of test materials: collect seeds from mature fruits, dry them, and then select 20 full seeds from each fruit. Use a vernier caliper to measure the length and width of the seeds;
[0045] According to the investigation results of this step, the length of F1 generation seeds is 3.75±0.12 mm, and the width of F1 generation seeds is 1.88±0.11 mm, which is between the two parents. The length and width of the seeds in the F2 generation show a normal distribution, indicating that the seed size of melon is a quantitative trait inheritance.
[0046] (3) Using BSA-seq and genetic linkage analysis methods, the chromosome segment closely linked to the thin-skinned melon seed size trait is obtained:
[0047] In F2 generation, 50 single plants of large seeds (seed length range: 5.00-6.30 mm) and 50 single plants of small seeds (seed length range: 2.36-3.38 mm) were selected, the DNA of each single plant was extracted, the DNA concentration was adjusted to be consistent, then the DNA was mixed in equal amounts to construct a thin-skinned melon seed size gene pool, and BSA-seq analysis was carried out; according to the analysis results combined with the resequencing data of the two parent genomes, InDel molecular markers were developed in the chromosome segment of the BSA-seq analysis results, genetic linkage analysis was carried out on the F2 generation population in spring and autumn of 2023, and finally the key major locus of the thin-skinned melon seed size trait was located on chromosome 2 of the melon genome, the common interval in spring and autumn was about 978.5 Kb (chromosome physical position: 1339914 bp-2758915 bp), which was named Cmss2.1 , Figure 1 thin-skinned melon seed size major locus Cmss2.1 Preliminary positioning results.
[0048] (4) Development of candidate InDel markers:
[0049] According to the resequencing data of the two parents, InDel molecular markers were developed, genotyping was carried out on each single plant in the natural population, and the genotype and phenotype were combined to judge the coincidence degree. The results showed that there was an InDel site change in the segment which was closely linked to the seed size trait.
[0050] Further, the application obtained Chr02-884280 molecular markers, Chr02-884280 the molecular marker is a 194 bp nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO. 1 and a 184 bp nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO. 2; the SEQ ID NO. 1 is closely linked to the large seed trait, and the SEQ ID NO. 2 is closely linked to the small seed trait.
[0051] In the application, the seed length range of the large seed trait is 8.16 mm-5.20 mm, the seed width range is 3.64 mm-2.65 mm, the seed length range of the small seed trait is 4.76 mm-3.15 mm, and the seed width range is 2.06 mm-1.72 mm.
[0052] SEQ ID NO. 1:
[0053] TATTTAGGATGATTGAGGCACTGAGTTGGTTATTATAATTTGTGTCTTTCATATATATATTATAATGATATATACTATAATAGATCAATTTTAGAAGTGGTTTAATTTGGGTATTGCTAAGGTGGGACCTCTCCTT[A]ATAAAATTTGATATGGTTTGAGAAT GAACTAAGGCAGAAATTATTGG
[0054] SEQ ID NO. 2:
[0055] TATTTAGGATGATTGAGGCACT GAGTTGGTTATTATAATTTGTGTCTTTCATATATATATTATAATGATATATACTATAATAGATCAATTTTAGAAGTGGTTTAATTTGGGTATTGCTAAGGTGGGACCTCTCCTT[A]ATAAAATTTGATATGGTTTGAGAAT GAACTAAGGCAGAAATTATTGG
[0056] Example 2: Acquisition of primer pair for identifying the seed size trait of C. melo var. inermis
[0057] According to the resequencing data of the parents, the molecular marker closely linked to the seed size trait of C. melo var. inermis was developed Chr02- 884280 The primer pair for amplifying the molecular marker was designed, specifically, the upstream primer with the nucleotide sequence as shown in SEQ ID NO. 3 and the downstream primer with the nucleotide sequence as shown in SEQ ID NO. 4 were obtained in the preliminary positioning interval of Example 1, according to the InDel differences existing in the sequencing data of the two parents.
[0058] The sequence of the upstream primer is Chr02-884280-F (SEQ ID NO. 3): 5'-TATTTAGGATGATTGAGGCACT-3';
[0059] The sequence of the downstream primer is Chr02-884280-R (SEQ ID NO. 4): 5'-CCAATAATTTCTGCCTTAGTTC-3'.
[0060] Example 3: A method for identifying the seed size trait of C. melo var. inermis
[0061] The method for identifying the seed size trait of C. melo var. inermis specifically comprises the following steps:
[0062] (1) Extracting the genomic DNA of the leaves or other tissues of the C. melo var. inermis sample to be tested.
[0063] The identification method of the present application can use melon seedlings at different stages as materials, and the best period for not affecting subsequent growth is the leaf of the melon seedling stage (two-leaf-one-heart stage) for extracting DNA.
[0064] (2) The primer pair obtained in Example 2 is used for PCR amplification of the genomic DNA of different samples, and the amplification product is obtained, and the amplification product is detected by polyacrylamide gel electrophoresis, if the amplification product contains a 194 bp fragment, it is determined as large seed type; if the amplification product contains a 184 bp fragment, it is determined as small seed type. Chr02-884280
[0065] The seed length of the large seed trait is in the range of 8.16 mm-5.20 mm, and the seed width is in the range of 3.64 mm-2.65 mm, the seed length of the small seed trait is in the range of 4.76 mm-3.15 mm, and the seed width is in the range of 2.06 mm-1.72 mm.
[0066] The PCR reaction system is as follows: 1 μL of each of the upstream and downstream primers (the primer concentration is 2 pM), 2 μL of DNA template (the concentration is 30 ng / μL), 1 μL of 10×PCR Buffer (containing Mg 2+ 15 mM), 0.15 μL of dNTP (the concentration is 10 mM), 0.1 μL of Taq enzyme (5 U / μL), and 6.75 μL of sterile deionized water.
[0067] The PCR reaction program is as follows: 94℃ pre-denaturation for 7 min, 94℃ denaturation for 30 s, 53℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles, 72℃ extension for 10 min, and 4℃ storage.
[0068] The PCR product detection method is as follows: 2 µL of PCR product is taken, 2 µL of Loading Buffer is added, mixed, and then spotted into a polyacrylamide gel, electrophoresis is performed at 220V / 400 mA, and the electrophoresis time is 50-60 min.
[0069] The identification method of the present application can be used to determine the seed size trait of the melon seedling at the seedling stage, and the sampling time is about the two-leaf-one-heart stage; and the conventional breeding needs to be performed after the fruit is mature, and the seed size is determined, and the identification method of the present application can effectively shorten the breeding time and accelerate the breeding speed.
[0070] Example 4: Screening of seed size of melon natural population using the primer pair obtained in Example 2
[0071] To determine the accuracy of the molecular marker obtained in Example 1, the primer pair obtained in Example 2, and the identification method obtained in Example 3 in identifying the seed size of C. melo, samples of C. melo natural population were selected, and the seed size of each sample was identified according to the identification method described in Example 3. At the fruit ripening stage, the field phenotype data of seed size, including seed length and seed width, were determined.
[0072] In this example, the genomic DNA of each single plant in the paternal parent, maternal parent, F1 generation and natural population in Example 1 was extracted, and the genomic DNA of the above samples was subjected to PCR amplification using the primer pair obtained in Example 2, to obtain PCR products. The PCR products were detected by polyacrylamide gel electrophoresis, and the results are shown in Figure 2 .
[0073] The natural population materials are shown in lanes 4-19 of Figure 2 The natural population materials are disclosed in the following article:
[0074] Liu Shi, Gao Peng, Zhu Qianglong, Zhu Zicheng, Liu Hongyu, Wang Xuezheng, Weng Yiqun, Gao Meiling and Luan Feishi*. Resequencing of 297 melon accessions reveals the genomic history of improvement and loci related to fruit traits in melon. 2020, 18, 2545-2558, Plant Biotechnology Journal.
[0075] As Figure 2As shown, the PCR product detection result of the maternal parent (P1) showed a fragment of 184 bp, and the enzyme digestion result of the paternal parent (P2) showed a fragment of 194 bp, indicating that the maternal parent was small-seeded and the paternal parent was large-seeded, which was consistent with the seed size measurement result of the paternal and maternal parents in Example 1. The PCR product detection result of the natural population in lanes 4-11 showed a fragment of 194 bp, and the PCR product detection result of the natural population in lanes 12-19 showed a fragment of 184 bp, indicating that the natural population in lanes 4-11 had large-seeded traits, and the natural population in lanes 12-19 had small-seeded traits. According to the actual measurement of the seed size of the natural population, it was found that the seed length variation range of the natural population in lanes 4-11 was 8.16 mm-5.20 mm, and the seed width variation range was 3.64 mm-2.65 mm. The seed length variation range of the natural population in lanes 12-19 was 4.76 mm-3.15 mm, and the seed width variation range was 2.06 mm-1.72 mm. Therefore, the seed size traits of C. pepo determined according to the electrophoresis result of the PCR product (marker genotyping result) were highly consistent with the actual seed size of each melon variety, and the genotype and phenotype were completely consistent, and the molecular marker identification result was 100% consistent with the actual seed size traits. Further, it was proved that the molecular marker provided in Example 1, the primer pair provided in Example 2, and the method for identifying the seed size traits of C. pepo provided in Example 3 were feasible and accurate, and could be applied to the seed size molecular marker identification of C. pepo at the seedling stage.
[0076] Example 5: A kit for identifying the seed size traits of C. pepo
[0077] A kit for identifying the seed size traits of C. pepo comprises the following reagents:
[0078] Chr02-884280-F and Chr02-884280-R described in Example 2 (both at a concentration of 2 pM), 10x PCR Buffer (containing Mg 2+ 15 mM), dNTP (at a concentration of 10 mM), Taq enzyme (5 U / μL), sterile deionized water.
[0079] Example 6: A method for using a kit for identifying the seed size traits of C. pepo
[0080] (1) Extract the genomic DNA of the C. pepo to be tested, and adjust the concentration of the genomic DNA to 30 ng / μL.
[0081] (2) Add the sample and reagents according to the following PCR system:
[0082] DNA template 2 μL;
[0083] Chr02-884280-F 1 muL (concentration 2 pM);
[0084] Chr02-884280-R 1 muL (concentration 2 pM);
[0085] 10x PCR Buffer (containing Mg 2+ 15 mM) 1 muL;
[0086] dNTP (concentration 10 mM) 0.15 muL;
[0087] Taq enzyme (5 U / muL) 0.1 muL;
[0088] Sterile deionized water 6.75 muL.
[0089] (3) PCR amplification is carried out, and the reaction procedure of the PCR amplification is as follows: 94 DEG C pre-denaturation for 7 min, 94 DEG C denaturation for 30 s, 53 DEG C annealing for 30 s, 72 DEG C extension for 30 s, 30 cycles, 72 DEG C extension for 10 min, and 4 DEG C preservation.
[0090] (4) The PCR product is detected by polyacrylamide gel electrophoresis, and the size of the melon petal is judged by the detection result, and specifically: if the amplification product is a 194 bp fragment, it is determined to be a large seed trait; if the amplification product is a 184 bp fragment, it is determined to be a small seed trait. The identification result is matched with the following range, the length of the seed of the large seed trait is 8.16 mm-5.20 mm, the width of the seed is 3.64 mm-2.65 mm, the length of the seed of the small seed trait is 4.76 mm-3.15 mm, and the width of the seed is 2.06 mm-1.72 mm.
[0091] Although the present application has been disclosed with the preferred embodiments as above, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, therefore, the protection scope of the present application should be defined by the claims.
Claims
1. A molecular marker for identifying the size trait of muskmelon seeds, characterized in that: The molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2; SEQ ID NO.1 is closely linked to the large seed trait, and SEQ ID NO.2 is closely linked to the small seed trait.
2. A primer pair for amplifying a molecular marker for identifying the size trait of muskmelon seeds, characterized in that: The sequences of the primer pair are shown in SEQ ID NO.3 and SEQ ID NO.
4.
3. A kit for identifying the size characteristics of thin-skinned melon seeds, characterized in that: The kit comprises the primer pair according to claim 2.
4. Use of a reagent for detecting the molecular marker of claim 1 in identifying the size traits of muskmelon seeds, characterized in that: SEQ ID NO. 1 is tightly linked to the large seed trait, and SEQ ID NO. 2 is tightly linked to the small seed trait.
5. Use of the primer pair according to claim 2 or the kit according to claim 3 in identifying the size traits of muskmelon seeds, characterized in that: Extract the genomic DNA of the thin-skinned melon to be tested as a template, use the primer pair described in claim 2 to perform PCR amplification, and obtain a PCR product to determine the seed size trait of the thin-skinned melon; if the amplified product in step 2 contains a 194 bp fragment, it is determined to be a large seed type; if the amplified product contains a 184 bp fragment, it is determined to be a small seed type.
6. Use of a reagent for detecting the molecular marker of claim 1 in assisting identification, assisting breeding, and screening of muskmelon seed size traits, characterized in that: SEQ ID NO. 1 is tightly linked to the large seed trait, and SEQ ID NO. 2 is tightly linked to the small seed trait.
7. Use of the primer pair according to claim 2 or the kit according to claim 3 in assisting identification, assisting breeding and screening of muskmelon seed size traits, characterized in that: Extract the genomic DNA of the thin-skinned melon to be tested as a template, use the primer pair described in claim 2 to perform PCR amplification, and obtain a PCR product to determine the seed size trait of the thin-skinned melon; if the amplified product in step 2 contains a 194 bp fragment, it is determined to be a large seed type; if the amplified product contains a 184 bp fragment, it is determined to be a small seed type.
8. The use according to any one of claims 4 to 7, characterized in that: The seed length of the large seed trait ranges from 8.16 mm to 5.20 mm, and the seed width ranges from 3.64 mm to 2.65 mm. The seed length of the small seed trait ranges from 4.76 mm to 3.15 mm, and the seed width ranges from 2.06 mm to 1.72 mm.
9. A method for identifying the size characteristics of muskmelon seeds, characterized in that: The method described is as follows: Step 1: Extract genomic DNA of the thin-skinned melon to be tested; Step 2: Using the DNA obtained in step 1 as a template, PCR amplification is performed using the primer pair described in claim 2 to obtain a PCR product to determine the size characteristics of the thin-skinned melon seeds; if the amplified product in step 2 contains a 194 bp fragment, it is determined to be a large seed type; if the amplified product contains a 184 bp fragment, it is determined to be a small seed type.
10. The method according to claim 9, characterized in that The PCR reaction system in step 2 is as follows: 1 μL of upstream and downstream primers, 2 pM primer concentration, 2 μL of DNA template, 30 ng / μL DNA template concentration, 1 μL of 10× PCR Buffer, 0.15 μL of dNTPs, 10 mM dNTP concentration, 0.1 μL of Taq enzyme, 5 U / μL Taq enzyme concentration, and 6.75 μL of sterile deionized water; the PCR reaction program is as follows: pre-denaturation at 94°C for 7 min; 30 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 30 s, and extension at 72°C for 30 s; extension at 72°C for 10 min, and storage at 4°C.
11. The method according to claim 9, characterized in that The seed length of the large seed trait ranges from 8.16 mm to 5.20 mm, and the seed width ranges from 3.64 mm to 2.65 mm. The seed length of the small seed trait ranges from 4.76 mm to 3.15 mm, and the seed width ranges from 2.06 mm to 1.72 mm.
Citation Information
Patent Citations
InDel molecular marker for identifying seed purity of muskmelon Niuhuahua variety and application of InDel molecular marker
CN112662798A
SNP (Single Nucleotide Polymorphism) marker co-segregated with melon seed size character and application thereof
CN115852031A