Preparation and application of pseudorabies virus circular RNA (Ribonucleic Acid) molecule

Abstract

The invention discloses preparation and application of pseudorabies virus circular RNA (Ribonucleic Acid). The circular RNA comprises a coding element for coding any one of gD protein, gB protein, gC protein and gK protein of the pseudorabies virus; preferably, the coding element encodes a pseudorabies virus gD protein. Further, the encoding element encodes gD wild-type protein, gD truncated protein, gD mutant protein and gD truncated mutant protein; preferred coding elements encode gD truncated plus muteins. Further, the encoding element encodes an optimized nucleotide sequence of pseudorabies virus gD truncated and mutant protein. Further, the circular RNA comprises an optimized translation initiation element. Researches show that the circular RNA provided by the invention can induce protein expression in an animal body, generate a high-level neutralizing antibody and successfully activate T cell immunity, especially CD8 + T cell immune response, and a basis is provided for preparing a circular mRNA vaccine for preventing and / or treating pseudorabies.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to the preparation and application of a pseudorabies virus circular RNA molecule, and specifically relates to the preparation and application of a pseudorabies virus envelope glycoprotein circular RNA; comprising a circular RNA encoding a pseudorabies virus gD truncated and mutant protein sequence, a linear RNA, a recombinant plasmid, a recombinant Escherichia coli engineering bacterium, and a preparation method and application of the circular RNA. Background Art

[0002] Pseudorabies is an acute, virulent infectious disease caused by pseudorabies virus (PRV) that seriously harms the pig breeding industry. The main clinical symptoms are pruritus, high fever, reproductive disorders and encephalomyelitis. The virus can lurk in the trigeminal ganglion or sacral ganglion to cause latent infection, making sick pigs carry the virus for a long time and difficult to eradicate. In my country, at present, attenuated live vaccines are mainly used to prevent and control PRV. However, due to the stronger pathogenicity of the newly emerged strains, the traditional vaccine has poor protection against the new PRV. In recent years, the number of pseudorabies-positive pig farms in my country has increased significantly. The prevalence of new pseudorabies viruses has brought great challenges to the prevention and control of the disease in my country (doi:10.1007 / s11250-018-1555-1). In addition, my country's prevention and control goal for pseudorabies is "purification and elimination". At this time, vaccination with infectious live vaccines will no longer be applicable. In view of the huge economic losses caused by the new outbreak of pseudorabies to my country's pig industry and the need to purify and eliminate the pseudorabies virus, the development of a new vaccine against PRV is of great significance for the prevention and control and purification of the disease.

[0003] PRV belongs to the α-subfamily of the Herpesviridae family. It is a double-stranded DNA virus with a genome size of about 150kb, at least 75 open reading frames, and is predicted to encode nearly 100 proteins. It is oval or round in shape, with a diameter of about 150 to 300nm. It consists of four layers, from the inside to the outside, the virus core containing the viral genome, the capsid that encapsulates the viral DNA, the membrane composed of functional proteins, and the capsule rich in PRV glycoprotein. At present, the new vaccines for pseudorabies mainly include inactivated vaccines and recombinant subunit vaccines. The inactivated vaccine is mainly made of strains through amplification, inactivation, emulsification and other processes, which plays a certain role in the prevention of pseudorabies disease. However, the traditional inactivated vaccine has a short protection period for animals and poor protection against mutant virus strains. In addition, the inactivated vaccine has high requirements for the production environment and production personnel during the production and preparation process. There is a risk of virus strain leakage and incomplete inactivation during the production and preparation process, so the production cost is relatively high. Another vaccine technology route is the recombinant subunit vaccine for pseudorabies, which is still in the research and development stage. Five glycoproteins (gB, gC, gD, gH, and gI proteins) have been identified on the PRV virus particle envelope. These glycoproteins are usually selected as targets for subunit vaccine research, but no pseudorabies subunit vaccine has been approved worldwide so far. There is still room for breakthroughs in the development of new vaccines for pseudorabies virus.

[0004] mRNA vaccines are vaccines that directly introduce mRNA containing antigenic proteins into the body, so that it is directly translated in the body to complete the expression of the target protein, thereby causing a specific immune response in the body. They have played an important role in the prevention of major respiratory infectious diseases in humans. At present, the mRNA used in clinical or preclinical applications is mainly linear mRNA. The structure of linear mRNA includes 5' cap structure (5'Cap), 3' polyadenosine tail (PolyA tail), 5' untranslational sequence (5'untranslational region, 5'UTR), 3' untranslational sequence (3'untranslational region, 3'UTR) and open reading frame (Open reading frame, ORF). The 5' cap structure is a basic feature of eukaryotic mRNA, which is obtained by adding N7-methylguanosine to the 5' end of mRNA. The 5' cap structure and 3' polyadenosine tail are necessary components of linear RNA, which can effectively prevent mRNA degradation and promote the translation of mRNA into protein. The 5' cap structure promotes mRNA translation by binding to the translation initiation complex eIF4E, and can effectively prevent mRNA degradation and reduce the immunogenicity of mRNA. The main function of the 3' polyadenosine tail is to bind to PolyA binding protein (PABP), which interacts with eIF4G and eIF4E, mediates the formation of mRNA into a ring, promotes the translation process, and prevents mRNA degradation.

[0005] Circular RNA (circRNAs) is a common type of RNA in eukaryotes. Currently, the most efficient technology for constructing circular RNA in vitro is the self-cleavage circular system design technology (patent CN 114574483 A). The design principle of this technology is to connect the exon E1 and E2 sequences end to end through molecular cloning to form a continuous circular plasmid. The intron is cut and broken by restriction endonuclease to obtain a linear plasmid. Then, in vitro transcription is performed through the T7 promoter upstream of the inverted 3' intron to obtain a linear RNA containing a 3' intron-E2-E1-5' intron structure. Similar to the natural class I intron system, the specific conserved sequence of the splicing site of exon E1 is broken by the nucleophilic attack of the free guanosine 3' hydroxyl, and exon E1 produces a naked 3' hydroxyl, while guanosine binds to the broken 5' intron. Afterwards, the exposed 3'hydroxyl group of exon E1 attacks the conserved sequence between the 3'intron and exon E2, excises the 3'intron, and exons E2 and E1 undergo a circularization reaction to obtain a circular E1-E2 RNA. Compared with linear mRNA, circular mRNA molecules often have a longer half-life and better stability, and have important application prospects in protein expression and clinical treatment. In addition, the preparation process of circular RNA designed based on the self-cleaving circularization system is simpler and has lower process costs. After transcription, only circularization is performed, and there is no need to use expensive capping enzymes and tailing enzymes to modify additional 5' cap structures and 3' polyadenosine tail structures, nor is there a need for additional circularization processes using T4 RNA ligase as in traditional circular RNA. In addition, it can avoid the introduction of additional exon sequences in circular RNA, thereby improving the sequence accuracy of circular RNA molecules.

[0006] Currently, circular RNA is mainly used in human protein expression research. So far, there has been no report on the optimized design, preparation and application of pseudorabies virus envelope glycoprotein circular RNA molecules. Summary of the invention

[0007] Problems to be solved by the invention:

[0008] In view of the many problems existing in the existing pseudorabies live and inactivated vaccines in clinical use and the recombinant subunit vaccines under research: for example, the porcine pseudorabies virus live vaccine cannot effectively prevent and control newly emerging strains and is not suitable for virus purification and elimination, the inactivated vaccine has a short protection period for animals, poor protection against mutant virus strains, and high production costs, the recombinant subprotein vaccine has unclear targets and unstable efficacy, low production efficiency, and difficulties in the purification process, and the reported pseudorabies virus linear RNA vaccine cannot activate CD8+ cell immune response and has insufficient immune protection efficacy (doi: 10.1016 / j.vetmic.2020.108886); Provided is the preparation and application of pseudorabies virus envelope glycoprotein circular RNA. The circular RNA contains coding elements encoding optimized pseudorabies virus envelope gD protein and optimized translation initiation elements. When introduced into an animal, it can induce protein expression, produce high levels of neutralizing antibodies, and successfully activate T cell immunity, especially CD8+T cell immune response, thus providing a basis for the preparation of circular mRNA vaccines for preventing and / or treating pseudorabies.

[0009] Solutions used to solve the problem:

[0010] <circular RNA>

[0011] The present invention provides a circular RNA, the circular RNA comprises a coding element, and the coding element encodes a polypeptide comprising a pseudorabies virus envelope protein. Wherein, the porcine pseudorabies virus envelope protein comprises any one of gD protein, gB protein, gC protein, and gK protein; preferably, the coding element encodes the pseudorabies virus envelope protein gD protein. Further, the coding element encodes gD wild-type protein, gD truncated protein, and gD truncated plus mutant protein; preferably, the coding element encodes pseudorabies virus gD truncated plus mutant protein. The circular RNA described in the present invention can be prepared by a traditional PIE system, and can also be prepared by a clean PIE system.

[0012] In some embodiments, the coding element encodes any one of (a) to (d):

[0013] (a) the amino acid sequence of the pseudorabies virus envelope protein gB protein comprises the sequence shown in SEQ ID NO.3, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO.3, and having or partially having the activity of gB protein;

[0014] (b) the amino acid sequence of the pseudorabies virus envelope protein gC protein comprises the sequence shown in SEQ ID NO.5, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO.5 and having or partially having the activity of the gC protein;

[0015] (c) the amino acid sequence of the pseudorabies virus envelope protein gD protein comprises the sequence shown in SEQ ID NO.7, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO.7 and having or partially having the activity of gD protein;

[0016] (d) The amino acid sequence of the pseudorabies virus envelope protein gK protein comprises the sequence shown in SEQ ID NO. 9, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO. 9 and having or partially having gK protein activity.

[0017] As a preferred embodiment, the coding element comprises the pseudorabies virus envelope protein gD protein and has an amino acid sequence as shown in SEQ ID NO.7.

[0018] In some embodiments, the coding element encodes any one of the following: pseudorabies virus envelope gD protein (amino acid sequence number SEQ ID NO.55) N-terminal truncation of 10 amino acids, N-terminal truncation of 21 amino acids, N-terminal truncation of 27 amino acids, N-terminal truncation of 28 amino acids, C-terminal truncation of 5 amino acids, containing mutation V154Y, containing mutation Q187D, containing mutation Q187L, containing mutation C117L, containing mutation R88E, containing mutation V154P, containing mutation V154Y / Q187D, containing mutation V154Y / R88E, containing mutation V154Y / Q187D / R88E, N-terminal truncation of 27 amino acids / mutation V154Y / Q187D, N-terminal truncation of 25 amino acids / mutation V154Y / Q187D, N-terminal truncation of 28 amino acids / mutation V154Y / Q187D, wild-type pseudorabies virus envelope gD protein.

[0019] As a preferred embodiment, the coding element comprises N-terminal truncation of 27 amino acids / mutation V154Y / Q187D and has an amino acid sequence as shown in SEQ ID NO.32.

[0020] In some embodiments, the coding element encodes any one of the following (a) to (d):

[0021] (a) the nucleotide sequence of the pseudorabies virus gB protein comprises the sequence shown in SEQ ID NO. 4, or has at least 90% sequence identity with the sequence shown in SEQ ID NO. 4, and encodes a polypeptide having or partially having the activity of the pseudorabies virus gB protein;

[0022] (b) the nucleotide sequence of the pseudorabies virus gC protein comprises the sequence shown in SEQ ID NO.6, or has at least 90% sequence identity with the sequence shown in SEQ ID NO.6, and encodes a polypeptide having or partially having the activity of the pseudorabies virus gC protein;

[0023] (c) the nucleotide sequence of the pseudorabies virus gD protein comprises the sequence shown in SEQ ID NO.8, or has at least 90% sequence identity with the sequence shown in SEQ ID NO.8, and encodes a polypeptide having or partially having the activity of the pseudorabies virus gD protein;

[0024] (d) The nucleotide sequence of the pseudorabies virus gK protein comprises the sequence shown in SEQ ID NO. 10, or has at least 90% sequence identity with the sequence shown in SEQ ID NO. 10, and encodes a sequence having or partially having the activity of a polypeptide having the activity of the pseudorabies virus gK protein.

[0025] As a preferred embodiment, the coding element comprises a nucleotide sequence encoding pseudorabies virus gD protein and has a sequence as shown in SEQ ID NO.8.

[0026] In some embodiments, the coding element comprises a nucleotide sequence encoding any one of the following:

[0027] Pseudorabies virus envelope gD protein with N-terminal truncation of 10 amino acids, N-terminal truncation of 21 amino acids, N-terminal truncation of 27 amino acids, N-terminal truncation of 28 amino acids, C-terminal truncation of 5 amino acids, mutation V154Y, mutation Q187D, mutation Q187L, mutation C117L, mutation R88E, mutation V154P, mutation V154Y / Q187D, mutation V154Y / R88E, mutation V154Y / Q187D / R88E, N-terminal truncation of 27 amino acids / mutation V154Y / Q187D, N-terminal truncation of 25 amino acids / mutation V154Y / Q187D, N-terminal truncation of 28 amino acids / mutation V154Y / Q187D, and wild-type pseudorabies virus envelope gD protein.

[0028] In some embodiments, the coding element comprises any one of the following:

[0029] Nucleotide sequence 1 (numbered SEQ ID NO.33), nucleotide sequence 2 (numbered SEQ ID NO.34), nucleotide sequence 3 (numbered SEQ ID NO.35), nucleotide sequence 4 (numbered SEQ ID NO.36), and nucleotide sequence 5 (numbered SEQ ID NO.37) encoding the N-terminal truncation of 27 amino acids / mutation V154Y / Q187D of pseudorabies virus envelope gD protein.

[0030] As a preferred embodiment, the coding element comprises a nucleotide sequence 1 (SEQ ID NO. 33) encoding the N-terminal truncation of 27 amino acids / mutation V154Y / Q187D of the pseudorabies virus envelope gD protein.

[0031] In some embodiments, the circular RNA of the present invention is prepared by a traditional PIE system, under which conditions, the circular RNA comprises elements arranged in the order shown in (a) or (b):

[0032] (a) the first exon, the second exon, the 5' spacer, the translation initiation element, the coding element and the 3' spacer;

[0033] (b) The first exon, the second exon, the translation initiation element and the coding element.

[0034] For the first exon, the second exon, the 5' spacer, and the 3' spacer, reference may be made to patent applications CN202011408937.4, CN202210200112.6, and CN202210200186.X, the entire contents of which are incorporated into this application by reference.

[0035] In other embodiments, the circular RNA of the present invention is prepared by a clean PIE system, under which conditions, the circular RNA comprises elements arranged in the order shown in (c) or (d):

[0036] (c) translation initiation elements and coding elements;

[0037] (d) Translation initiation elements, coding elements and insertion elements.

[0038] In some preferred embodiments, the circular RNA of the present invention is prepared by a clean PIE system, and the circular RNA comprises the elements arranged in the order shown in (d) above. The clean PIE system for preparing circular RNA can refer to the contents shown in patents CN202210200112.6 and CN202210200186.X, and the entire contents of the above patents are incorporated into this application by reference.

[0039] In some embodiments, the translation initiation element described herein can be any type of element that can initiate translation of a coding element in a circular RNA.

[0040] In some specific embodiments, the translation initiation element of the present invention comprises one or more of the following sequences with translation initiation activity: IRES sequence, 5'UTR sequence, Kozak sequence, m 6A modified (N(6) methyladenosine modification) sequence, complementary sequence of ribosomal 18S rRNA.

[0041] In some preferred embodiments, the translation initiation element of the present invention comprises an IRES sequence. Exemplary, the IRES sequence includes but is not limited to an IRES sequence derived from Echovirus, Human poliovirus, Human Enterovirus, Coxsackievirus, Human rhinovirus, Canine picornavirus, Turdivirus 3, Hepatovirus, Passerivirus, Picornaviridae, Tremovirus A, Feline kobuvirus, Murine kobuvirus, Kobuvirus sewage Kathmandu, Ferret kobuvirus, Marmot kobuvirus, Humanparechovirus, Chicken picornavirus, Falcon picornavirus, Feline picornavirus, French Guiana picornavirus, etc.

[0042] In some embodiments, the insertion element described in the present invention can be used to regulate the transcription of recombinant nucleic acid molecules, to regulate the translation of circular RNA, to achieve specific expression of circular RNA in different tissues, or to purify circular RNA, etc.

[0043] In some specific embodiments, the insertion element described in the present invention comprises one or more of the following sequences: a non-translated region sequence, a polyN sequence, an adapter sequence, a ribosomal switch sequence, and a sequence that binds a transcriptional regulatory factor; in the polyN sequence, N is selected from at least one of A, T, G, and C.

[0044] In some preferred embodiments, the insertion element of the present invention comprises a stop codon and a polyAC sequence; preferably, the polyAC sequence comprises the sequence shown in SEQ ID NO.15.

[0045] In some more preferred embodiments, the circular RNA described in the present invention has a sequence as shown in any one of SEQ ID NOs. 38 to 46.

[0046] In some preferred embodiments, the circular RNA comprises a nucleotide sequence of any one of the following: a nucleotide sequence as shown in SEQ ID NO.38, a nucleotide sequence as shown in SEQ ID NO.39, a nucleotide sequence as shown in SEQ ID NO.40, a nucleotide sequence as shown in SEQ ID NO.41, or a nucleotide sequence as shown in SEQ ID NO.42; or a nucleotide sequence as shown in SEQ ID NO.43, a nucleotide sequence as shown in SEQ ID NO.44, a nucleotide sequence as shown in SEQ ID NO.45, or a nucleotide sequence as shown in SEQ ID NO.46.

[0047] In some more preferred embodiments, the circular RNA described in the present invention has a sequence as shown in SEQ ID NO.44.

[0048] <Linear RNA>

[0049] The present invention provides a linear RNA, wherein the linear RNA undergoes a self-cleavage reaction and then cyclizes to form the above-mentioned circular RNA. Accordingly, the linear RNA is also called a cyclized precursor RNA.

[0050] In some embodiments, the linear RNA of the present invention is derived from the traditional PIE system, under which conditions, the linear RNA comprises elements arranged in the order shown in (e) or (f) below:

[0051] (e) 5' homology arm, intron fragment II, second exon, 5' spacer, translation initiation element, coding element, 3' spacer, first exon, intron fragment I and 3' homology arm;

[0052] (f) 5' homology arm, intron fragment II, second exon, translation initiation element, coding element, first exon, intron fragment I and 3' homology arm.

[0053] The linear RNA molecule having the above structure can utilize the ribozyme activity of the class I intron to undergo a self-cleavage cyclization reaction in vitro to obtain a circular RNA. Specifically, under the initiation of GTP, the junction between the 5' intron and the first exon is broken; the ribozyme cleavage of the first exon further attacks the junction between the 3' intron and the second exon, causing the junction to break, the 3' intron dissociates, and the first exon and the second exon are connected to obtain a circular mRNA.

[0054] In other embodiments, the linear RNA of the present invention is derived from the clean PIE system, under which conditions, the linear RNA comprises the elements arranged in the order shown in (g), (h) or (i):

[0055] (g) intron fragment II, translation initiation element truncation fragment II, coding element, translation initiation element truncation fragment I, intron fragment I;

[0056] (h) intron fragment II, translation initiation element truncation fragment II, coding element, insertion element, translation initiation element truncation fragment I, intron fragment I;

[0057] (i) Intron fragment II, translation initiation element truncation fragment II, coding element (including stop codon), polyAC, translation initiation element truncation fragment I, intron fragment I.

[0058] When the linear RNA molecule having the above structure is used to prepare circular RNA, the ribozyme recognizes the connection position between the translation initiation element truncated fragment I (IRES fragment I) and the intron fragment I and breaks it first, releasing the intron fragment I; then the ribozyme recognizes the connection position between the translation initiation element truncated fragment II (IRES fragment II) and the intron fragment II and breaks it, releasing the intron fragment II. The 3' end of the translation initiation element truncated fragment I and the 5' end of the translation initiation element truncated fragment II are connected to form a circular molecule.

[0059] In some preferred embodiments, the linear RNA of the present invention is derived from the clean PIE system, and the linear RNA comprises the elements arranged in the order shown in (i) above.

[0060] In some specific embodiments, the intron fragment II of the present invention comprises a sequence as shown in SEQ ID NO. 1. In some specific embodiments, the intron fragment I of the present invention comprises a sequence as shown in SEQ ID NO. 17. The nucleotide sequence of the intron fragment I is connected with the nucleotide sequence of the intron fragment II to obtain an intron sequence.

[0061] In some specific embodiments, the translation initiation element truncated fragment II of the present invention comprises a sequence as shown in SEQ ID NO.47; the translation initiation element truncated fragment I comprises a sequence as shown in SEQ ID NO.48. In some specific embodiments, the nucleotide sequence of the translation initiation element truncated fragment II (EVE-II) is shown in SEQ ID NO.18; the nucleotide sequence of the translation initiation element truncated fragment I (EVE-I) is shown in SEQ ID NO.19. The nucleotide sequence of the translation initiation element truncated fragment I is connected with the nucleotide sequence of the translation initiation element truncated fragment II to obtain the translation initiation element sequence.

[0062] In some specific embodiments, the coding element of the present invention comprises a sequence as shown in any one of SEQ ID NO.33 to SEQ ID NO.37.

[0063] <Recombinant Nucleic Acid Molecule>

[0064] The present invention provides a recombinant nucleic acid molecule, which forms the above-mentioned linear RNA after transcription.

[0065] In some embodiments, the recombinant nucleic acid molecule of the present invention may contain a regulatory sequence in addition to the elements contained in the linear RNA described above. Exemplarily, the regulatory sequence is a T7 promoter.

[0066] <Recombinant Escherichia coli engineered bacteria>

[0067] The present invention provides a recombinant Escherichia coli engineering bacterium, wherein the engineering bacterium is obtained by transforming E. coli with the above-mentioned recombinant nucleic acid molecule.

[0068] <Nucleic acid lipid nanoparticle composition>

[0069] The present invention provides a nucleic acid lipid nanoparticle composition, which comprises lipid nanoparticles and the above-mentioned circular RNA.

[0070] By encapsulating the above circular RNA into lipid nanoparticles, the body's uptake efficiency of circular RNA can be improved, while the storage stability of circular RNA is improved, providing assistance for the development and application of pseudorabies vaccine.

[0071] <Medical Use>

[0072] The circular RNA, linear RNA, recombinant nucleic acid molecule and / or nucleic acid lipid nanoparticle composition provided by the present invention can be used to prevent and / or treat pseudorabies.

[0073] The present invention provides use of the circular RNA, linear RNA, recombinant nucleic acid molecule, recombinant Escherichia coli engineered bacteria, and / or nucleic acid lipid nanoparticle composition in the preparation of a drug for preventing and / or treating pseudorabies.

[0074] The present invention provides a method for preventing and / or treating pseudorabies, comprising administering an effective amount of the above-mentioned circular RNA, linear RNA, recombinant nucleic acid molecule and / or nucleic acid lipid nanoparticle composition to a subject; preferably, the administration is performed by injection.

[0075] Beneficial effects:

[0076] (1) The present invention provides a preferred gD truncated and mutant protein sequence and a circular RNA molecule encoding the protein (numbered EVE-gD2132, nucleotide sequence numbered SEQ ID NO.42). Compared with the circular RNA encoding the gD wild-type protein (numbered EVE-gD1103), the vaccine containing the molecule successfully increased the neutralizing antibody titer in mice by 4.6 times (14 days after the second immunization).

[0077] (2) Furthermore, for the gD truncated and mutant protein, the present invention provides a preferred nucleotide sequence and a circular RNA molecule comprising the preferred nucleotide sequence (numbered EVE-gD2135, nucleotide sequence numbered SEQ ID NO.38). Compared with the circular RNA molecule comprising the wild-type nucleotide (numbered EVE-gD2132), the vaccine comprising the molecule successfully increased the expression of the target protein in 293T cells by 2.7 times (48 hours after transfection).

[0078] (3) Furthermore, the present invention provides a circular RNA molecule constructed using a preferred translation initiation element (numbered PPV-gD2135, nucleotide sequence numbered SEQ ID NO.44). Compared with a circular RNA molecule constructed using a known translation initiation element (numbered EVE-gD2135), a vaccine comprising the molecule successfully increased the neutralizing antibody titer in pigs by 5.3 times (28 days after the second immunization).

[0079] (4) Compared with the linear RNA molecule encoding the wild-type gD protein of pseudorabies virus (numbered linear-gD1103), the LNP-circular RNA vaccine prepared using the above-mentioned optimized circular RNA molecule (numbered PPV-gD2135, nucleotide sequence numbered SEQ ID NO.44) successfully activated the T cell immune response in pigs, especially the critical CD8+T cell immune response, further improving immune protection and providing a basis for the preparation of pseudorabies virus circular RNA vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0081] Figure 1 A schematic diagram of the precursor sequence and circular mRNA sequence for generating pseudorabies virus gD protein circular mRNA;

[0082] Figure 2 This is the ratio of CD4+ and CD8+ T lymphocytes in blood PBMC cells after pig immunization (14 days after the second immunization). DETAILED DESCRIPTION

[0083] The present invention is described in detail below in conjunction with embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0084] In the present invention, the term "a" or "an" or "the" may mean "one", and may also mean "one or more", "at least one" and "one or more than one".

[0085] In the present invention, the terms "comprising", "having", "including" or "containing" may mean inclusive or open-ended, and do not exclude additional, uncited elements or method steps. At the same time, "comprising", "having", "including" or "containing" may also mean closed, excluding additional, uncited elements or method steps.

[0086] In the present invention, the word "may" includes both performing a certain process and not performing a certain process.

[0087] In the present invention, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and the description includes instances where the event occurs and instances where it does not occur.

[0088] In the present invention, the term "about" may mean that a value includes the standard deviation of the error of the device or method used to determine the value. Unless otherwise explicitly stated, it should be understood that all ranges, quantities, values ​​and percentages used in the present invention are modified by "about".

[0089] In the present invention, the terms "polypeptide", "peptide" and "protein" are used interchangeably herein and are amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0090] In the present invention, the term "circular RNA" refers to an RNA molecule in a closed circular shape. In the present invention, the circular RNA used has protein translation activity and can also be called "circular mRNA".

[0091] In the present invention, the term "linear RNA" refers to an RNA precursor that can be circularized to form a circular RNA, which is generally transcribed from a linear DNA molecule and can also be called "linear mRNA".

[0092] In the present invention, the term "linear RNA" refers to RNA with translation function including a 5' cap structure (5' Cap), a 3' polyadenosine tail (PolyA tail), a 5' untranslational region (5' UTR), a 3' untranslational region (3' UTR) and an open reading frame (Open reading frame, ORF) and other structures, which can also be called "linear mRNA".

[0093] In the present invention, the term "recombinant nucleic acid molecule" refers to a polynucleotide having sequences that are not linked together in nature. The recombinant polynucleotide may be included in a suitable vector, and the vector may be used to transform into a suitable host cell. The polynucleotide is then expressed in a recombinant host cell to produce, for example, a "recombinant polypeptide", "recombinant protein", "fusion protein", etc. In the present invention, the recombinant nucleic acid molecule comprises a coding element encoding a target polypeptide, and a translation initiation element connected upstream of the coding element.

[0094] In the present invention, the term "translation initiation element" refers to any sequence that can recruit ribosomes and initiate the translation process of RNA molecules. Exemplary, the translation initiation element includes an IRES sequence, an m6A modification sequence, or a rolling circle translation initiation sequence, etc.

[0095] In the present invention, the term "IRES" (Internal ribosome entry site, IRES) is also called internal ribosome entry site, "internal ribosome entry site" (IRES) belongs to the translation control sequence, which is usually located at the 5' end of the gene of interest and enables the translation of RNA in a cap-independent manner. The transcribed IRES can directly bind to the ribosomal subunit so that the mRNA start codon is properly oriented in the ribosome for translation. The IRES sequence is usually located in the 5'UTR of the mRNA (just upstream of the start codon). IRES functionally replaces the need for various protein factors that interact with the eukaryotic translation machinery.

[0096] In the present invention, the term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0097] In the present invention, the term "wild type" is synonymous with "naturally occurring", and refers to an object that can be found in nature and has not been modified by humans.

[0098] In the present invention, the terms "variant" and "mutant" are used interchangeably and refer to nucleotides or amino acids that contain changes (i.e., substitutions, insertions and / or deletions) at one or more (e.g., several) positions relative to a "wild-type" polynucleotide or polypeptide. Substitution refers to replacing a nucleotide / amino acid occupying a position with a different nucleotide / amino acid. Deletion refers to the removal of a nucleotide / amino acid occupying a position. Insertion refers to the addition of a nucleotide / amino acid adjacent to and immediately following the nucleotide / amino acid occupying the position.

[0099] In the present invention, the terms "sequence identity" and "percentage of identity" refer to the percentage of nucleotides or amino acids that are identical (i.e., identical) between two or more polynucleotides or polypeptides. The sequence identity between two or more polynucleotides or polypeptides can be determined by the following method: the nucleotide or amino acid sequences of the polynucleotides or polypeptides are aligned and the number of positions containing the same nucleotide or amino acid residue in the aligned polynucleotides or polypeptides is scored, and compared with the number of positions containing different nucleotides or amino acid residues in the aligned polynucleotides or polypeptides. The polynucleotides may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or missing nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or two polynucleotides). The polypeptides may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or missing amino acids (i.e., amino acid insertions or amino acid deletions in one or two polypeptides). The sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the identical nucleotide or amino acid residue by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

[0100] In the present invention, the term "individual", "patient" or "subject" includes mammals. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).

[0101] In the present invention, "treatment" means: after suffering from a disease, the subject is exposed to (e.g., administered) the RNA molecule described in the present invention, thereby alleviating the symptoms of the disease compared to when the subject is not exposed, and does not necessarily mean that the symptoms of the disease are completely suppressed. Suffering from a disease means: the body has symptoms of the disease.

[0102] In the present invention, "prevention" means that before contracting a disease, by exposing a subject to the RNA molecule described in the present invention, the probability of contracting a disease and / or the symptoms after contracting a disease are reduced compared to when the subject is not exposed, and it does not mean that the disease must be completely suppressed.

[0103] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art. Unless otherwise specified, the units used in this specification are all international standard units, and the numerical values ​​and numerical ranges appearing in the present invention should be understood to include inevitable systematic errors.

[0104] In the examples, if the specific conditions are not specified, the conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for all reagents or instruments, they are all conventional products that can be purchased commercially. In order to better illustrate the present invention, numerous specific details are provided in the specific embodiments below. It should be understood by those skilled in the art that the present invention can be implemented equally without certain specific details. In other embodiments, methods, means, equipment and steps well known to those skilled in the art are not described in detail to highlight the gist of the present invention.

[0105] Example 1 Pseudorabies virus circular RNA vaccine target selection

[0106] Selecting a suitable antigen target is the first step and one of the difficulties in designing a circular RNA vaccine, which directly determines the effectiveness of the vaccine. Research on subunit protein vaccines is an important reference for selecting RNA vaccine targets, but as of now, no pseudorabies virus subunit protein vaccine has been approved for clinical use at home and abroad. The pseudorabies virus subunit vaccine under development mainly uses pseudorabies virus envelope glycoprotein as a target, but the effects of different targets vary greatly and even contradictory results appear. For example, the results of Zhang et al. (doi:10.1016 / j.vaccine.2020.07.025) showed that the gD subunit vaccine was better than gB, while the results of Li et al. (doi:10.1016 / j.virol.2019.07.027) showed that the gB subunit vaccine was better than gD. Patent CN 110327461 B believes that PRV subunit vaccine requires a combination of five proteins: gB, gC, gD, gH, and gL, while CN115838440 A believes that although protein vaccines based on gB, gC, and gD have been studied for a long time, there is no genetically engineered subunit vaccine available for application so far, so further research is needed, and a gH and gL subunit bivalent vaccine has been reported. Therefore, the target for designing a circular RNA vaccine against pseudorabies virus is still unclear.

[0107] Based on the above problems, this study first screened and designed targets for pseudorabies virus circular RNA vaccine.

[0108] 1.1 Gene design and synthesis

[0109] In this study, we first designed the vector DNA of circular RNA for the wild-type protein of the major envelope glycoprotein gB or gC or gD or gK or gH or gL of pseudorabies virus. The backbone of circular RNA was designed with reference to patent CN 114574483A, in which the translation initiation elements were selected from the Caprine kobuvirus IRES sequence in which the 80th G mutated to T, the 81st A mutated to C, and the 82nd G mutated to T to obtain a mutant sequence (numbered CKV) or the Echovirus E29IRES sequence in which the 13th G mutated to T, the 19th T mutated to C, and the 20th G mutated to T to obtain a mutant sequence (numbered EVE).

[0110] Specifically, each DNA vector in this study contains the following elements arranged in the following order from 5' to 3': intron fragment II, translation initiation element truncation fragment II (numbered CKV-II or EVE-II, respectively), protein coding element, insertion element, translation initiation element truncation fragment I (numbered CKV-I or EVE-I, respectively), intron fragment I. Among them:

[0111] The nucleotide sequence of intron fragment II is shown in SEQ ID NO.1;

[0112] The nucleotide sequence of the translation initiation element truncation fragment II (CKV-II) is shown in SEQ ID NO. 2;

[0113] The protein coding element comprises: a nucleotide sequence encoding the gB protein of the pseudorabies virus JS-2012 strain (as shown in SEQ ID NO.4), or a nucleotide sequence of the gC protein (as shown in SEQ ID NO.6), or a nucleotide sequence of the gD protein (as shown in SEQ ID NO.8), or a nucleotide sequence of the gK protein (as shown in SEQ ID NO.10), or a nucleotide sequence of the gH protein (as shown in SEQ ID NO.12, and the amino acid sequence of the gH protein is shown in SEQ ID NO.11), or a nucleotide sequence of the gL protein (as shown in SEQ ID NO.14, and the amino acid sequence of the gL protein is shown in SEQ ID NO.13), and a stop codon (as shown in (TAA)x(TAG)y(TGA)z, wherein x+y+z≥1, x, y, z are each independently an integer greater than or equal to 0, and the stop codon is preferably TGA);

[0114] The nucleotide sequence of the insertion element (polyAC) is shown in SEQ ID NO.15;

[0115] The nucleotide sequence of the translation initiation element truncation fragment I (CKV-I) is shown in SEQ ID NO. 16;

[0116] The nucleotide sequence of intron fragment I is shown in SEQ ID NO.17.

[0117] The corresponding vectors designed with the above elements for gB protein, gC protein, gD protein, gK protein, gH protein or gL protein are numbered pCKV-gB1602, pCKV-gC535, pCKV-gD1103, pCKV-gK1574, pCKV-gH674, and pCKV-gL783 respectively.

[0118] The above CKV translation initiation element is replaced by the EVE translation initiation element, and the vectors designed for gB protein, gC protein, gD protein, gK protein, gH protein, or gL protein are numbered pEVE-gB1602, pEVE-gC535, pEVE-gD1103, pEVE-gK1574, pEVE-gH674, and pEVE-gL783, respectively, wherein the nucleotide sequence of the translation initiation element truncated fragment II (EVE-II) is shown in SEQ ID NO.18; the nucleotide sequence of the translation initiation element truncated fragment I (EVE-I) is shown in SEQ ID NO.19;

[0119] The above vectors are transcribed to obtain linear RNA molecules with corresponding structures. The mechanism of forming circular RNA from linear RNA molecules is as follows: ribozyme recognizes the connection position between translation initiation element truncated fragment I (IRES fragment I) and intron fragment I to generate a break, releasing intron fragment I; then ribozyme recognizes the connection position between translation initiation element truncated fragment II (IRES fragment II) and intron fragment II to generate a break, releasing intron fragment II. The 3' end of translation initiation element truncated fragment I and the 5' end of translation initiation element truncated fragment II are connected to form a circular molecule ( Figure 1 ).

[0120] The above genes pCKV-gB1602, pCKV-gC535, pCKV-gD1103, pCKV-gK1574, pCKV-gH674, pCKV-gL783 and pEVE-gB1602, pEVE-gC535, pEVE-gD1103, pEVE-gK1574, pEVE-gH674, pEVE-gL783 were commissioned to Suzhou Genewise Biotechnology Co., Ltd. for synthesis and cloning. The obtained gene fragments were connected to the pUC57 vector and verified to be correct by gene sequencing.

[0121] 1.2 Preparation of circular RNA

[0122] The DNA vector obtained in step 1.1 of this example is prepared into circular RNA.

[0123] (1) Test method

[0124] a) Preparation of bacterial strains: The synthesized DNA vectors were transformed into DH5α competent cells, spread on LB medium plates containing 100 μg / ml ampicillin, and cultured at 37°C. When the colonies on the plates were clearly visible, single colonies were picked and placed in 3 ml LB liquid culture medium containing 100 μg / ml ampicillin, cultured at 37°C, and 1 ml of the bacterial solution was added to glycerol with a final concentration of 8%, and stored at -80°C to obtain engineered bacteria as seeds for subsequent experiments.

[0125] b) Plasmid extraction: Activate the externally constructed puncture bacteria at 37°C / 220rpm for 3-4h; take the activated bacterial solution for expansion culture, culture conditions: shake overnight culture at 37°C / 220rpm; extract the plasmid using a commercial kit (Tiangen Endotoxin-Free Plasmid Extraction Kit).

[0126] c) Plasmid digestion and purification: The plasmid was digested by restriction endonuclease BsaI (nearshore protein) / BsaI (Takara), and the digestion system was as follows: 10× buffer: 100 μl, plasmid: 5 mg, BsaI: 150 μl, water was added to 1000 μl, and digestion was carried out at 37°C overnight. After digestion, the digestion product was purified by column using a commercial DNA recovery kit (TIANGEN) to obtain a linearized plasmid.

[0127] d) In vitro transcription: The transcription system is configured as shown in Table 1 below:

[0128] Table 1

[0129] Reagents volume 10× Reaction Buffer 2ml ATP(100mM) 2ml CTP (100 mM) 2ml UTP(100mM) 2ml GTP (100 mM) 2ml Linearized plasmid 600μl T7 RNA Polymerase (25U / μl) 2ml RNase inhibitor (10U / μl) 2ml Nuclease free water Total 20ml

[0130] Reaction conditions: Constant temperature shaking reaction at 37°C / 220rpm for 2-4h, then add 2ml of deoxyribonuclease I (DNaseI) to the transcription system, and constant temperature shaking reaction at 37°C / 220rpm for 15min.

[0131] e) Precipitation of transcription product mRNA: Add LiCl solution to the transcription product obtained in a) above and place at -20°C for overnight precipitation; centrifuge the overnight treated solution to obtain mRNA precipitate, dry at room temperature and resuspend the precipitate in enzyme-free water to obtain a linear mRNA aqueous solution.

[0132] f) mRNA cyclization and concentration: The cyclization system and conditions are shown in Table 2 below

[0133] Table 2

[0134]

[0135] The above solutions were mixed thoroughly and heated at 55°C for 15 min. The circularized mRNA product was concentrated by ultrafiltration tube centrifugation, and the filtrate was discarded; and the ultrafiltration liquid was transferred to a new centrifuge tube.

[0136] g) Circular mRNA HPLC purification: A certain amount of circular mRNA was separated by chromatographic column SEC-1000 (SEPAX) in 150 mM phosphate buffer mobile phase, and the main peak component was collected.

[0137] h) Ultrafiltration and concentration of the purified circular mRNA: The circular mRNA tube is subjected to ultrafiltration centrifugation and concentration, and the filtrate is discarded; enzyme-free water is added to the ultrafiltration tube, and the circular mRNA is repeatedly washed twice, and the circular mRNA is concentrated to a desired concentration; the ultrafiltration liquid is transferred to a new centrifuge tube.

[0138] (2) Test results

[0139] Through the above process, a circular mRNA with the following sequence structure was successfully prepared:

[0140] 1) IRES-CKV-wild gB-stop codon (TGA)-polyAC; the circular mRNA was named CKV-gB1602, and the sequence was shown in SEQ ID NO.20.

[0141] 2) IRES-CKV-wild gC-stop codon (TGA)-polyAC; the circular mRNA was named CKV-gC535, and the sequence was shown in SEQ ID NO.21.

[0142] 3) IRES-CKV-wild gD-stop codon (TGA)-polyAC; the circular mRNA was named CKV-gD1103, and the sequence is shown in SEQ ID NO.22.

[0143] 3) IRES-CKV-wild gK-stop codon (TGA)-polyAC; the circular mRNA was named CKV-gK1574, and the sequence is shown in SEQ ID NO.23.

[0144] 4) IRES-CKV-wild gH-stop codon (TGA)-polyAC; the circular mRNA was named CKV-gH674, and the sequence was shown in SEQ ID NO.24.

[0145] 5) IRES-CKV-wild gL-stop codon (TGA)-polyAC; the circular mRNA was named CKV-gL783, and the sequence is shown in SEQ ID NO.25.

[0146] 6) IRES-EVE-wild gB-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gB1602, and the sequence was shown in SEQ ID NO.26.

[0147] 7) IRES-EVE-wild gC-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gC535, and the sequence was shown in SEQ ID NO.27.

[0148] 8) IRES-EVE-wild gD-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD1103, and the sequence was shown in SEQ ID NO.28.

[0149] 8) IRES-EVE-wild gK-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gK1574, and the sequence was shown in SEQ ID NO.29.

[0150] 9) IRES-EVE-wild gH-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gH674, and the sequence was shown in SEQ ID NO.30.

[0151] 10) IRES-EVE-wild gL-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gL783, and the sequence is shown in SEQ ID NO.31.

[0152] Table 3 Circular RNA names and corresponding sequences

[0153] Group Nucleotide sequence CKV-gB1602 SEQ ID NO.20 CKV-gC535 SEQ ID NO.21 CKV-gD1103 SEQ ID NO.22 CKV-gK1574 SEQ ID NO.23 CKV-gH674 SEQ ID NO.24 CKV-gL783 SEQ ID NO.25 EVE-gB1602 SEQ ID NO.26 EVE-gC535 SEQ ID NO.27 EVE-gD1103 SEQ ID NO.28 EVE-gK1574 SEQ ID NO.29 EVE-gH674 SEQ ID NO.30 EVE-gL783 SEQ ID NO.31

[0154] 1.3 In vitro expression verification

[0155] Each circular mRNA prepared in step 1.2 of this example was transfected into 293T cells respectively. 48 hours after transfection, a His tag ELISA detection kit (Nanjing GenScript Biotechnology Co., Ltd., catalog number L00436) was used to quantitatively detect each antigen in the cell supernatant to evaluate the expression of each circular mRNA in each cell.

[0156] (1) Test method

[0157] 1) Cell culture: 293T cells were cultured at 1×10 5 Cells were inoculated into 24-well cell culture plates, and cultured in a 37°C, 5% CO2 incubator using DMEM high-glucose medium containing 10% fetal bovine serum and 1% double antibody. Cell transfection was performed when the cells reached 70% confluence.

[0158] 2) Cell transfection: 0.75-1.5 μL of MessengerMax (Thermo Fisher Scientific) was diluted to 25 μL with Opti-MEM (Thermo Fisher Scientific) per well and reacted at room temperature for 10 min. 0.5 μg of each circular RNA was diluted to 25 μL with Opti-MEM per well. 25 μL of MessengerMax / Opti-MEM diluted solution reacted at room temperature was mixed with 25 μL of circular mRNA / Opti-MEM diluted solution in a 1:1 ratio and incubated at room temperature for 5 min.

[0159] Add 50 μL of the incubated mixed reagent to each 24-well cell culture plate and culture in a 37°C, 5% CO2 incubator. Collect the cell supernatant after 48 hours of culture and freeze at -80°C.

[0160] The supernatant of 293T cells not transfected with circular mRNA was used as the negative control group (NC group).

[0161] 3) Detection of antigen content using His tag ELISA detection kit: A His tag ELISA detection kit (Nanjing GenScript Biotechnology Co., Ltd., Catalog No. L00436) was used to quantitatively detect the antigen content in the supernatant of each cell in step 2) according to the instructions to evaluate the expression of each circular mRNA in each cell.

[0162] (2) Test results

[0163] The results are shown in Table 4. After 48 hours of transfection, all optimized groups expressed, but the expression efficiency was different. The expression levels of the groups with EVE translation initiation element were slightly higher overall, so it was used for further study. In addition, the in vitro expression level of the circular RNA corresponding to the gH protein in this study was slightly lower than that of other groups, which may be related to the lower expression efficiency of the protein with a larger molecular weight.

[0164] Table 4 In vitro expression level / ng / ml

[0165] Group Mean SD value Group Mean SD value CKV-gB1602 16.4 2.5 EVE-gB1602 19.4 2.2 CKV-gC535 10.8 3.1 EVE-gC535 9.8 3.6 CKV-gD1103 14.4 2.8 EVE-gD1103 16.7 5.5 CKV-gK1574 12.7 4.5 EVE-gK1574 13.6 3.2 CKV-gH674 6.6 2.3 EVE-gH674 10 1.1 CKV-gL783 10.5 1.5 EVE-gL783 12.4 4.2 Untransfected control 1.6 0.9 \

[0166] 1.4 LNP-mRNA preparation

[0167] The circular RNA molecules (EVE-gB1602, EVE-gC535, EVE-gD1103, EVE-gK1574, EVE-gH674, and EVE-gL783) obtained in step 1.3 were prepared into LNP-encapsulated RNA using commercial LNPs, and were numbered LNP / EVE-gB1602, LNP / EVE-gC535, LNP / EVE-gD1103, LNP / EVE-gK1574, LNP / EVE-gH674, and LNP / EVE-gL783, respectively, to prepare for further animal experiments.

[0168] (1) Test method

[0169] The LNP-mRNA preparation reference (doi: 10.1016 / j.cell.2022.03.044), the specific process is as follows:

[0170] a) Dilute the circular RNA to a final concentration of 170 μg / mL using PNI formulation buffer (Precision NanoSystems, Cat. No. NWW0043).

[0171] b) On a NanoAssembler Ignite (Precision NanoSystems), commercial LNP (Precision NanoSystems) and circular RNA were mixed at a volume ratio of 1:3 using Ignite NxGenCartridge (Precision NanoSystems, Catalog No. NIT0002).

[0172] c) Using tangential flow technology, the buffer environment was replaced with PBS at pH 7.4 to remove ethanol and prepare LNP-mRNA.

[0173] d) Using Quant-iT TM RiboGreen TM RNA Assay Kit (Invitrogen TM The particle size, PDI and surface potential of LNP particles were measured by dynamic light scattering method on a Zeta potential laser particle size analyzer Malvern Zetasizer Nano-ZEN 3600 (Malvern).

[0174] (2) Test results

[0175] The mRNA-encapsulated LNP prepared in this step has a small particle size and uniform distribution, good encapsulation effect, and an encapsulation rate of more than 90%; the surface potential is electronegative, avoiding cytotoxicity caused by positive charge on the surface of the nanoparticles, and has good biosafety.

[0176] 1.5 Mouse immunization and neutralizing antibody determination

[0177] (1) Experimental methods

[0178] Female Babl / c mice aged 6 to 8 weeks were randomly divided into 7 groups, 4 mice in each group, and the 5 kinds of LNP-encapsulated circular mRNAs prepared in step 1.4 of this embodiment (respectively LNP / EVE-gB1602, LNP / EVE-gC535, LNP / EVE-gD1103, LNP / EVE-gK1574, LNP / EVE-gH674, LNP / EVE-gL783) were immunized with mice at a dose of 30 μg / mouse. The mice inoculated with LNP were negative controls and boosted once on the 21st day after the initial immunization. Blood was collected 14 days after the second immunization to separate serum for virus neutralizing antibody detection. The detection method was referenced to CN_112430625_B, and the neutralizing antibody titer of each group was expressed by mean ± SD value.

[0179] (2) Experimental results

[0180] The results are shown in Table 5. Compared with the LNP control group, circular RNA encoding gB, gC, gD, and gK proteins all produced significant neutralizing antibodies, while those encoding gH and gL proteins did not. In previous studies, gH and gL proteins were considered to be possible targets of pseudorabies virus protein vaccines, but the corresponding circular RNA molecules and corresponding vaccines prepared in this study did not produce neutralizing antibodies; while gK protein was not seen as a target of pseudorabies virus protein vaccine, but the corresponding circular RNA molecules and corresponding vaccines prepared in this study produced significant neutralizing antibodies in mice, suggesting that circular RNA molecules and protein vaccines have very different efficacy mechanisms, and it is impossible to directly apply the relevant research information of protein vaccines to design circular RNA vaccine targets. In this study, the circular RNA vaccine encoding gD protein (number EVE-gD1103) had the highest level of neutralizing antibodies in mice, so gD protein was selected as the preferred target for designing pseudorabies virus circular RNA vaccines. The research results on gB, gC, gD, and gK can be further studied for multi-target pseudorabies circular RNA vaccines.

[0181] Table 5 Neutralizing antibody titers induced in mice

[0182]

[0183]

[0184] Example 2 gD protein design and optimization

[0185] The linear RNA vaccine targeting gD protein under development (doi: 10.1016 / j.vetmic.2020.108886.) uses the complete gD wild-type protein as the design unit, which may have many defects: including the presence of uncertain decoy epitopes on the surface of viral proteins, which consume the body's immune resources, resulting in low levels of neutralizing antibodies, leading to viral immune escape and even antibody-dependent infection enhancement (ADE) effects; on the other hand, wild-type proteins are often prone to insufficient vaccine effects due to structural instability, toxicity, or the formation of non-natural aggregates. This study analyzed the spatial structure and antigenicity of pseudorabies virus gD protein through molecular simulation, molecular dynamics, dominant B cell epitope prediction, and T cell epitope prediction, and thus made the correct amino acid truncation and amino acid mutation selection for pseudorabies virus gD wild-type protein.

[0186] 2.1 Gene design and optimization

[0187] According to the prediction, a total of 17 DNA molecules were rationally designed for the gD protein, including 17 different protein modifications. The corresponding DNA vectors were designed according to the method of step 1.1 in Example 1. The translation initiation elements used in each vector were EVE, and the protein coding elements respectively contained 17 modifications of the gD protein, as shown in Table 6. Each DNA vector was commissioned to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis and cloning. The obtained gene fragments were connected to the pUC57 vector.

[0188] Table 6 gD protein design

[0189]

[0190]

[0191] 2.2 Preparation of circular RNA

[0192] The circular RNA was prepared according to the method of step 1.2 of Example 1, specifically, the wild gD nucleotide sequence in the circular mRNA molecule (IRES-EVE-wild gD-stop codon (TGA)-polyAC (number EVE-gD1103, nucleotide sequence see SEQ ID NO.28)) was replaced with the corresponding nucleotides in Table 6, and finally a circular mRNA with the following sequence structure was obtained:

[0193] 1) IRES-EVE-gD truncation 1-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2118.

[0194] 2) IRES-EVE-gD truncated 2-stop codon (TGA)-polyAC; this circular mRNA was named EVE-gD2119.

[0195] 3) IRES-EVE-gD truncated 3-stop codon (TGA)-polyAC; this circular mRNA was named EVE-gD2120.

[0196] 4) IRES-EVE-gD truncated 4-stop codon (TGA)-polyAC; this circular mRNA was named EVE-gD2121.

[0197] 5) IRES-EVE-gD truncated 5-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2122.

[0198] 6) IRES-EVE-gD mutation 1-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2123.

[0199] 7) IRES-EVE-gD mutation 2-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2124.

[0200] 8) IRES-EVE-gD mutation 3-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2125.

[0201] 9) IRES-EVE-gD mutation 4-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2126.

[0202] 10) IRES-EVE-gD mutated 5-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2127.

[0203] 11) IRES-EVE-gD mutated to 6-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2128.

[0204] 12) IRES-EVE-gD mutation 7-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2129.

[0205] 13) IRES-EVE-gD mutated 8-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2130.

[0206] 14) IRES-EVE-gD mutation 9-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2131.

[0207] 15) IRES-EVE-gD truncation mutation 1-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2132.

[0208] 16) IRES-EVE-gD truncation mutation 2 stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2133.

[0209] 17) IRES-EVE-gD truncation mutation 3-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2134.

[0210] 2.3 In vitro expression verification

[0211] The circular mRNA containing each gD protein mutant prepared in step 2.2 of this example was transfected into 293T cells, and each antigen in the cell supernatant was quantitatively detected using a His tag ELISA detection kit (Nanjing GenScript Biotechnology Co., Ltd., catalog number L00436) 48 hours after transfection to evaluate the expression of each circular mRNA in each cell, with the circular RNA (number EVE-gD1103) for the gD wild-type protein prepared in step 1.2 of Example 1 and the untransfected group as controls. Specific cell culture and transfection, His tag ELISA detection kit detection methods are shown in step 1.3 of Example 1.

[0212] The results are shown in Table 7. Optimization of protein amino acids has a significant impact on protein expression efficiency:

[0213] Compared with the wild type, the expression levels of EVE-gD2126 (mutation C117L) and EVE-gD2128 (mutation V154P) histones were significantly reduced, indicating that the mutations were harmful; the expression levels of the remaining histones were increased to varying degrees.

[0214] Table 7 In vitro expression level / ng / ml

[0215] Group Target protein modification Mean SD value EVE-gD2118 N-terminal truncation of 10 aa 19.7 3.4 EVE-gD2119 N-terminal truncation of 21 aa 22.3 10.1 EVE-gD2120 N-terminal truncation of 27 aa 20.6 3.2 EVE-gD2121 N-terminal truncation of 28 aa 33.4 4.9 EVE-gD2122 C-terminal truncation of 5 aa 19.6 3.2 EVE-gD2123 Mutation V154Y 15.2 0.9 EVE-gD2124 Mutation Q187D 18.9 2.5 EVE-gD2125 Mutation Q187L 23.8 3.4 EVE-gD2126 Mutation C117L 3.1 1.7 EVE-gD2127 Mutation R88E 18.6 2.6 EVE-gD2128 Mutation V154P 2.3 1.5 EVE-gD2129 Mutation V154Y / Q187D 20.4 6.3 EVE-gD2130 Mutation V154Y / R88E 19.2 2.1 EVE-gD2131 Mutation V154Y / Q187D / R88E 28.3 5.2 EVE-gD2132 N-terminal truncation of 27 aa / mutation V154Y / Q187D 24.7 10.9 EVE-gD2133 N-terminal truncation of 25 aa / mutation V154Y / Q187D 25.1 11.0 EVE-gD2134 N-terminal truncation of 28 aa / mutation V154Y / Q187D 29.4 5.2 EVE-gD1103 (control) wild type 16.5 4.2 Negative control \ 1.6 0.6

[0216] 2.4 LNP-mRNA preparation

[0217] The circular mRNAs prepared in step 2.2 of this example and the circular RNA (numbered EVE-D1103) against the gD wild-type protein prepared in step 1.2 of example 1 were respectively prepared into lipid nanoparticle / RNA compositions using commercial LNPs (Precision NanoSystems). The compositions were tested to meet the requirements: the LNPs encapsulating the mRNA had a small particle size and uniform distribution, and had a good encapsulation effect, with an encapsulation rate greater than 90%; the surface potential was electrically neutral or electronegative, avoiding the cytotoxicity caused by the positive charge on the surface of the nanoparticles, and had good biosafety.

[0218] 2.5 Mouse immunization and antibody determination

[0219] Each circular RNA molecule encapsulated by LNP prepared in step 2.4 of this example was used to immunize mice, and mice inoculated with only LNP and circular RNA of gD wild-type protein encapsulated by LNP (numbered EVE-gD1103) were used as controls. The other operations were the same as step 1.5 of Example 1, and booster immunization was performed once on the 21st day after the initial immunization. Blood was collected 14 days after the second immunization to separate serum, and neutralizing antibodies in each group were detected by conventional methods. At the same time, gD antibodies in each group were detected using a commercial mouse gD antibody detection kit (Shanghai Angzyme Biotechnology Co., Ltd.), and the antibody titer was expressed as mean ± SD value.

[0220] The results are shown in Table 8. The optimization of protein amino acids has a significant effect on antibody titer, which further demonstrates the necessity of amino acid optimization:

[0221] N-terminal truncation of 27 amino acids (numbered EVE-gD2120) increased neutralizing antibodies by 3.1 times; while N-terminal truncation of 28 aa was harmful, resulting in the complete undetectability of gD antibodies and neutralizing antibodies; the remaining truncations had no significant changes. Mutations V154Y, Q187D, and R88E all effectively reduced gD antibody titers, suggesting that the dominant epitope was destroyed, and the remaining mutations were ineffective. Further studies showed that only the double-site mutation V154Y / Q187D reduced gD antibody titers by 47.7% and slightly increased neutralizing antibodies, while the triple-site mutation V154Y / Q187D / R88E significantly reduced gD antibody titers and neutralizing antibody titers, suggesting that mutation-effect modification is not a simple additive relationship. After further screening of the above factors, the optimal molecule (numbered EVE-gD2132, N-terminal truncation of 27 aa / mutation V154Y / Q187D) was successfully obtained, which reduced the gD protein antibody titer by 55.6% and increased the neutralizing antibody titer by 4.6 times compared with the wild-type molecule (numbered EVE-gD1103). The optimization of the gD protein amino acid sequence successfully reduced the ineffective immune consumption and successfully improved the vaccine effect.

[0222] Table 8 gD antibody titers and neutralizing antibody titers induced in mice

[0223]

[0224]

[0225] Example 3 Nucleotide sequence design and optimization

[0226] In theory, a protein can be encoded by countless nucleotides, but it is difficult to select the optimal nucleotide sequence from them. This study analyzed the higher-level structure of RNA through molecular dynamics calculations and other methods, and thus made a correct design of the nucleotide sequence encoding the above amino acid sequence.

[0227] 3.1 Gene design and circular RNA preparation

[0228] For the gD truncated plus mutant protein obtained in Example 2 (N-terminal truncated 27 aa / mutation V154Y / Q187D, amino acid sequence SEQ ID NO.32, nucleotide sequence 5 (see SEQ ID NO.37)), 4 nucleotide sequences were screened according to the calculation results: nucleotide sequence 1 (SEQ ID NO.33), nucleotide sequence 2 (SEQ ID NO.34), nucleotide sequence 3 (SEQ ID NO.35), nucleotide sequence 4 (SEQ ID NO.36), and the corresponding DNA vectors were designed according to the method of step 1.1 in Example 1. The translation initiation element used in each vector is EVE, and the protein coding element contains 4 nucleotides of gD truncated plus mutant protein (N-terminal truncated 27 aa / mutation V154Y / Q187D). Each DNA vector was commissioned to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis and cloning. The obtained gene fragment was connected to the pUC57 vector.

[0229] The corresponding circular RNA was prepared according to the method of step 1.2 of Example 1, and finally a circular mRNA having the following sequence structure was obtained, as shown in Table 9:

[0230] 1) IRES-EVE-truncated mutant gD nucleotide 1-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2135, and the sequence was shown in SEQ ID NO.38.

[0231] 2) IRES-EVE-truncated mutant gD nucleotide 2-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2136, and the sequence was shown in SEQ ID NO.39.

[0232] 3) IRES-EVE-truncated mutant gD nucleotide 3-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2137, and the sequence is shown in SEQ ID NO.40.

[0233] 4) IRES-EVE-truncated mutant gD nucleotide 4-stop codon (TGA)-polyAC; the circular mRNA was named EVE-gD2138, and the sequence is shown in SEQ ID NO.41.

[0234] Table 9 Nucleotide sequence optimization

[0235]

[0236] 3.2 In vitro expression verification

[0237] Each circular mRNA molecule prepared in step 3.1 of this example and step 2.2 of example 2 was transfected into 293T cells, and each antigen in the cell supernatant was quantitatively detected using a His tag ELISA detection kit (Nanjing GenScript Biotechnology Co., Ltd., catalog number L00436) on day 1, 2, 3, 4, and 5 of transfection to evaluate the expression of each circular mRNA in each cell, with the untransfected group as a negative control. Specific cell culture and transfection, His tag ELISA detection kit detection methods are shown in step 1.3 of example 1.

[0238] The results are shown in Table 10. Different nucleotides encoding the same protein showed great differences in expression and duration of expression: compared with the control EVE-gD2132, EVE-gD2136, EVE-gD2137, and EVE-gD2138 failed to significantly increase or even reduce the expression of the target protein, but the EVE-gD2135 group successfully improved the expression efficiency of the target protein, and the target protein expression level increased from 29.7 ng / ml to 80.4 ng / ml at 48h, an increase of 2.7 times, so this group was selected as the preferred nucleotide sequence. The optimization of the nucleotide sequence successfully improved the expression efficiency of the target antigen, indicating that nucleotide optimization is necessary.

[0239] Table 10 In vitro expression level / ng / ml

[0240]

[0241]

[0242] Example 4 Preparation of control linear RNA

[0243] To further compare the effects of circular RNA and linear RNA, this study prepared linear RNA of pseudorabies virus gD wild-type protein with reference to the literature (doi: 10.1016 / j.vetmic.2020.108886.). The designed DNA vector number is plinear-gD1103, and the coding region of the linear RNA contains the gD wild-type protein of PRV JS-2012 strain (amino acid sequence see SEQ ID NO.7, nucleotide sequence see SEQ ID NO.8), as follows: The gene sequence of the gD wild-type protein of SEQ ID NO.8 was commissioned to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis, and the resulting gene fragment was connected between the BamHI and XhoI sites of the pUC57 vector and verified to be correct by sequencing. Escherichia coli containing the vector DNA was cultured by conventional methods and DNA plasmids were prepared by a plasmid extraction kit (Cat. No. D6948-02, OMEGA Bio-Tek). The linear RNA molecule (number linear-gD1103) was further prepared as follows: RNA was transcribed using a transcription kit (Cat. No. AM1333, Life Technologies) and a tailing kit (A-Plus TM Poly(A) Polymerase Tailing Kit, Catalog No. C-PAP5104H, CellScript) to increase the 3′ polyA structure, and use the capping kit (ScriptCap TM m7G CappingSystem, Catalog No. C-SCCE0610, CellScript) was used to add a 5′ cap structure and purified with a kit (Catalog No. R6247-02, OMEGA Bio-Tek) to obtain a linear RNA molecule (code linear-gD1103). The Agilent 2100 Bioanalyzer was used to analyze the quality of the in vitro synthesized linear RNA molecule linear-gD1103. The band was consistent with the target band and the purity met the requirements.

[0244] Example 5 Optimization of circular RNA molecular backbone

[0245] The circular RNA molecular skeleton disclosed in the prior art (patent CN 114574483 A) uses the preferred translation initiation element (IRES sequence) of Caprine kobuvirus IRES sequence (numbered CKV in the present invention) and Echovirus E29IRES sequence (numbered EVE in the present invention). The circular RNA containing these translation initiation elements encodes human proteins and is highly expressed in human cell lines (lung cancer human alveolar basal epithelial cells A549 cells or human kidney epithelial cell line 293T cells), but the effect in pigs is unknown; on the other hand, there are at least thousands of known translation initiation elements (IRES sequences), and it is very difficult to select the suitable elements from them. This study designed a combinatorial library, a nucleotide site-directed mutagenesis modification library and other methods to analyze and compare the IRES sequence, so that a better IRES sequence was matched to the optimized gD protein nucleotide sequence.

[0246] 5.1IRES Optimization Design and CircRNA Preparation

[0247] Three candidate IRES sequences (numbered PPV, PSV and LTE) were obtained through preliminary screening, and the IRES in the preferred circular RNA molecule (numbered EVE-gD2135, nucleotide sequence SEQ ID NO.38) obtained by screening in Example 4 was replaced with candidate IRES sequences (numbered PPV, PSV, LTE and CKV in Example 1) and constructed into DNA vectors, and the operation method was the same as the method of step 1.1 of Example 1. Each DNA vector was commissioned to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis and cloning. The obtained gene fragment was connected to the pUC57 vector.

[0248] The nucleotide sequence of the translation initiation element truncated fragment II (PPV-II) is shown in SEQ ID NO.47; the nucleotide sequence of the translation initiation element truncated fragment I (PPV-I) is shown in SEQ ID NO.48;

[0249] The nucleotide sequence of the translation initiation element truncated fragment II (PSV-II) is shown in SEQ ID NO.49; the nucleotide sequence of the translation initiation element truncated fragment I (PSV-I) is shown in SEQ ID NO.50;

[0250] The nucleotide sequence of the translation initiation element truncated fragment II (LTE-II) is shown in SEQ ID NO.51; the nucleotide sequence of the translation initiation element truncated fragment I (LTE-I) is shown in SEQ ID NO.52;

[0251] The nucleotide sequence of the translation initiation element truncated fragment II (CKV-II) is shown in SEQ ID NO.2; the nucleotide sequence of the translation initiation element truncated fragment I (CKV-I) is shown in SEQ ID NO.16;

[0252] The corresponding circular RNA was prepared according to the method of step 1.2 of Example 1, and finally a circular mRNA with the following sequence structure was obtained:

[0253] (1) IRES-CKV-truncated mutant gD nucleotide 1-stop codon (TGA)-polyAC; the circular mRNA was named CKV-gD2135, and the sequence is shown in SEQ ID NO.43.

[0254] (2) IRES-PPV-truncated mutant gD nucleotide 1-stop codon (TGA)-polyAC; the circular mRNA was named PPV-gD2135, and the sequence is shown in SEQ ID NO.44.

[0255] (3) IRES-PSV-truncated mutant gD nucleotide 1-stop codon (TGA)-polyAC; the circular mRNA was named PSV-gD2135, and the sequence is shown in SEQ ID NO.45.

[0256] (4) IRES-LTE-truncated mutant gD nucleotide 1-stop codon (TGA)-polyAC; the circular mRNA was named LTE-gD2135, and the sequence was shown in SEQ ID NO.46.

[0257] 5.2 LNP-mRNA preparation

[0258] Each circular mRNA molecule prepared in step 5.1 of this embodiment and the linear RNA molecule prepared in Example 4 were prepared into lipid nanoparticle / RNA compositions using commercial LNP (Precision NanoSystems). The specific steps are shown in Example 1, and LNP-encapsulated EVE-gD2135, LNP-encapsulated CKV-gD2135, LNP-encapsulated PPV-gD2135, LNP-encapsulated PSV-gD2135, LNP-encapsulated LTE-gD2135 and LNP-encapsulated linear-gD1103 were obtained. The results were tested to meet the requirements: the particle size distribution of each group of LNPs encapsulating mRNA was uniform, the encapsulation effect was good, and the encapsulation rate was greater than 90%; the surface potential was electrically neutral or electronegative, avoiding the cytotoxicity caused by the positive charge on the surface of the nanoparticles, and the biosafety was good.

[0259] 5.3 Pig Neutralizing Antibody Determination

[0260] The pseudorabies virus antibody was negative at 70-90 days of age. The screening criteria for experimental pigs are shown in Table 11 below. A total of 49 piglets were screened.

[0261] Table 11 Screening criteria for experimental pigs

[0262]

[0263] The experimental animals were divided into 7 groups, 7 in each group, and immunized. After preliminary dose exploration in the early stage, the vaccination dose was set at 100 μg / head in this experiment. At the same time, the control was set as follows:

[0264] Group 1: EVE-gD2135 encapsulated with LNP prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0265] Group 2: CKV-gD2135 encapsulated with LNP prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0266] Group 3: PPV-gD2135 encapsulated with LNP prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0267] Group 4: PSV-gD2135 encapsulated with LNP prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0268] Group 5: LTE-gD2135 encapsulated with LNP prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0269] Group 6: linear-gD1103 encapsulated with LNP prepared in step 5.2 of this example, with an immunization dose of 100 μg / head.

[0270] Group 7: LNP immunization group only, immunization dose 1 ml / head.

[0271] Each group was boosted with the same dose on day 28 after the first immunization. Serum was collected and prepared on day 7, day 28, and day 56 of the second immunization, and neutralizing antibody detection was performed according to the method in step 1.5 of Example 1.

[0272] The results are shown in Table 12. The change of the translation initiation element has a great influence on the effect of the vaccine in pigs: compared with the control EVE-gD2135 group, the neutralizing antibody titer after replacing its IRES with PPV (number PPV-gD2135) or LTE (number LTE-gD2135) was improved after 28 days of immunization, among which the PPV-gD2135 molecule had the highest increase (neutralizing antibody titer increased from 72.1 to 388.2, an increase of 5.4 times) and was preferred; but the neutralizing antibody titer after replacing with other IRES did not show a significant increase or even decreased significantly (number CKV-gD2135, PSV-gD2135). This result shows that it is effective and necessary to optimize the circular RNA backbone, especially IRES, for pig products.

[0273] Furthermore, the PPV-gD2135 group was significantly superior to the linear RNA molecule (numbered linear-gD1103 group) in terms of antibody response speed, neutralizing antibody titer achieved, and antibody duration. In addition, the PPV-gD2135 group rapidly produced high-titer neutralizing antibodies 7 days after 2 immunizations, indicating that this group of circular RNA vaccines produced a stronger immune memory effect, which can quickly respond to the immune system and provide better immune protection. The optimization and design of circular RNA vaccines around pseudorabies virus successfully improved the protective effect of the vaccine and provided a basis for the preparation of pseudorabies RNA vaccines.

[0274] Table 12 Neutralizing antibody titers induced in pigs

[0275]

[0276] 5.4 Detection of background immunogenicity in porcine cells

[0277] In order to preliminarily explore the mechanism of the improved effect of the PPV-gD2135 group, the expression of the immune-related cytokine IFN-beta induced by each group of RNA molecules in step 5.3 of this example in porcine intestinal epithelial cells (IPEC-J2) was further detected to evaluate the background immunogenicity of each molecule. The operation method refers to patent CN 114574483 A, as follows:

[0278] The purified circular mRNA was transfected into IPEC-J2 cells using Lipofectamine Messenger Max (Invitrogen). The specific implementation process is as follows:

[0279] IPEC-J2 cells were inoculated in DMEM high-glucose medium containing 10% fetal bovine serum and 1% double antibody and cultured in a 37°C, 5% CO2 incubator. Cells were subcultured every 2-3 days.

[0280] (1) Cell transfection:

[0281] Before transfection, IPEC-J2 cells were cultured at 1×10 5 Each well was inoculated in a 24-well plate and cultured in a 37°C, 5% CO2 incubator. When the cells reached 70-90% confluence, the IPEC-J2 cells were transfected with 500 ng / well of mRNA using Lipofectamine MessengerMax (Invitrogen) transfection reagent according to the reagent operating instructions. The cells expressing for 8 hours were harvested, lysed, and the expression level of immune response proteins was verified by fluorescence quantitative PCR.

[0282] (2) Fluorescence quantitative PCR

[0283] The primer sequences used are as follows:

[0284] IFNb-F:TGGGAGGATTCTGCATTACC

[0285] IFNb-R: CAGCATCGCTGGTTGAGA

[0286] The results are shown in Table 13. Although the background immunogenicity of circular RNA molecules is lower than that of linear RNA molecules, surprisingly, the difference in IRES has a greater impact on the results in pig somatic cells: although the IRES of EVE-gD2135 and CKV-gD2135 has low background immunity in human cell lines, they show high background immunogenicity in pig intestinal epithelial cells, indicating that the response mechanisms of the two cells are different and cannot be simply applied. Although the LTE-gD2135 group has a slight improvement, the effect is not obvious, while the optimized PPV-gD2135 molecule greatly reduces the induction of immunogenicity in pig intestinal epithelial cells, which is conducive to improving the stability and expression efficiency of RNA molecules in pig somatic cells, which may be an important mechanism to improve the immune effect of vaccines in pigs.

[0287] Table 13 Induction of expression of immune-related cytokine IFN-beta in pig cells

[0288] Grouping Mean SD value EVE-gD2135 188.2 102.2 CKV-gD2135 157.6 56.9 PPV-gD2135 85.4 12.7 PSV-gD2135 266.1 25.9 LTE-gD2135 117.2 32.8 linear-gD1103 312.4 54.5 Negative control 10.9 2.7

[0289] Example 6 Cellular Immune Response Detection

[0290] The cellular immune response stimulated by each group of RNA vaccines in pigs was further detected. For each immunization group (PPV-VP1-5147 group, EVE-VP1-5147 group, linear-VP1-1051, LNP group) in step 5.3 of Example 5, blood PBMC cells were collected and the corresponding lymphocyte subtypes were detected by flow cytometry. The specific operation is as follows:

[0291] (1) 14 days after the second immunization, anticoagulated blood was collected from each group and single cell suspensions were prepared;

[0292] (2) Cell density adjustment and density counting: After filtering the above single cell suspension through a 100 μm cell sieve, take 18 μL and add it to a 200 μL EP tube, add 2 μL of trypan blue and mix well, then take 10 μL and add it to a counting plate for cell counting, and dilute it with an appropriate amount of PBS solution until the density of the single cell suspension is 1×10 6 / mL; observe the number of dead cells and living cells under a microscope. Antibody incubation can be carried out only after the cell density and cell viability of the single cell suspension meet the requirements.

[0293] (3) Antibody incubation:

[0294] (4) Preparation of single-stained tubes: Take 0.5 mL of the single-cell suspension of each group into three 1.5 mL EP tubes, and add 1 μL of fluorescein isothiocyanate (FITC)-labeled mouse anti-swine CD3 antibody (BD Company), 1 μL of phycoerythrin PE-labeled mouse anti-swine CD4 antibody (BD Company), and 1 μL of allophycocyanin fluorescein APC-labeled mouse anti-swine CD8 antibody (BD Company) in sequence. Incubate at 4°C in the dark for 30 min, then centrifuge at 1000 rpm for 5 min, remove the supernatant, resuspend with 0.5 mL PBS, and place on ice. Add 2.5 μL of 7-aminoactinomycin D (eBioscience Company) to each tube before loading.

[0295] (5) Preparation of sample tubes: Take 1 mL of the single cell suspension from each group into a 1.5 mL EP tube and add 2 μL of FITC-labeled mouse anti-swine CD3 antibody (BD Company), 5 μL of PE-labeled mouse anti-swine CD4 antibody (BD Company), and 5 μL of APC-labeled mouse anti-swine CD8 antibody (BD Company). Incubate at 4°C in the dark for 30 min, then centrifuge at 1000 rpm for 5 min, remove the supernatant, resuspend with 1 mL of PBS, and place on ice. Add 5 μL of 7-aminoactinomycin D (eBioscience Company) to each tube before loading.

[0296] (6) Sorting on the flow cytometer: Sorting was performed on the flow cytometer (BD Aria SORP, BD). The above tubes were filtered into the flow tubes with a 100 μm cell sieve and marked. First, the blank tube was used to determine the location of lymphocytes, and then the single-stained tube was used to determine whether the antibody labeling was good. If the labeling was good (i.e., the antibody fluorescence signal value was 10 3The samples were placed in the sample tubes, and CD4-CD8- double negative cells, CD4+CD8+ double positive cells, CD4+CD8- single positive cells, and CD4-CD8+ single positive cells were circled and sorted. Unpaired t-test was used for statistical significance analysis, * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001.

[0297] The results are as follows Figure 2 As shown, the linear-gD1103 group can induce an increase in CD4+ cells in pigs, but failed to stimulate CD8+ cells. The proportion of the two T cells in the PPV-gD2135 group after amino acid optimization, nucleotide optimization and IRES optimization was significantly higher than that in the other groups, indicating that this group successfully activated the cellular immune response, especially the CD8+T cell immune response, further improving the protective effect of the vaccine.

[0298] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A circular RNA, characterized in that The circular RNA comprises a coding element, which encodes a polypeptide comprising a pseudorabies virus envelope protein.

2. The circular RNA according to claim 1, characterized in that The coding element code includes any one of (a) to (d): (a) the amino acid sequence of the pseudorabies virus envelope protein gB protein comprises the sequence shown in SEQ ID NO.3, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO.3, and having or partially having the activity of gB protein; (b) the amino acid sequence of the pseudorabies virus envelope protein gC protein comprises the sequence shown in SEQ ID NO.5, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO.5 and having or partially having the activity of the gC protein; (c) the amino acid sequence of the pseudorabies virus envelope protein gD protein comprises the sequence shown in SEQ ID NO.7, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO.7 and having or partially having the activity of gD protein; (d) The amino acid sequence of the pseudorabies virus envelope protein gK protein comprises the sequence shown in SEQ ID NO. 9, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO. 9 and having or partially having gK protein activity.

3. The circular RNA according to claim 1 or 2, characterized in that The coding element encodes any one of the following: pseudorabies virus envelope gD protein N-terminal truncation of 10 amino acids, N-terminal truncation of 21 amino acids, N-terminal truncation of 27 amino acids, N-terminal truncation of 28 amino acids, C-terminal truncation of 5 amino acids, comprising mutation V154Y, comprising mutation Q187D, comprising mutation Q187L, comprising mutation C117L, comprising mutation R88E, comprising mutation V154P, comprising mutation V154Y / Q187D, comprising mutation V154Y / R88E, comprising mutation V154Y / Q187D / R88E, N-terminal truncation of 27 amino acids / mutation V154Y / Q187D, N-terminal truncation of 25 amino acids / mutation V154Y / Q187D or N-terminal truncation of 28 amino acids / mutation V154Y / Q187D, and wild-type pseudorabies virus envelope gD protein.

4. The circular RNA according to claim 1, characterized in that The coding element code includes any one of the following (a) to (d): (a) the nucleotide sequence of the pseudorabies virus gB protein comprises the sequence shown in SEQ ID NO. 4, or has at least 90% sequence identity with the sequence shown in SEQ ID NO. 4, and encodes a polypeptide having or partially having the activity of the pseudorabies virus gB protein; (b) the nucleotide sequence of the pseudorabies virus gC protein comprises the sequence shown in SEQ ID NO.6, or has at least 90% sequence identity with the sequence shown in SEQ ID NO.6, and encodes a polypeptide having or partially having the activity of the pseudorabies virus gC protein; (c) the nucleotide sequence of the pseudorabies virus gD protein comprises the sequence shown in SEQ ID NO.8, or has at least 90% sequence identity with the sequence shown in SEQ ID NO.8, and encodes a polypeptide having or partially having the activity of the pseudorabies virus gD protein; (d) The nucleotide sequence of the pseudorabies virus gK protein comprises the sequence shown in SEQ ID NO. 10, or has at least 90% sequence identity with the sequence shown in SEQ ID NO. 10, and encodes a sequence having or partially having the activity of a polypeptide having the activity of the pseudorabies virus gK protein.

5. The circular RNA according to claim 1 or 4, characterized in that The coding element comprises a nucleotide sequence encoding any one of the following: pseudorabies virus envelope gD protein with N-terminal truncation of 10 amino acids, N-terminal truncation of 21 amino acids, N-terminal truncation of 27 amino acids, N-terminal truncation of 28 amino acids, C-terminal truncation of 5 amino acids, mutation V154Y, mutation Q187D, mutation Q187L, mutation C117L, mutation R88E, mutation V154P, mutation V154Y / Q187D, mutation V154Y / R88E, mutation V154Y / Q187D / R88E, N-terminal truncation of 27 amino acids / mutation V154Y / Q187D, N-terminal truncation of 25 amino acids / mutation V154Y / Q187D or N-terminal truncation of 28 amino acids / mutation V154Y / Q187D, and wild-type pseudorabies virus envelope gD protein.

6. The circular RNA according to claim 1, characterized in that The coding element comprises any one of the following nucleotide sequences encoding the pseudorabies virus envelope gD protein N-terminal truncated 27 amino acids / mutation V154Y / Q187D: Nucleotide sequence 1 as shown in SEQ ID NO.33, nucleotide sequence 2 as shown in SEQ ID NO.34, nucleotide sequence 3 as shown in SEQ ID NO.35, nucleotide sequence 4 as shown in SEQ ID NO.36, and nucleotide sequence 5 as shown in SEQ ID NO.

37.

7. The circular RNA according to claim 1, characterized in that The circular RNA comprises the elements arranged in the order shown in any one of the following (a) to (d): (a) the first exon, the second exon, the 5' spacer, the translation initiation element, the coding element and the 3' spacer; (b) first exon, second exon, translation initiation element and coding element; (c) translation initiation elements and coding elements; (d) Translation initiation elements, coding elements and insertion elements.

8. The circular RNA according to claim 7, characterized in that The translation initiation element comprises one or more of the following sequences with translation initiation activity: an IRES sequence, a 5'UTR sequence, a Kozak sequence, a sequence comprising m 6 A modified sequence, a complementary sequence of ribosomal 18S rRNA; the insertion element comprises one or more of the following sequences: a non-translated region sequence, a polyN sequence, an adapter sequence, a ribosomal switch sequence, and a sequence binding to a transcriptional regulatory factor; wherein, in the polyN sequence, N is selected from at least one of A, T, G, and C.

9. The circular RNA according to claim 7 or 8, characterized in that A nucleotide sequence comprising any one of SEQ ID NO.38 to SEQ ID NO.42, or a nucleotide sequence comprising any one of SEQ ID NO.43 to SEQ ID NO.

46.

10. A linear RNA, characterized in that The linear RNA undergoes self-cleavage reaction and then circularizes to form the circular RNA according to any one of claims 1 to 9.

11. The linear RNA according to claim 10, characterized in that The linear RNA comprises elements arranged in the following order: (i) an intron fragment II comprising the sequence shown in SEQ ID NO.1, a translation initiation element truncated fragment II comprising the sequence shown in SEQ ID NO.47, a coding element comprising the sequence shown in SEQ ID NO.33, a polyAC comprising the sequence shown in SEQ ID NO.15, a translation initiation element truncated fragment I comprising the sequence shown in SEQ ID NO.48, and an intron fragment I comprising the sequence shown in SEQ ID NO.

17.

12. A recombinant nucleic acid molecule, characterized in that The recombinant nucleic acid molecule forms a linear RNA after transcription; the linear RNA is as shown in claim 10 or 11, or the linear RNA undergoes a self-cleavage reaction and then cyclizes to form a circular RNA as described in any one of claims 1-9.

13. A recombinant Escherichia coli engineered bacterium, characterized in that: The engineered bacteria are obtained by transforming E. coli with the recombinant nucleic acid molecule as claimed in claim 12.

14. Use of the circular RNA according to any one of claims 1 to 9, or the linear RNA according to claim 10 or 11, or the recombinant nucleic acid molecule according to claim 12, or the recombinant Escherichia coli engineered bacteria according to claim 13 in the preparation of a drug for preventing and / or treating pseudorabies.

Images