RT-LAMP-CRISPR / Cas12b-based beet western yellow virus microfluidic detection kit and method

Abstract

The invention belongs to the technical field of molecular biology, immunology and virology, and discloses an RT-LAMP-CRISPR / Cas12b-based micro-fluidic detection kit and method for beet western yellow virus, isothermal amplification LAMP and CRISPR / Cas12b detection are connected in a reaction chamber by utilizing a raffinose dynamic diffusion system, and simultaneous detection of multiple samples is realized through a micro-fluidic chip. The detection method effectively avoids aerosol pollution, has the advantages of excellent specificity, sensitivity and visualization, is simple and convenient to operate, does not need expensive instruments and equipment, can simply, conveniently and quickly detect whether pepper and beet samples are infected by beet western yellowing virus in the field, and improves the detection efficiency.

Description

Technical Field

[0001] The present invention belongs to the technical fields of molecular biology, immunology and virology, and in particular relates to a microfluidic detection kit and method for beet western yellows virus based on RT-LAMP-CRISPR / Cas12b. Background Art

[0002] Beet western yellows virus (BWYV) was first discovered in radishes and beets in North America in 1960. It was subsequently found in beets in Czechoslovakia, Israel, Japan, China, and other places. BWYV has a wide host range and can infect more than 150 dicotyledonous plants. In particular, after infecting pepper plants, it can cause leaf curling, shrinking and yellowing, and fruit discoloration and shrinkage, causing huge economic losses.

[0003] At present, the detection of BWYV mainly adopts reverse transcription polymerase chain reaction (RT-PCR), but this method has problems such as dependence on expensive precision instruments, professional training personnel and long detection cycle (about 2 hours). Clustered regularly interspaced short palindromic repeats (CRISPR) are composed of a series of repeated DNA sequences and spacer sequences, and CRISPR associated protein (Cas) constitutes the CRISPR / Cas system, which is widely present in archaea and many bacteria, and is an important immune mechanism for prokaryotes to deal with foreign nucleic acid invasion. Recent studies have shown that the CRISPR / Cas system is not only widely used in the field of gene editing, but also shows great potential as a new nucleic acid detection method, especially in the detection of pathogens. It is highly practical. At present, various Cas proteins can effectively cut the target gene sequence under the guidance of sgRNA, among which Cas12b protein has excellent target gene sequence specific recognition ability and efficient trans-cutting activity. Therefore, the characteristic of Cas12b protein being activated by a specific target can be used to achieve specific detection of target single-stranded DNA. Existing rapid nucleic acid detection methods include loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA). Although these methods have gotten rid of the reliance of traditional amplification technology on temperature control modules, false positive amplification is very likely to occur in practical applications. The CRISPR / Cas12b system has the same reaction temperature as LAMP and has perfect complementarity, which can significantly improve the specificity of isothermal amplification. However, the two-step detection strategy is currently mainly used, which poses an obvious risk of aerosol contamination.

[0004] Therefore, it is urgent to develop a method based on RTLAMP and CRISPR / Cas12b technology combined with microfluidic chips to achieve rapid, low-cost, and one-pot field detection of BWYV-related diseases.

[0005] Through the above analysis, the problems and defects of the prior art are as follows:

[0006] Currently, the two-step detection strategy is mainly used, which poses an obvious risk of aerosol contamination. Summary of the invention

[0007] In view of the problems existing in the prior art, the present invention provides a beet western yellows virus microfluidic detection kit and method based on RT-LAMP-CRISPR / Cas12b.

[0008] The present invention is implemented in this way: a detection method of a beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b comprises:

[0009] Step 1, extracting RNA from the sample to be tested;

[0010] Step 2, adding the sample RNA to be tested into the sample loading chamber of the microfluidic chip;

[0011] Step 3, pre-loading a CRISPR / Cas12b detection system comprising the crRNA and the probe in the detection chamber of the microfluidic chip;

[0012] Step 4, mixing the raffinose with the RT-LAMP amplification system containing the primers, and then adding the mixture into the injection well;

[0013] Step 5, step 2 is pushed by step 4 and gathered at the bottom of step 3;

[0014] Step 6, placing the microfluidic chip completed in step 5 in a constant temperature heater for amplification and detection to obtain a detection product;

[0015] Step 7, the detection product is tested with a Cas12 nucleic acid test strip. Red strips appear on both the test strip quality control line and the test line, and the result is positive; red strips appear on the test strip quality control line, and the test line does not show color, and the result is negative; the test strip quality control line is the C line; and the test line is the T line.

[0016] Furthermore, the CRISPR / Cas12b detection system described in step 3 is: 3 μL of 10×Cas12b reaction buffer, 1 μL of 5 μM AapCas12b protease, 5 μL of 500 nM crRNA, 12 μL of 2 μM ssDNA probe, and pure water is added to 30 μL.

[0017] Furthermore, the RT-LAMP amplification system in step 4 is: 2×LAMP Master Mix 12.5 μL, inner primers FIP and BIP (40 μM) 1.6 μL each, outer primers F3 and B3 (5 μM) 0.2 μL each, loop primer LB (20 μM) 0.4 μL, betaine (5 M) 3 μL, sample RNA to be tested 1 μL, and pure water is added to make up to 25 μL.

[0018] Furthermore, in step 7, the amplification and detection conditions are 57° C. for 1 hour.

[0019] Another object of the present invention is to provide a beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b, comprising an RT-LAMP amplification system and a CRISPR / Cas12b detection system.

[0020] The RT-LAMP amplification primers include the following primer pairs: F3 / B3 nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; FIP / BIP nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4; LB nucleotide sequence is shown in SEQ ID NO.5;

[0021] The CRISPR / Cas12b detection system includes a crRNA nucleotide sequence as shown in SEQ ID NO.6; a ssDNA sequence as shown in SEQ ID NO.7;

[0022] Also included was raffinose at a concentration of 0.1 g / ml;

[0023] Furthermore, it also includes a microfluidic chip, which includes an injection hole for isothermal amplification using the primers and the cottonseed sugar, a sample loading chamber for the sample to be tested, a detection chamber for detection using the crRNA and the probe, a 1000μm microchannel connecting the injection hole and the loading chamber, and a 1000μm Tesla valve connecting the loading chamber and the detection chamber.

[0024] Another object of the present invention is to provide a detection system of a beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b, comprising:

[0025] A sample loading module, used for adding the sample RNA to be tested into the sample loading chamber of the microfluidic chip;

[0026] A loading module, used for pre-loading the CRISPR / Cas12b detection system comprising the crRNA and the probe in the detection chamber of the microfluidic chip;

[0027] A mixing module, used for mixing the cottonseed sugar with the RT-LAMP amplification system containing the primers and the RNA to be tested in a Tesla valve microchannel;

[0028] A gathering module, used for adding modules to gather at the bottom of the loading module under the push of the mixing module;

[0029] An amplification module is used to place the completed microfluidic chip in a constant temperature heater for amplification and detection to obtain a detection product;

[0030] The detection module is used to perform Cas12 nucleic acid test strip detection on the detection product. If red strips appear on both the test strip quality control line and the test line, the result is positive; if red strips appear on the test strip quality control line and the test line does not show color, the result is negative; the test strip quality control line is the C line; the test line is the T line.

[0031] In combination with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0032] First, the present invention integrates the RT-LAMP amplification system and the CRISPR / Cas12b detection system through a raffinose-mediated dynamic diffusion system, thereby realizing one-pot, pollution-free virus detection.

[0033] The RT-LAMP amplification and CRISPR / Cas12b detection of the present invention are both reacted under isothermal conditions of 57° C. The reaction temperature does not need to be adjusted during the entire process, and the experimental results can be displayed in only 1 hour.

[0034] The microfluidic chip of the present invention is highly integrated and can perform virus detection on 6 plant samples at the same time.

[0035] The microfluidic chip of the present invention adds an anti-backflow microchannel between the sample addition chamber and the detection chamber, which effectively avoids cross contamination between samples while mixing the RNA to be tested and the RT-LAMP reagent.

[0036] The microfluidic chip of the present invention has low production cost and can be used in combination with Cas12 nucleic acid test strips to realize visual virus detection in the field.

[0037] Second, the technical solution of the present invention effectively solves the problems of slow detection speed, complicated operation and low sensitivity in the existing beet western yellowing virus (BWYV) detection methods in industrial applications. Traditional detection methods usually require professional laboratory equipment and technicians to complete. Technologies such as RT-PCR have high requirements for equipment and environment, which limits their application in field or non-professional environments. In addition, the detection cycle of traditional methods is long, which makes it difficult to meet the needs of rapid detection and timely prevention and control. The low-sensitivity detection method also leads to the neglect of viral infection, which in turn damages the growth and yield of crops.

[0038] The present invention realizes efficient and convenient virus detection by combining RT-LAMP isothermal amplification, CRISPR / Cas12b system and microfluidic chip. The RT-LAMP amplification system rapidly amplifies the target RNA under constant temperature conditions, which not only improves the amplification efficiency, but also simplifies the temperature control requirements, making on-site operation easier. With the help of the specific recognition ability of CRISPR / Cas12b and the mechanism of cutting probes, the specificity and sensitivity of the detection are greatly enhanced, and low-concentration viral RNA can be detected. The application of microfluidic chips further optimizes the detection process, reduces the manual operation steps through the automated flow and control within the chip, and shortens the detection time.

[0039] In addition, the present invention adopts Cas12 nucleic acid test strips as the final color development detection method, so that the test results are visualized and intuitive. Through the color development of the quality control line and the test line on the test strip, the user can judge the test results without complex instruments, providing a convenient means for rapid on-site diagnosis. Compared with traditional detection methods, the detection method of the present invention greatly reduces the dependence on equipment, shortens the detection cycle, improves the detection sensitivity and accuracy, and makes the rapid detection of BWYV applied in the field field, which helps to timely discover and control the spread of the virus. This innovation has significant technological progress and industrial application value in increasing crop yields and ensuring the quality and efficiency of agricultural production.

[0040] Third, currently, the detection of beet western yellows virus (BWYV) is of great significance in agricultural production, but the existing detection methods have the following major technical problems:

[0041] 1. Slow detection speed: Traditional molecular biological detection methods, such as RT-PCR, usually take several hours or even longer to complete the detection process, which is difficult to meet the needs of rapid diagnosis and immediate decision-making, especially in large-scale field testing.

[0042] 2. High dependence on equipment: Existing virus detection methods usually rely on complex and expensive experimental equipment, such as thermal cyclers and fluorescence detectors, which limits their application in field environments with limited resources and increases detection costs and operational complexity.

[0043] 3. Complex operation: Traditional detection methods require multiple steps, including RNA extraction, reverse transcription, amplification and detection. Each step requires professional technicians to operate and is easily affected by human operation errors, which reduces the reliability and consistency of the detection.

[0044] 4. Limited sensitivity and specificity: Some existing detection methods have insufficient detection sensitivity in low viral load samples and are prone to false negative results. In addition, some methods have low specificity between different virus strains, resulting in false positive results and affecting the accuracy of the test.

[0045] 5. Poor portability: Existing detection equipment is large in size and heavy in weight, which is not suitable for mobile detection and rapid on-site diagnosis, limiting its widespread application in agricultural production, especially in remote or resource-scarce areas.

[0046] The present invention proposes a detection method of a beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b, and has achieved the following significant technical progress in view of the above technical problems:

[0047] 1. Significantly improve the detection speed: The detection method of the present invention integrates reverse transcription loop-mediated isothermal amplification (RT-LAMP) and CRISPR / Cas12b-mediated specific detection technology, and realizes rapid RNA amplification and real-time detection on a microfluidic chip. The entire detection process can be completed in only about 60 minutes, which greatly shortens the detection time compared to the traditional RT-PCR method, meeting the needs of rapid diagnosis and immediate decision-making.

[0048] 2. Reduce equipment dependence: The microfluidic detection kit of the present invention is designed as a portable device, using a simplified constant temperature heater instead of a complex thermal cycler, combined with Cas12 nucleic acid test strips to achieve visual reading, significantly reducing dependence on expensive detection equipment. This design is suitable for use in field environments, especially in agricultural production areas with limited resources, and improves the flexibility and operability of detection.

[0049] 3. Simplified operation process: By integrating isothermal amplification and specific detection steps, the detection method of the present invention greatly simplifies the operation process, reduces the operation steps and the professional level requirements of the required technicians. Users only need to follow the preset steps, without complicated experimental operations, reducing the risk of human operation errors and improving the consistency and reliability of detection.

[0050] 4. Improve detection sensitivity and specificity: Combining the efficient amplification ability of RT-LAMP and the specific recognition of CRISPR / Cas12b, the detection method of the present invention shows higher sensitivity in low viral load samples and can effectively detect trace amounts of viral RNA. In addition, the specific crRNA design ensures high specificity for BWYV, reduces the occurrence of false positive and false negative results, and improves the accuracy of detection.

[0051] 5. Enhanced portability and field application capabilities: The design of the microfluidic chip makes the entire detection device small and light, easy to carry and move. Combined with the visual reading method of the Cas12 nucleic acid test strip, without relying on complex instruments and equipment, users can quickly perform virus detection in the field or other field environments, timely understand the health status of crops, and guide precision agricultural management and disease prevention and control.

[0052] 6. Significant cost-effectiveness: The detection method of the present invention uses simple and readily available reagents and materials, has a low production cost, and is suitable for large-scale promotion and application. The mass production of microfluidic chips and the low-cost manufacturing of Cas12 nucleic acid test strips have greatly reduced the overall detection cost and improved the economy, making it suitable for widespread application in conventional detection needs in agricultural production.

[0053] The present invention integrates RT-LAMP and CRISPR / Cas12b technologies, combines microfluidic chips and Cas12 nucleic acid test strips, and realizes a rapid, sensitive, portable and highly specific detection method for beet western yellows virus. In industrial applications, the present invention effectively solves key technical problems in the prior art such as slow detection speed, strong equipment dependence, complex operation, insufficient sensitivity and specificity, and poor portability. By significantly improving detection efficiency and accuracy and reducing equipment and operating costs, the technical solution of the present invention has broad application prospects and promotion value in agricultural disease management, promotes the development of rapid detection technology for plant diseases, and promotes the realization of precision agriculture and intelligent agricultural management. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 It is a flow chart of the detection method of the beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b provided in an embodiment of the present invention.

[0055] Figure 2 It is a structural block diagram of the detection system of the beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b provided in an embodiment of the present invention.

[0056] Figure 3 It is a diagram of the screening results of the primer set in the RT-LAMP system provided in the embodiment of the present invention.

[0057] Figure 4 It is a diagram showing the optimization results of primer ratios in the RT-LAMP system provided in an embodiment of the present invention.

[0058] Figure 5 This is a diagram showing the optimization results of betaine concentration in the RT-LAMP system provided in an embodiment of the present invention.

[0059] Figure 6This is a graph showing the results of a crRNA concentration optimization experiment in a CRISPR detection system provided in an embodiment of the present invention.

[0060] Figure 7 This is a graph showing the results of an experiment to optimize the concentration of ssDNA probes in the CRISPR detection system provided in an embodiment of the present invention.

[0061] Figure 8 It is a schematic diagram of the structure of the microfluidic chip provided in an embodiment of the present invention.

[0062] Fig. 9 This is a sensitivity test evaluation result diagram of the one-pot microfluidic detection system of RT-LAMP-CRISPR / Cas12b provided in an embodiment of the present invention.

[0063] Fig.10 This is a graph showing the specificity test evaluation results of the one-pot microfluidic detection system of RT-LAMP-CRISPR / Cas12b provided in an embodiment of the present invention.

[0064] Fig.11 This is a comparison result diagram of one-pot microfluidic detection and RT-PCR bands in a field detection experiment provided by an embodiment of the present invention. DETAILED DESCRIPTION

[0065] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0066] like Figure 1 As shown, a detection method of a beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b provided in an embodiment of the present invention comprises the following steps:

[0067] S101, extracting RNA from the sample to be tested;

[0068] S102, adding the sample RNA to be tested into the sample loading chamber of the microfluidic chip;

[0069] S103, pre-loading a CRISPR / Cas12b detection system comprising the crRNA and the probe in the detection chamber of the microfluidic chip;

[0070] S104, mixing the raffinose with the RT-LAMP amplification system containing the primers, and then adding the mixture to the injection well;

[0071] S105, S102 gathers at the bottom of S103 under the push of S104;

[0072] S106, placing the microfluidic chip completed in S105 in a constant temperature heater for amplification and detection to obtain a detection product;

[0073] S107, the detection product is tested on the Cas12 nucleic acid test strip. If red strips appear on both the test strip quality control line and the test line, the result is positive; if red strips appear on the test strip quality control line and the test line does not show color, the result is negative; the test strip quality control line is the C line; the test line is the T line.

[0074] The CRISPR / Cas12b detection system described in S103 provided in an embodiment of the present invention is: 3 μL of 10×Cas12b reaction buffer, 1 μL of 5 μM AapCas12b protease, 5 μL of 500 nM crRNA, 12 μL of 2 μM ssDNA probe, and pure water is added to 30 μL.

[0075] The RT-LAMP amplification system in S104 provided in the embodiment of the present invention is: 2×LAMP Master Mix 12.5 μL, inner primers FIP and BIP (40 μM) 1.6 μL each, outer primers F3 and B3 (5 μM) 0.2 μL each, loop primer LB (20 μM) 0.4 μL, betaine (5 M) 3 μL, sample RNA to be tested 1 μL, and pure water is added to make up to 25 μL.

[0076] In S107 provided in the embodiment of the present invention, the amplification and detection conditions are 57° C. for 1 hour.

[0077] The embodiment of the present invention provides a beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b, comprising an RT-LAMP amplification system and a CRISPR / Cas12b detection system.

[0078] The RT-LAMP amplification primers include the following primer pairs: F3 / B3 nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; FIP / BIP nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4; LB nucleotide sequence is shown in SEQ ID NO.5;

[0079] The CRISPR / Cas12b detection system includes a crRNA nucleotide sequence as shown in SEQ ID NO.6; a ssDNA sequence as shown in SEQ ID NO.7;

[0080] Also included was raffinose at a concentration of 0.1 g / ml;

[0081] The invention also includes a microfluidic chip, which includes an injection hole for isothermal amplification using the primers and the cottonseed sugar, a sample loading chamber for a sample to be tested, a detection chamber for detection using the crRNA and the probe, a 1000 μm microchannel connecting the injection hole and the loading chamber, and a 1000 μm Tesla valve connecting the loading chamber and the detection chamber.

[0082] like Figure 2 As shown, a detection system of a beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b provided in an embodiment of the present invention comprises:

[0083] A sample loading module, used for adding the sample RNA to be tested into the sample loading chamber of the microfluidic chip;

[0084] A loading module, used for pre-loading the CRISPR / Cas12b detection system comprising the crRNA and the probe in the detection chamber of the microfluidic chip;

[0085] A mixing module, used for mixing the cottonseed sugar with the RT-LAMP amplification system containing the primers and the RNA to be tested in a Tesla valve microchannel;

[0086] A gathering module, used for adding modules to gather at the bottom of the loading module under the push of the mixing module;

[0087] An amplification module is used to place the completed microfluidic chip in a constant temperature heater for amplification and detection to obtain a detection product;

[0088] The detection module is used to perform Cas12 nucleic acid test strip detection on the detection product. If red strips appear on both the test strip quality control line and the test line, the result is positive; if red strips appear on the test strip quality control line and the test line does not show color, the result is negative; the test strip quality control line is the C line; the test line is the T line.

[0089] The present invention is specifically implemented:

[0090] Main experimental materials: HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, USA), RNase inhibitor, 2×Taq Plus MasterMix and DNase / RNase FreeddH2O were all purchased from Kangwei Century, 2×LAMP MasterMix (New England Biolabs, USA); the universal RNA extraction kit was purchased from Beijing Coolaibo Technology Co., Ltd.; the cDNA reverse transcription kit was purchased from Yubao Bioengineering Co., Ltd.; ssDNA probes, Cas12b protein and Cas12 nucleic acid test strips were all purchased from Guangzhou Aidi Gene Technology Co., Ltd.

[0091] Main instruments: full-wavelength microplate reader, ordinary PCR instrument (Biometra TONE Germany), constant temperature water bath (Shanghai Yuejin Medical Instrument Co., Ltd.), nucleic acid electrophoresis instrument (Beijing Liuyi Instrument Factory), UV gel imager (Hunan Aikerui Bioengineering Co., Ltd.), UV-visible spectrophotometer (Shanghai Yuanxi Instrument Co., Ltd.), etc.

[0092] The total RNA of the sample to be tested was extracted as a reaction template by mixing 300 μL of lysis solution (20 mM NaoH+6% PEG+1 μL RNase) with the sample juice.

[0093] Example 1 Establishment of RT-LAMP-CRISPR / 12b detection system

[0094] 1. Establishment of RT-LAMP detection system

[0095] 1.1 Primer design

[0096] LAMP amplification primers were designed according to the BWYV Rep gene sequences of different genotypes (AF473561.1, ON924237, KU521325.1, LC198684.1, MK307780.1, ON759519.1, EU636990.1, EU636991.1, KU521326.1, HM804472.1, HM804471.1, AB903032.1, AB903036.1). The primers were synthesized by Xi'an Qingke Biotechnology Co., Ltd. The primer sequences are as follows:

[0097] Primer Set 1:

[0098] FIP: GCTTCCCCGTTGAAGGTGAAGA CTTGCAAGGCCGTACACTT(SEQ ID NO.8)

[0099] BIP: TCACAGGGATCTCCCCCTGCACTGTGCCCTGGATCTGT (SEQ ID NO.9)

[0100] LF: TGCAGAGGTTGGATGCTGTTT (SEQ ID NO.10)

[0101] LB: CGCAAATTCGTCTCTGTCCTGAG (SEQ ID NO.11)

[0102] F3: ACCAAACTGGGAAGGAACC (SEQ ID NO.12)

[0103] B3: ACCCAATAGCGTTTTGCCAT (SEQ ID NO.13)

[0104] Primer set 2:

[0105] FIP: GTGGGGGGCAGTCGTAAGTCAGGCTACACAGAGCTTGCG (SEQ ID NO.14)

[0106] BIP: GCAGGATTATTCCTCGCGCGAATGCCCTTGACAAGGAGGT (SEQ ID NO.15)

[0107] LF: GCACTCGAGGAATGTAATGAGGC (SEQ ID NO.16)

[0108] LB: GGAGAGGATACACAAACACCAGG (SEQ ID NO.17)

[0109] F3: CCAACGTCACCGTTTGGC (SEQ ID NO.18)

[0110] B3: TGCACACCAGACCGAAAG (SEQ ID NO.19)

[0111] Primer set 3:

[0112] FIP: TCAACCCATCCCCGGTGTGTGT GTTTGACGCTGGAATCGGAG (SEQ ID NO.20)

[0113] BIP: CTTCCCGTTTTAGCTCGCCTGA GGGGAAAGCTCTTCAAACCT (SEQ ID NO.21)

[0114] LF: GGTTTCCCGTATGCGATGTACG (SEQ ID NO.22)

[0115] LB: ATCCGATTACAGAGATGTTGGAGG (SEQ ID NO.23)

[0116] F3: CAAGCTGTTTTCTCGCTCGA (SEQ ID NO.24)

[0117] B3: TTCTTGCACTAGCTGCTCC (SEQ ID NO.25)

[0118] Primer set 4:

[0119] FIP: TTCAATTCCGCTTGGGCCCCACTCCACCCAGAGTTGGC (SEQ ID NO.26)

[0120] BIP: ATCCTTGCGGCTACAAGCCG TCCCGCTCCTCAGTTGAG (SEQ ID NO.27)

[0121] LF: CGAAGCCACGGGTCTGTACT (SEQ ID NO.28)

[0122] LB: GAACGCGCCCAGCAAGTTA (SEQ ID NO.29)

[0123] F3: TTGGGGAGCAAAAGTCCTC (SEQ ID NO.30)

[0124] B3: GCCTCGCAGCATTTCCTT (SEQ ID NO.31)

[0125] Primer set 5:

[0126] FIP: CGCGGAGCTTGCTTGTTGTTT GATATGGAAGTCCGCAACCG (SEQ ID NO.3)

[0127] BIP: CAGTGTCCTGTGCCTATCCGAC GGAGGTTGTAGCTTCCTG (SEQ ID NO.4)

[0128] LB: CGTGTGCCTGGAGTTCAGAA (SEQ ID NO.5)

[0129] F3: CGGACTGGCTTCTTGGAGA (SEQ ID NO.1)

[0130] B3:GGAAAGCTGCCATCACTCT(SEQ ID NO.2)

[0131] 1.2 Establishment of RT-LAMP detection method

[0132] According to Table 2, the LAMP amplification system was established and the reaction was carried out on ice. After the reaction system was prepared, vortexed and mixed, then centrifuged instantly, reacted at 63°C for 40 minutes, and inactivated at 80°C for 5 minutes. After the reaction, centrifuged instantly, 5 μL of sample was taken and added with 2 μL of HNB, and the reaction results were observed by 2% agarose gel electrophoresis.

[0133] Table 2 RT-LAMP reaction amplification system (25 μL)

[0134] Reagent name Volume (μL) 2×MasterMix (premix) 12.5 DetectionCoponent (Indicator) 1 40 μM FIP / BIP 1.6 5μM F3 / B3 0.2 20 μM LB 0.4 Betaine 5M 3 Target RNA 1 <![CDATA[ddH2O]]> upto25

[0135] The primers, ratio of internal and external primers, and betaine concentration in the reaction amplification system were optimized. The system was optimized by controlling the single variable principle in the LAMP system. The results are as follows: Figure 3 , Figure 4 and Figure 5 The results showed that the most suitable primer was primer set 5, and the best reaction system (25 μL) was: 2×LAMP Master Mix 12.5 μL, inner primers FIP and BIP (40 μM) 1.6 μL each, outer primers F3 and B3 (5 μM) 0.2 μL each, loop primer LB (20 μM) 0.4 μL, betaine (5 M) 3 μL, sample RNA to be tested 1 μL, and pure water was added to make up to 25 μL.

[0136] 2. Establishment of CRISPR / Cas12b detection system targeting BWYV Rep gene

[0137] 2.1crRNA primer design, ligation and purification

[0138] Design crRNA: According to the LAMP amplification product sequence, select the T-rich sequence as the detection target site, and design the detection site 2023bp after PAM through the website https: / / www.ezassay.com / rna. Use the T7 promoter (SEQID NO.32: CCCTATAGTGAGTCGTATTAATTTC) + Cas12b scaffold sequence

[0139] (SEQ ID NO.33:

[0140] GTGCCACTTCTCAGATTTGAGAAGCTCAACGGGCTTTGCCACCTGGAAAGTGGCCATTGGCACACCCGTTGAAAA ATTCTGTCCTCTAGAC) + target sequence (target DNA, 23bp after PAM sequence, SEQ ID NO.34: TATCATCTCCAAGAAGCCAGTCC) constitutes crRNAR, and the reverse complement of T7 promoter (SEQ ID NO.35: GAAATTAATACGACTCACTATAGGG) is crRNAF, wherein the T7 promoter enables the annealed DNA double strand to be recognized and transcribed by T7 polymerase, and the scaffold sequence can bind to Cas12b. After annealing, crRNAF and crRNAR obtain a DNA double strand, and then T7 in vitro transcription is performed to obtain the required crRNA.

[0141] Table 3 crRNA information for BWYV detection

[0142]

[0143] Oligonucleotide chain annealing: The crRNA oligonucleotide chain was annealed to form double-stranded DNA. The synthesized crRNAF and crRNAR dry powders were centrifuged at 12000 rpm for 5 min and diluted to a working concentration of 10 μM. The oligonucleotide chain annealing system is shown in Table 4. The annealing procedure is:

[0144] 95℃, 2min; 95℃, 90sec; 1℃per cycle; GOTO step2, 70×; 4℃, ∞.

[0145] Table 4 crRNA oligonucleotide chain annealing system

[0146] Reagent name Volume (μL) 5×Annealing Buffer for DNA Oligos 10 BWYVT7crRNAF 10 BWYVcrRNAR 10 <![CDATA[ddH2O]]> 20

[0147] The crRNA DNA double-strand concentration was measured by UV-visible spectrophotometer (METASH).

[0148] T7 in vitro transcription: The T7 in vitro transcription system is shown in Table 5, and the reaction procedure is 37°C, 16h.

[0149] Table 5T7 in vitro transcription system

[0150] Reagent name Volume (μL) NTPBufferMix 10 DTT 1 T7RNApolymeraseMix 2 TemplateDNA 4 <![CDATA[ddH2O]]> upto20

[0151] The total reaction volume (30 μL) was supplemented with 2 μL T7 polymerase, 10 μL NTPmix, 1 μg RNase Free ddH2O to 30 μL.

[0152] Remove the DNA template from the system: After completing T7 in vitro transcription, add 20 μL RNaseFree ddH2O and 2 μL DNase I (RNaseFree) to the system and react at 37°C for 15 min.

[0153] crRNA purification (LicL precipitation method):

[0154] (1) Transfer 50 μL of the transcribed product to a 1.5 mL centrifuge tube and add RNase Free ddH2O to a volume of 180 μL.

[0155] (2) Add 25 M Licl solution, vortex to mix, and incubate at 20°C for 30 min;

[0156] (4) Centrifuge at 12,000 rpm for 15 min at 4°C and discard the supernatant (aqueous phase);

[0157] (8) Add 500 μL of pre-cooled 75% ethanol to wash the precipitate, centrifuge at 12,000 rpm for 15 min at 4°C, and discard the supernatant (aqueous phase);

[0158] (9) Repeat step (8) once;

[0159] (9) Centrifuge the empty tube at 12,000 rpm for 2 min and leave the tube open for 5 min;

[0160] (10) Add 50 μL ddH2O to dissolve the precipitate and store at 20°C.

[0161] 2.2 Design and synthesis of ssDNA probes

[0162] Table 6 ssDNA probe

[0163] Reagent name sequence ssDNA probe (test strip) 6-FAMTTATTBiotin (SEQ ID NO.7)

[0164] The probe sequence is shown in Table 6, which was synthesized by Xi'an Qingke Biotechnology Co., Ltd. The brown tube dry powder was stored in the dark, centrifuged at 12000 rpm for 5 min, diluted to a working solution concentration of 2 μM, and stored at 20°C for later use.

[0165] 2.3 Optimization of CRISPR / Cas12b detection system

[0166] Table 7 Components of the test system

[0167] Reagent name Volume (μL) 10×Cas12b reaction buffer 3 5 μM AapCas12b protease 1 500nM crRNA 5 2μM ssDNA probe 12 Target 4 <![CDATA[ddH2O]]> up to 30

[0168] 2.3.1 Screening of optimal crRNA concentration

[0169] In order to achieve the best analytical performance of the detection system, the crRNA concentration in the CRISPR detection system was optimized, and 0.8, 1.5, 3.0, 4.5 and 6.0 μL of crRNA with a concentration of 28.8 ng / μL was added to the system, so that the final concentration of crRNA in the system was 25nM, 50nM, 100nM, 150nM and 200nM, respectively. After the detection preparation containing Cas12b protein, ssDNA probe, PCR amplification product containing target sequence, buffer and ssDNA probe of different volumes was completed, it was fully mixed and reacted at 37°C for 30 minutes. The product was detected by Cas12 nucleic acid test strips. The method is to insert the test strips into the above reaction system and observe the results within 510 minutes. The results are as follows Figure 6 As shown, in the range of 25 nM to 100 nM, as the concentration of crRNA increases, the color of the T line becomes darker, so 100 nM was selected as the crRNA concentration in the detection system in subsequent experiments.

[0170] 2.3.2 Screening of optimal concentration of ssDNA probe

[0171] In order to achieve the best analytical performance of the detection system, the concentration of ssDNA probes in the CRISPR detection system was optimized, and 0.8, 1.5, 3.0, 6.0, 4.0 and 12.0 μL of ssDNA probes with a concentration of 10 μM were added to the system, respectively, so that the final concentrations of ssDNA probes in the system were 50nM, 100nM, 200nM, 400nM and 800nM, respectively. After the detection preparation containing Cas12b protein, crRNA, PCR amplification products containing target sequences, buffer and different volumes of ssDNA probes was completed, it was fully mixed and reacted at 37°C for 30 minutes. The product was detected by Cas12 nucleic acid test strips, and the test strips were inserted into the above reaction system and the results were observed within 510 minutes.

[0172] Theoretically, the color depth of the test strip quality control line (T line) is proportional to the concentration of the ssDNA probe. The higher the ssDNA concentration in the detection system, the darker the T line color. However, too much probe will lead to non-specific results. Figure 7 As shown, the probe concentration is in the range of 50 nM to 400 nM. As the probe concentration increases, the color of the generated T line becomes darker. Therefore, 400 nM was selected as the ssDNA probe concentration in the detection system in subsequent experiments.

[0173] 3. One-pot microfluidic detection based on RT-LAMP-CRISPR / Cas12b

[0174] In this method, RT-LAMP amplification, the sample RNA to be tested and CRISPR / Cas12b are integrated on a microfluidic chip. The structure of the microfluidic chip is shown in the attached figure. Figure 8 As shown, 4 μL of the sample RNA to be tested is pre-loaded in the sample loading chamber, the CRISPR / Cas12b detection system is pre-loaded in the detection chamber, and the CRISPR / Cas12b reaction system is shown in Table 7.

[0175] The RT-LAMP system (Table 2) was proportionally reduced to 7.5 μL, mixed with 10% raffinose solution in a 1:1 ratio, and the mixture was evenly dispensed into the lower layer of the detection chamber through the microchannel through the injection hole of the microfluidic chip.

[0176] The loaded microfluidic chip was placed in a constant temperature heater at 57°C for 1 hour.

[0177] After the reaction is completed, insert the Cas12 nucleic acid test strip into the microfluidic chip detection chamber and observe the results within 5-10 minutes. If red strips appear on both the test strip quality control line (C line) and the test line (T line), the result is positive; if red strips appear on the test strip quality control line (C line) and the test line (T line) does not show color, the result is negative.

[0178] 3.2 Sensitivity test of the one-pot microfluidic detection system of RT-LAMP-CRISPR / Cas12b

[0179] In order to evaluate the sensitivity of the one-pot microfluidic detection system based on RT-LAMP-CRISPR / Cas12b, the gradient diluted RNA was added to the detection system and placed in a constant temperature heater at 57°C for 1 hour. After the reaction, the Cas12 nucleic acid test strip was used for detection. Fig. 9 As shown, the one-pot microfluidic detection sensitivity of RT-LAMP-CRISPR / Cas12b is 1 to 103 ng / μL.

[0180] 3.3 Specificity test of the one-pot microfluidic detection system of RT-LAMP-CRISPR / Cas12b

[0181] In order to verify the specificity of the one-pot microfluidic detection system of RT-LAMP-CRISPR / Cas12b for BWYV detection, the detection method was used to detect beet western yellows virus (BWYV), pepper cryptovirus 2 (PCV2), and cucumber mosaic virus (CMV). Fig.10 As shown, only the virus BWYV sample showed a red band on the T line of the Cas12 nucleic acid test strip, while the negative control, PCV2 and CMV samples did not show corresponding bands on the T line.

[0182] Example 2 Field sample detection

[0183] Testing of pepper samples from the field, Fig.11 The results of one-pot microfluidic detection of RT-LAMP-CRISPR / Cas12b in the field are shown. The color development results of the test strips are highly consistent with the color development results of the PCR strips. The results show that the detection system of the present invention has excellent specificity, sensitivity and repeatability for detecting BWYV, is easy to operate, does not require expensive instruments and equipment, and has the advantage of visualization.

[0184] In an embodiment of the present invention, a detection method of a beet western yellowing virus (BWYV) microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b achieves efficient, sensitive and convenient virus detection by integrating isothermal amplification and CRISPR / Cas12b-mediated specific detection and visual result reading. The detailed working principle is as follows:

[0185] Section 1: Sample loading into microfluidic chip

[0186] The extracted viral RNA is then added to the sample loading chamber of the microfluidic chip. The microfluidic chip is designed with multiple independent fluid channels and reaction chambers, which can achieve precise distribution and reaction control of small volume samples. Through microfluidic technology, the sample RNA is effectively transported to the detection chamber, while avoiding sample cross contamination and diffusion, improving the specificity and sensitivity of the detection.

[0187] Section 2: Pre-loading of CRISPR / Cas12b detection system

[0188] In the detection chamber of the microfluidic chip, a CRISPR / Cas12b detection system containing specific crRNA and probes is pre-loaded. The crRNA (CRISPR RNA) sequence is designed to specifically recognize and bind to the target sequence of BWYV. Once bound to the target RNA, the Cas12b protein is activated and cuts the nearby probe to release the signal. The pre-loading of this system ensures the automation and efficiency of the detection process, allowing the system to quickly respond to the appearance of amplification products in the detection chamber.

[0189] Section 3: Preparation and mixing of RT-LAMP amplification system

[0190] In step 4, the RT-LAMP amplification system containing the primers is mixed with cottonseed sugar (as a stabilizer or enhancer) and added to the injection hole of the microfluidic chip. RT-LAMP is an efficient isothermal amplification technology that can rapidly amplify viral RNA at a constant temperature. The primers are specific to the genome sequence of BWYV, and through the synergistic effect of the loop primer and the inner primer, a stable hairpin structure is formed to achieve efficient RNA amplification. This process does not require expensive thermal cycling equipment and is suitable for portable and on-site detection applications.

[0191] Section 4: Aggregation of samples and amplification system and reaction initiation

[0192] In step 5, the sample RNA in step 2 moves along the channel of the microfluidic chip and gathers at the bottom of the detection chamber in step 3 under the impetus of step 4. At this time, the RNA is fully mixed with the RT-LAMP amplification system to start the isothermal amplification reaction. The constant temperature heater is maintained at a suitable temperature (usually 57°C) to ensure the efficient conduct of the RT-LAMP reaction. As the viral RNA amplifies, the concentration of the target sequence in the detection chamber increases rapidly, providing sufficient trigger signals for the CRISPR / Cas12b system to promote the cutting of the probe and signal release.

[0193] Section 5: Detection of amplification products and reading of results

[0194] After the amplification reaction is completed (step 6), the amplified product is specifically detected by the CRISPR / Cas12b system (step 7). The activated Cas12b protein cuts the probe and releases a visual signal. These signals are displayed as red strips through the Cas12 nucleic acid test strip. The test strip design includes a quality control line (C line) and a test line (T line): when red strips appear on both the C line and the T line, the result is positive; when only the C line appears red and the T line does not show color, the result is negative. The quality control line ensures the effectiveness of the detection process and the normal operation of the reagents, while the test line displays the specific virus detection results. This simple visual reading method does not require professional equipment, which is convenient for quick judgment of the test results on site, and improves the practicality and convenience of the test.

[0195] Through the above five steps, the detection method of the beet western yellowing virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b of the present invention combines efficient RNA extraction, specific isothermal amplification, accurate CRISPR / Cas12b-mediated detection and convenient visual result reading, providing a fast, sensitive and easy-to-operate virus detection solution. This method not only improves the accuracy and reliability of detection, but also significantly shortens the detection time and reduces the detection cost, and has broad industrial application prospects and promotion value.

[0196] Application Example 1: Detection method of beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b

[0197] This example demonstrates the specific steps and operation procedures for virus detection using the beet western yellows virus (BWYV) microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b of the present invention.

[0198] Step 1: RNA extraction

[0199] Samples were taken from leaves infected with BWYV and RNA was extracted using TRIzol reagent according to the manufacturer's instructions. The specific steps included:

[0200] 1. Grind about 100 mg of leaf tissue evenly and add 1 mL of TRIzol reagent.

[0201] 2. Centrifuge at 12,000 × g, 4°C, for 10 min and collect the supernatant.

[0202] 3. Add 200 μL of chloroform, shake vigorously and let stand for 3 minutes.

[0203] 4. Centrifuge again at 12,000 × g, 4°C, 15 min and collect the supernatant.

[0204] 5. Add an equal volume of isopropanol to precipitate RNA and centrifuge at 10,000 × g, 4°C, for 10 min.

[0205] 6. Wash RNA precipitate in 75% ethanol, centrifuge at 8,000 × g, 4°C, 5 min, dry and dissolve in 30 μL RNase-free water.

[0206] The concentration of the extracted RNA was measured by NanoDrop to ensure that it met the requirements for subsequent amplification and detection.

[0207] Step 2: Loading the sample onto the microfluidic chip

[0208] Add 100 μL of extracted RNA sample to the sample loading chamber of the microfluidic chip. The microfluidic chip is made of ordinary resin material and is designed with multiple independent fluid channels and reaction chambers to ensure that the sample can be accurately and evenly distributed to each detection unit.

[0209] Step 3: Pre-loading of CRISPR / Cas12b detection system

[0210] The CRISPR / Cas12b detection system containing specific crRNA and probe is pre-loaded in the detection chamber of the microfluidic chip. The specific configuration is as follows:

[0211] The crRNA sequence was designed to target the RdRp gene region of BWYV, ensuring high specificity and sensitivity.

[0212] The probe uses an oligonucleotide sequence labeled with 6-carboxyfluorescein (6-FAM) and biotin, which releases a signal when cut by Cas12b.

[0213] Step 4: Preparation and mixing of RT-LAMP amplification system

[0214] At room temperature, the RT-LAMP amplification system (including dNTPs, Bst DNA polymerase, buffer, etc.) containing BWYV-specific primers was mixed evenly with 5 μL of the cottonseed sugar solution, and then the mixture was added to the injection hole of the microfluidic chip.

[0215] Step 5: Aggregation of samples and amplification system and reaction initiation

[0216] Through the pressure-driven system of the microfluidic chip, the RNA sample and the RT-LAMP amplification system gather at the bottom of the detection chamber to start the isothermal amplification reaction. The entire microfluidic chip is placed in a constant temperature heater, maintained at 57°C, and the RT-LAMP reaction is carried out for 30 minutes. During this process, the viral RNA is efficiently amplified to generate a large number of target DNA sequences, providing sufficient trigger signals for the CRISPR / Cas12b system.

[0217] Step 6: Detection of amplification products and result reading

[0218] After amplification, the CRISPR / Cas12b system is used to specifically detect the amplified product. The amplified product in the detection chamber is introduced into the Cas12 nucleic acid test strip through a microfluidic chip. The test strip design includes a quality control line (C line) and a detection line (T line):

[0219] Positive result: Red bands appear on both the C line and the T line, indicating the presence of BWYV virus in the sample.

[0220] Negative result: Only the C line shows a red band, and the T line does not show color, indicating that the BWYV virus is not detected in the sample.

[0221] The quality control line ensures the effectiveness of the test process and the normal operation of the reagents, while the test line displays the specific virus test results. The results can be quickly judged by the naked eye without the assistance of professional equipment, which is suitable for on-site rapid detection applications.

[0222] Application Example 2: Detection method of beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b

[0223] This example further illustrates the specific operation and optimization process of BWYV detection under different conditions using the microfluidic detection kit of the present invention to improve the sensitivity and specificity of the detection.

[0224] Step 1: RNA extraction

[0225] 100 mg samples were taken from healthy and BWYV-infected sugar beet stem tissues and RNA was extracted using the Qiagen RNeasyMini Kit according to the manufacturer's instructions. The specific steps included:

[0226] 1. Add sample tissue to RLT lysis buffer and lyse thoroughly.

[0227] 2. Remove proteins and other impurities through column purification and wash the RNA precipitate.

[0228] 3. Wash the purification column with 70% ethanol, centrifuge and dry at room temperature.

[0229] 4. Dissolve the RNA precipitate in 30 μL RNase-free water and store at 80°C for later use.

[0230] The extracted RNA was tested by Agilent Bioanalyzer to ensure that its integrity and purity met the test standards.

[0231] Step 2: Loading the sample onto the microfluidic chip

[0232] 50 μL of extracted RNA sample was added to the sample loading chamber of the microfluidic chip, and the sample flow path was controlled by a microfluidic valve to prevent sample cross contamination.

[0233] Step 3: Pre-loading of CRISPR / Cas12b detection system

[0234] The detection chamber is pre-loaded with a pre-made CRISPR / Cas12b detection system, including:

[0235] 1μM specific crRNA is designed against the CP gene sequence of BWYV to ensure highly specific recognition of the virus.

[0236] The probe is labeled with 0.5 μM 6-FAM and Biotin. When Cas12b is activated, the probe is cut and the signal is released.

[0237] Step 4: Preparation and mixing of RT-LAMP amplification system

[0238] The RT-LAMP amplification system (including buffer, dNTPs, Bst DNA polymerase, MgSO4, etc.) containing BWYV-specific primers was mixed with 10 μL of cottonseed sugar solution. The mixed solution was injected into the detection chamber through the injection hole of the microfluidic chip to form a uniform amplification reaction system.

[0239] Step 5: Aggregation of samples and amplification system and reaction initiation

[0240] The electronically controlled valve of the microfluidic chip is used to promote the aggregation of RNA samples and RT-LAMP amplification system in the detection chamber to start the RT-LAMP reaction. The chip is placed in a portable thermostat and maintained at 63°C for 40 minutes of isothermal amplification. This process uses microfluidic technology to achieve efficient reaction control and uniform amplification product generation.

[0241] Step 6: Detection of amplification products and result reading

[0242] After amplification, the CRISPR / Cas12b system is used to specifically detect the amplified product. The product in the reaction chamber is introduced into the Cas12 nucleic acid test strip through the chip, and the color change on the test strip is observed:

[0243] Positive result: Both the quality control line (C line) and the test line (T line) show red bands, indicating the presence of BWYV virus in the sample.

[0244] Negative result: Only the quality control line (C line) shows a red strip, and the test line (T line) does not show color, indicating that BWYV virus is not detected in the sample.

[0245] In this embodiment, the sensitivity of detection was improved by optimizing the RT-LAMP reaction time and the concentration of the CRISPR / Cas12b detection system, so that the method can maintain high accuracy even under low viral load conditions.

[0246] Through the above two specific examples, the specific operation process and optimization strategy of the detection method of the beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b in different application scenarios are demonstrated in detail. These examples not only verify the feasibility and efficiency of the method of the present invention, but also demonstrate its flexibility and adaptability in practical applications, further highlighting the innovation and practical value of the present invention in the field of rapid virus detection.

[0247] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. A detection method of a beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b, characterized in that: The following steps are involved: Step 1, extracting RNA from the sample to be tested; Step 2, adding the sample RNA to be tested into the sample loading chamber of the microfluidic chip; Step 3, pre-loading a CRISPR / Cas12b detection system comprising the crRNA and the probe in the detection chamber of the microfluidic chip; Step 4, mixing the raffinose with the RT-LAMP amplification system containing the primers, and then adding the mixture into the injection well; Step 5, step 2 is pushed by step 4 and gathered at the bottom of step 3; Step 6, placing the microfluidic chip completed in step 5 in a constant temperature heater for amplification and detection to obtain a detection product; Step 7, the detection product is tested with a Cas12 nucleic acid test strip, and red strips appear on both the quality control line and the detection line of the test strip, indicating a positive result; A red strip appears on the quality control line of the test strip, and the detection line does not show color, and the result is negative; the quality control line of the test strip is the C line; and the detection line is the T line.

2. The detection method of the beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b as claimed in claim 1, characterized in that: The CRISPR / Cas12b detection system described in step 3 is: 3 μL of 10×Cas12b reaction buffer, 1 μL of 5 μM AapCas12b protease, 5 μL of 500 nM crRNA, 12 μL of 2 μM ssDNA probe, and pure water is added to 30 μL.

3. The detection method of the beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b as claimed in claim 1, characterized in that: The RTLAMP amplification system in step 4 is: 2×LAMP Master Mix 12.5 μL, inner primers FIP and BIP (40 μM) 1.6 μL each, outer primers F3 and B3 (5 μM) 0.2 μL each, loop primer LB (20 μM) 0.4 μL, betaine (5 M) 3 μL, sample RNA to be tested 1 μL, and pure water is added to make up to 25 μL.

4. The detection method of the beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b as claimed in claim 1, characterized in that: In step 7, the amplification and detection conditions are 57° C. for 1 hour.

5. A microfluidic detection kit for beet western yellows virus based on RT-LAMP-CRISPR / Cas12b for implementing the detection method as claimed in claim 1, characterized in that: The RT-LAMP-CRISPR / Cas12b-based beet western yellows virus microfluidic detection kit includes an RT-LAMP amplification system and a CRISPR / Cas12b detection system. The RTLAMP amplification primers include the following primer pairs: the F3 / B3 nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; the FIP / BIP nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4; the LB nucleotide sequence is shown in SEQ ID NO.5; The CRISPR / Cas12b detection system includes a crRNA nucleotide sequence as shown in SEQ ID NO.6; a ssDNA sequence as shown in SEQ ID NO.7; Raffinose was also included at a concentration of 0.1 g / ml.

6. The beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b as claimed in claim 5, characterized in that The invention also includes a microfluidic chip, which includes an injection hole for isothermal amplification using the primers and the cottonseed sugar, a sample loading chamber for a sample to be tested, a detection chamber for detection using the crRNA and the probe, a 1000 μm microchannel connecting the injection hole and the loading chamber, and a 1000 μm Tesla valve connecting the loading chamber and the detection chamber.

7. A detection system for a beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b that implements the detection method of the beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b as described in any one of claims 1 to 6, characterized in that: The detection system of the beet western yellows virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b includes: A sample loading module, used for adding the sample RNA to be tested into the sample loading chamber of the microfluidic chip; A loading module, used for pre-loading the CRISPR / Cas12b detection system comprising the crRNA and the probe in the detection chamber of the microfluidic chip; A mixing module, used for mixing the cottonseed sugar with the RT-LAMP amplification system containing the primers and the RNA to be tested in a Tesla valve microchannel; A gathering module, used for adding modules to gather at the bottom of the loading module under the push of the mixing module; An amplification module is used to place the completed microfluidic chip in a constant temperature heater for amplification and detection to obtain a detection product; The detection module is used to perform Cas12 nucleic acid test strip detection on the detection product. If red strips appear on both the test strip quality control line and the test line, the result is positive; if red strips appear on the test strip quality control line and the test line does not show color, the result is negative; the test strip quality control line is the C line; the test line is the T line.

Images