Microfluidic Detection Kit and Method for Beet Western Aflatovirus Based on RT-LAMP-CRISPR / Cas12b

Abstract

This invention belongs to the fields of molecular biology, immunology, and virology. It discloses a microfluidic detection kit and method for beet western yellow virus based on RT-LAMP-CRISPR / Cas12b. This invention utilizes a raffinose dynamic diffusion system to connect isothermal amplification LAMP and CRISPR / Cas12b detection in a single reaction chamber, and achieves simultaneous detection of multiple samples through a microfluidic chip. This detection method effectively avoids aerosol contamination, possesses excellent specificity, sensitivity, and visualization advantages, is simple to operate, requires no expensive instruments, and can easily and quickly detect whether pepper and beet samples are infected with beet western yellow virus in the field, improving detection efficiency.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology, immunology and virology, and particularly relates to a microfluidic detection kit and method for beet western yellow virus based on RT-LAMP-CRISPR / Cas12b. Background Technology

[0002] Beet western yellows virus (BWYV) was first discovered in 1960 on radishes and beets in North America. Subsequently, it was found on beets in Czechoslovakia, Israel, Japan, China, and other countries. BWYV has a very wide host range, infecting more than 150 species of dicotyledonous plants. Particularly after infecting pepper plants, it causes leaf curling, wrinkling, and yellowing, as well as discoloration and shrinkage of the fruit, resulting in significant economic losses.

[0003] Currently, BWYV detection mainly employs reverse transcription polymerase chain reaction (RT-PCR), but this method suffers from drawbacks such as reliance on expensive, sophisticated instruments, specialized training, and a long detection cycle (approximately 2 hours). Clustered regularly interspaced short palindromic repeats (CRISPR) consist of a series of repetitive DNA sequences and spacer sequences. Together with CRISPR-associated proteins (Cas), they form the CRISPR / Cas system, which is widely found in archaea and many bacteria, serving as a crucial immune mechanism for prokaryotes against invading nucleic acids. Recent studies have shown that the CRISPR / Cas system is not only widely used in gene editing but also demonstrates great potential as a novel nucleic acid detection method, particularly in pathogen detection. Currently, various Cas proteins can effectively cleave target gene sequences under sgRNA guidance. Among them, Cas12b protein, in addition to its excellent target gene sequence specificity recognition ability, also possesses highly efficient trans-cleavage activity. Therefore, the characteristic of Cas12b protein being activated by specific targets can be utilized to achieve specific detection of target single-stranded DNA. Current rapid nucleic acid detection methods include loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA). While these methods eliminate the reliance on temperature regulation modules found in traditional amplification techniques, they are prone to false positives in practical applications. The CRISPR / Cas12b system, with its identical reaction temperature to LAMP and perfect complementarity, can significantly improve the specificity of isothermal amplification. However, current methods primarily employ a two-step detection strategy, which carries a significant risk of aerosol contamination.

[0004] Therefore, it is urgent to develop a method for rapid, low-cost, one-pot field detection of BWYV-related diseases based on RTLAMP and CRISPR / Cas12b technologies combined with microfluidic chips.

[0005] Based on the above analysis, the problems and shortcomings of the existing technology are as follows:

[0006] The current main detection strategy is a two-step method, which poses a significant risk of aerosol contamination. Summary of the Invention

[0007] To address the problems existing in the prior art, this invention provides a microfluidic detection kit and method for beet western yellow virus based on RT-LAMP-CRISPR / Cas12b.

[0008] This invention is achieved as follows: a detection method for a microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b for beet western yellow virus includes:

[0009] Step 1: Extract RNA from the sample to be tested;

[0010] Step 2: Add the RNA sample to be tested into the sample dispensing chamber of the microfluidic chip;

[0011] Step 3: Preload the CRISPR / Cas12b detection system containing the crRNA and the probe into the detection chamber of the microfluidic chip;

[0012] Step 4: Mix the raffinose with the RT-LAMP amplification system containing the primers, and then add it to the injection well;

[0013] Step 5, Step 2 is pushed together at the bottom of Step 3 under the force of Step 4;

[0014] Step 6: Place the microfluidic chip that has completed step 5 into a constant temperature heater for amplification and detection to obtain the detection product;

[0015] Step 7: Detect the product using a Cas12 nucleic acid test strip. If both the control line and the test line show red bands, the result is positive; if the control line shows a red band but the test line does not show color, the result is negative. The control line is the C line; the test line is the T line.

[0016] Furthermore, the CRISPR / Cas12b detection system in step 3 is as follows: 3 μL of 10×Cas12b reaction buffer, 1 μL of 5 μM AapCas12b protease, 5 μL of 500 nM crRNA, 12 μL of 2 μM ssDNA probe, and pure water added to make up to 30 μL.

[0017] Furthermore, the RT-LAMP amplification system in step 4 is as follows: 12.5 μL of 2×LAMP Master Mix, 1.6 μL each of inner primers FIP and BIP (40 μM), 0.2 μL each of outer primers F3 and B3 (5 μM), 0.4 μL of loop primer LB (20 μM), 3 μL of betaine (5 M), 1 μL of RNA sample to be tested, and pure water to make up to 25 μL.

[0018] Furthermore, in step 7, the amplification and detection conditions are a reaction at 57°C for 1 hour.

[0019] Another objective of this invention is to provide a microfluidic detection kit for beet western yellow virus based on RT-LAMP-CRISPR / Cas12b, comprising an RT-LAMP amplification system and a CRISPR / Cas12b detection system.

[0020] The RT-LAMP amplification primers include the following primer pairs: F3 / B3 nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; FIP / BIP nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4; and LB nucleotide sequences as shown in SEQ ID NO.5.

[0021] The CRISPR / Cas12b detection system includes the crRNA nucleotide sequence as shown in SEQ ID NO. 6; and the ssDNA sequence as shown in SEQ ID NO. 7.

[0022] It also includes raffinose at a concentration of 0.1 g / ml;

[0023] Furthermore, it also includes a microfluidic chip, which includes an injection well for isothermal amplification using the primers and the raffinose, a sample loading chamber for the test sample, a detection chamber for detection using the crRNA and the probe, a 1000 μm microchannel connecting the injection well and the loading chamber, and a 1000 μm Tesla valve connecting the loading chamber and the detection chamber.

[0024] Another objective of this invention is to provide a detection system for a microfluidic detection kit for beet western yellow virus based on RT-LAMP-CRISPR / Cas12b, comprising:

[0025] The sample addition module is used to add the RNA sample to be tested into the sample addition chamber of the microfluidic chip.

[0026] A loading module is used to preload a CRISPR / Cas12b detection system containing the crRNA and the probe into the detection chamber of the microfluidic chip;

[0027] A mixing module is used to mix the raffinose with the RT-LAMP amplification system containing the primers and the RNA to be tested in a Tesla valve microchannel.

[0028] The aggregation module is used to join modules that are aggregated at the bottom of the loading module under the push of the mixing module;

[0029] The amplification module is used to place the completed microfluidic chip in a constant temperature heater for amplification and detection to obtain the detection product;

[0030] The detection module is used to detect the product using a Cas12 nucleic acid test strip. If both the control line and the test line of the test strip show red bands, the result is positive; if the control line shows a red band but the test line does not show color, the result is negative. The control line of the test strip is the C line; the test line is the T line.

[0031] Based on the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solution to be protected by this invention are as follows:

[0032] First, this invention integrates the RT-LAMP amplification system and the CRISPR / Cas12b detection system through a raffinose-mediated dynamic diffusion system, achieving one-pot, pollution-free virus detection.

[0033] The RT-LAMP amplification and CRISPR / Cas12b detection of this invention are both carried out under isothermal conditions at 57°C. The entire process does not require adjustment of the reaction temperature and the experimental results can be displayed in just 1 hour.

[0034] The microfluidic chip of this invention is highly integrated and can simultaneously detect viruses in 6 plant samples.

[0035] The microfluidic chip of this invention adds an anti-backflow microchannel between the sample dispensing chamber and the detection chamber, which effectively avoids cross-contamination between samples while mixing the RNA to be tested and the RT-LAMP reagent.

[0036] The microfluidic chip of this invention has low manufacturing cost and, when used in conjunction with the Cas12 nucleic acid test strip, enables visual detection of viruses in the field.

[0037] Secondly, the technical solution of this invention effectively solves the problems of slow detection speed, complex operation, and low sensitivity in existing sugar beet Western Yellow Virus (BWYV) detection methods in industrial applications. Traditional detection methods usually require specialized laboratory equipment and technicians. Techniques such as RT-PCR have high requirements for equipment and environment, limiting their application in field or non-professional environments. In addition, the detection cycle of traditional methods is long, making it difficult to meet the needs of rapid detection and timely prevention and control. Low-sensitivity detection methods also lead to the overlooking of viral infections, which in turn damages crop growth and yield.

[0038] This invention achieves efficient and convenient virus detection by combining RT-LAMP isothermal amplification, a CRISPR / Cas12b system, and a microfluidic chip. The RT-LAMP amplification system rapidly amplifies target RNA under isothermal conditions, improving amplification efficiency and simplifying temperature control requirements, making on-site operation more convenient. Leveraging the specific recognition capabilities and probe cleavage mechanism of CRISPR / Cas12b, the specificity and sensitivity of the detection are greatly enhanced, enabling the detection of low concentrations of viral RNA. The application of the microfluidic chip further optimizes the detection process, reducing manual operation steps and shortening detection time through automated flow and control within the chip.

[0039] Furthermore, this invention employs Cas12 nucleic acid test strips as the final colorimetric detection method, making the test results visual and intuitive. Through the color development of the control and test lines on the test strip, users can determine the test results without complex instruments, providing a convenient means for rapid on-site diagnosis. Compared to traditional detection methods, the detection method of this invention significantly reduces reliance on equipment, shortens the detection cycle, and improves detection sensitivity and accuracy, enabling rapid detection of BWYV in the field and facilitating timely detection and control of virus transmission. This innovation has significant technological advancement and industrial application value in improving crop yields and ensuring the quality and efficiency of agricultural production.

[0040] Third, the detection of Western Yellow Beet Virus (BWYV) is currently of great significance in agricultural production; however, existing detection methods have the following main technical problems:

[0041] 1. Slow detection speed: Traditional molecular biology detection methods, such as RT-PCR, usually take several hours or even longer to complete the detection process, which is difficult to meet the needs of rapid diagnosis and immediate decision-making, especially in large-scale field testing.

[0042] 2. High dependence on equipment: Existing virus detection methods usually rely on complex and expensive experimental equipment, such as thermal cyclers and fluorescence detectors, which limits their application in resource-constrained field environments and increases detection costs and operational complexity.

[0043] 3. Complex operation: Traditional detection methods require multiple steps, including RNA extraction, reverse transcription, amplification and detection. Each step requires professional technicians and is susceptible to human error, which reduces the reliability and consistency of the detection.

[0044] 4. Limited sensitivity and specificity: Some existing detection methods have insufficient sensitivity in samples with low viral load, which can easily lead to false negative results. In addition, some methods have low specificity among different viral strains, resulting in false positive results and affecting the accuracy of the detection.

[0045] 5. Poor portability: Existing testing equipment is large and heavy, making it unsuitable for mobile testing and rapid on-site diagnosis, which limits its widespread application in agricultural production, especially in remote or resource-scarce areas.

[0046] This invention proposes a detection method for sugar beet western yellow virus based on a microfluidic detection kit using RT-LAMP-CRISPR / Cas12b, achieving the following significant technical advancements to address the aforementioned technical problems:

[0047] 1. Significantly Improved Detection Speed: The detection method of this invention integrates reverse transcription loop-mediated isothermal amplification (RT-LAMP) and CRISPR / Cas12b-mediated specific detection technologies, achieving rapid RNA amplification and real-time detection on a microfluidic chip. The entire detection process can be completed in only about 60 minutes, significantly shortening the detection time compared to the traditional RT-PCR method, thus meeting the needs of rapid diagnosis and immediate decision-making.

[0048] 2. Reduced Equipment Dependence: The microfluidic detection kit of this invention is designed as a portable device, using a simplified isothermal heater instead of a complex thermal cycler, and combined with Cas12 nucleic acid test strips for visual reading, significantly reducing reliance on expensive detection equipment. This design is suitable for use in field environments, especially in resource-constrained agricultural production areas, improving the flexibility and operability of detection.

[0049] 3. Simplified Operation Process: By integrating isothermal amplification and specific detection steps, the detection method of this invention greatly simplifies the operation process, reduces the number of steps and the required professional skills of the technicians. Users only need to follow the preset steps, eliminating the need for complex experimental operations, reducing the risk of human error, and improving the consistency and reliability of the detection.

[0050] 4. Enhanced Detection Sensitivity and Specificity: Combining the high-efficiency amplification capability of RT-LAMP with the specific recognition of CRISPR / Cas12b, the detection method of this invention exhibits higher sensitivity in samples with low viral load, effectively detecting trace amounts of viral RNA. Furthermore, the specific crRNA design ensures high specificity for BWYV recognition, reducing false positive and false negative results and improving detection accuracy.

[0051] 5. Enhanced portability and field application capabilities: The microfluidic chip design makes the entire detection device compact and lightweight, easy to carry and move. Combined with the visual reading method of the Cas12 nucleic acid test strip, users can quickly conduct virus detection in the field or other field environments without relying on complex instruments and equipment, promptly grasp the health status of crops, and guide precision agricultural management and disease control.

[0052] 6. Significant cost-effectiveness: The detection method of this invention uses simple and readily available reagents and materials, resulting in low production costs and suitability for large-scale application. The mass production of microfluidic chips and the low-cost manufacturing of Cas12 nucleic acid test strips significantly reduce overall detection costs, improving economic efficiency and making it suitable for routine testing needs in agricultural production.

[0053] This invention integrates RT-LAMP and CRISPR / Cas12b technologies, combined with a microfluidic chip and Cas12 nucleic acid test strips, to achieve a rapid, sensitive, portable, and highly specific detection method for Western yellow beet virus. In industrial applications, this invention effectively solves key technical problems in existing technologies, such as slow detection speed, strong equipment dependence, complex operation, insufficient sensitivity and specificity, and poor portability. By significantly improving detection efficiency and accuracy while reducing equipment and operating costs, the technical solution of this invention has broad application prospects and promotional value in agricultural disease management, promoting the development of rapid plant disease detection technology and facilitating the realization of precision agriculture and intelligent agricultural management. Attached Figure Description

[0054] Figure 1 This is a flowchart of the detection method for the beet western yellow virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b provided in this embodiment of the invention.

[0055] Figure 2 This is a block diagram of the detection system structure of the RT-LAMP-CRISPR / Cas12b-based microfluidic detection kit for beet western yellow virus provided in this embodiment of the invention.

[0056] Figure 3 This is a diagram showing the primer set screening results in the RT-LAMP system provided in this embodiment of the invention.

[0057] Figure 4 This is a graph showing the results of primer ratio optimization in the RT-LAMP system provided in this embodiment of the invention.

[0058] Figure 5 This is a graph showing the optimized betaine concentration in the RT-LAMP system provided in this embodiment of the invention.

[0059] Figure 6This is a graph showing the experimental results of crRNA concentration optimization in the CRISPR detection system provided in this embodiment of the invention.

[0060] Figure 7 This is a graph showing the experimental results of ssDNA probe concentration optimization in the CRISPR detection system provided in this embodiment of the invention.

[0061] Figure 8 This is a schematic diagram of the structure of the microfluidic chip provided in an embodiment of the present invention.

[0062] Figure 9 This is a graph showing the sensitivity test evaluation results of the one-pot microfluidic detection system RT-LAMP-CRISPR / Cas12b provided in this embodiment of the invention.

[0063] Figure 10 This is a diagram showing the specificity test evaluation results of the one-pot microfluidic detection system RT-LAMP-CRISPR / Cas12b provided in the embodiments of the present invention.

[0064] Figure 11 This is a comparison of the banding results of one-pot microfluidic detection and RT-PCR in the field testing provided by the embodiments of the present invention. Detailed Implementation

[0065] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0066] like Figure 1 As shown in the figure, the detection method of the beet western yellow virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b provided by the present invention includes the following steps:

[0067] S101, extract RNA from the sample to be tested;

[0068] S102, the RNA sample to be tested is added to the sample dispensing chamber of the microfluidic chip;

[0069] S103, A CRISPR / Cas12b detection system containing the crRNA and the probe is pre-loaded in the detection chamber of the microfluidic chip;

[0070] S104, Mix the raffinose with the RT-LAMP amplification system containing the primers, and then add it to the injection well;

[0071] S105 and S102 are pushed together at the bottom of S103 by S104;

[0072] S106, the microfluidic chip that has completed S105 is placed in a constant temperature heater for amplification and detection to obtain the detection product;

[0073] S107, the test product is tested using a Cas12 nucleic acid test strip. If both the control line and the test line of the test strip show red bands, the result is positive; if the control line shows a red band but the test line does not show color, the result is negative. The control line of the test strip is the C line; the test line is the T line.

[0074] The CRISPR / Cas12b detection system described in S103 of this embodiment is as follows: 3 μL of 10×Cas12b reaction buffer, 1 μL of 5 μM AapCas12b protease, 5 μL of 500 nM crRNA, 12 μL of 2 μM ssDNA probe, and pure water added to make up to 30 μL.

[0075] The RT-LAMP amplification system described in S104 of this embodiment is as follows: 12.5 μL of 2×LAMP Master Mix, 1.6 μL each of inner primers FIP and BIP (40 μM), 0.2 μL each of outer primers F3 and B3 (5 μM), 0.4 μL of loop primer LB (20 μM), 3 μL of betaine (5 M), 1 μL of RNA sample to be tested, and pure water to make up to 25 μL.

[0076] In S107 provided in this embodiment of the invention, the amplification and detection conditions are a reaction at 57°C for 1 hour.

[0077] This invention provides a microfluidic detection kit for beet western yellowing virus based on RT-LAMP-CRISPR / Cas12b, comprising an RT-LAMP amplification system and a CRISPR / Cas12b detection system.

[0078] The RT-LAMP amplification primers include the following primer pairs: F3 / B3 nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; FIP / BIP nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4; and LB nucleotide sequences as shown in SEQ ID NO.5.

[0079] The CRISPR / Cas12b detection system includes the crRNA nucleotide sequence as shown in SEQ ID NO. 6; and the ssDNA sequence as shown in SEQ ID NO. 7.

[0080] It also includes raffinose at a concentration of 0.1 g / ml;

[0081] It also includes a microfluidic chip, which includes an injection well for isothermal amplification using the primers and the raffinose, a sample loading chamber, a detection chamber for detection using the crRNA and the probe, a 1000 μm microchannel connecting the injection well and the loading chamber, and a 1000 μm Tesla valve connecting the loading chamber and the detection chamber.

[0082] like Figure 2 As shown in the figure, the detection system of the beet western yellow virus microfluidic detection kit based on RT-LAMP-CRISPR / Cas12b provided by the present invention includes:

[0083] The sample addition module is used to add the RNA sample to be tested into the sample addition chamber of the microfluidic chip.

[0084] A loading module is used to preload a CRISPR / Cas12b detection system containing the crRNA and the probe into the detection chamber of the microfluidic chip;

[0085] A mixing module is used to mix the raffinose with the RT-LAMP amplification system containing the primers and the RNA to be tested in a Tesla valve microchannel.

[0086] The aggregation module is used to join modules that are aggregated at the bottom of the loading module under the push of the mixing module;

[0087] The amplification module is used to place the completed microfluidic chip in a constant temperature heater for amplification and detection to obtain the detection product;

[0088] The detection module is used to detect the product using a Cas12 nucleic acid test strip. If both the control line and the test line of the test strip show red bands, the result is positive; if the control line shows a red band but the test line does not show color, the result is negative. The control line of the test strip is the C line; the test line is the T line.

[0089] Specific implementation of the present invention:

[0090] Main experimental materials: HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, USA), RNase inhibitor, 2×Taq Plus MasterMix and Dnase / RNase FreeddH2O were purchased from Kangwei Century, 2×LAMP MasterMix (New England Biolabs, USA); universal RNA extraction kit was purchased from Beijing Coollab Technology Co., Ltd.; cDNA reverse transcription kit was purchased from Takara Bio Inc.; ssDNA probe, Cas12b protein and Cas12 nucleic acid test strip were purchased from Guangzhou Aidi Gene Technology Co., Ltd.

[0091] Main instruments: full-wavelength microplate reader, conventional PCR instrument (Biometra TONE, Germany), constant temperature water bath (Shanghai Yuejin Medical Instrument Co., Ltd.), nucleic acid electrophoresis instrument (Beijing Liuyi Instrument Factory), ultraviolet gel imaging system (Hunan Aikerui Bioengineering Co., Ltd.), ultraviolet-visible spectrophotometer (Shanghai Yuanxi Instrument Co., Ltd.), etc.

[0092] Total RNA was extracted from the sample as a reaction template by mixing 300 μL of lysis buffer (20 mM NaoH + 6% PEG + 1 μL RNase) with the sample juice.

[0093] Example 1: Establishment of the RT-LAMP-CRISPR / 12b detection system

[0094] 1. Establishment of the RT-LAMP detection system

[0095] 1.1 Primer Design

[0096] LAMP amplification primers were designed based on the BWYV Rep gene sequences of different genotypes (AF473561.1, ON924237, KU521325.1, LC198684.1, MK307780.1, ON759519.1, EU636990.1, EU636991.1, KU521326.1, HM804472.1, HM804471.1, AB903032.1, AB903036.1). The primers were synthesized by Xi'an Qingke Biotechnology Co., Ltd., and the primer sequences are shown below:

[0097] Primer set 1:

[0098] FIP: GCTTCCCCGTTGAAGGTGAAGA CTTGCAAGGCCGTACACTT(SEQ ID NO.8)

[0099] BIP: TCACAGGGATCTCCCCCTGCACTGTGCCCTGGATCTGT (SEQ ID NO.9)

[0100] LF: TGCAGAGGTTGGATGCTGTTT (SEQ ID NO.10)

[0101] LB: CGCAAATTCGTCTCTGTCCTGAG (SEQ ID NO.11)

[0102] F3: ACCAAACTGGGAAGGAACC (SEQ ID NO.12)

[0103] B3: ACCCAATAGCGTTTTGCCAT (SEQ ID NO.13)

[0104] Primer set 2:

[0105] FIP: GTGGGGGGCAGTCGTAAGTCAGGCTACACAGAGCTTGCG (SEQ ID NO.14)

[0106] BIP: GCAGGATTATTCCTCGCGCGAATGCCCTTGACAAGGAGGT (SEQ ID NO.15)

[0107] LF: GCACTCGAGGAATGTAATGAGGC (SEQ ID NO.16)

[0108] LB: GGAGAGGATACACAAACACCAGG (SEQ ID NO.17)

[0109] F3: CCAACGTCACCGTTTGGC (SEQ ID NO.18)

[0110] B3: TGCACACCAGACCGAAAG (SEQ ID NO.19)

[0111] Primer set 3:

[0112] FIP: TCAACCCATCCCCGGTGTGTGT GTTTGACGCTGGAATCGGAG (SEQ ID NO.20)

[0113] BIP: CTTCCCGTTTTAGCTCGCCTGA GGGGAAAGCTCTTCAAACCT (SEQ ID NO.21)

[0114] LF: GGTTTCCCGTATGCGATGTACG (SEQ ID NO.22)

[0115] LB: ATCCGATTACAGAGATGTTGGAGG (SEQ ID NO.23)

[0116] F3: CAAGCTGTTTTCTCGCTCGA (SEQ ID NO.24)

[0117] B3: TTCTTGCACTAGCTGCTCC (SEQ ID NO.25)

[0118] Primer set 4:

[0119] FIP: TTCAATTCCGCTTGGGCCCCACTCCACCCAGAGTTGGC (SEQ ID NO.26)

[0120] BIP: ATCCTTGCGGCTACAAGCCG TCCCGCTCCTCAGTTGAG (SEQ ID NO.27)

[0121] LF: CGAAGCCACGGGTCTGTACT (SEQ ID NO.28)

[0122] LB: GAACGCGCCCAGCAAGTTA (SEQ ID NO.29)

[0123] F3: TTGGGGAGCAAAAGTCCTC (SEQ ID NO.30)

[0124] B3: GCCTCGCAGCATTTCCTT (SEQ ID NO.31)

[0125] Primer set 5:

[0126] FIP: CGCGGAGCTTGCTTGTTGTTT GATATGGAAGTCCGCAACCG (SEQ ID NO.3)

[0127] BIP: CAGTGTCCTGTGCCTATCCGAC GGAGGTTGTAGCTTCCTG (SEQ ID NO.4)

[0128] LB: CGTGTGCCTGGAGTTCAGAA (SEQ ID NO.5)

[0129] F3: CGGACTGGCTTCTTGGAGA (SEQ ID NO.1)

[0130] B3:GGAAAGCTGCCATCACTCT(SEQ ID NO.2)

[0131] 1.2 Establishment of RT-LAMP detection method

[0132] The LAMP amplification system was established according to Table 2, and the reaction was carried out on ice. After the reaction system was prepared, it was vortexed to mix, then briefly centrifuged, and reacted at 63℃ for 40 min, followed by inactivation at 80℃ for 5 min. After the reaction, it was briefly centrifuged, and 5 μL of sample was added to 2 μL of HNB. The reaction results were observed by 2% agarose gel electrophoresis.

[0133] Table 2 RT-LAMP reaction amplification system (25 μL)

[0134] Reagent Name Volume (μL) 2×MasterMix (premixed solution) 12.5 Detection Coponent (Indicator) 1 40μM FIP / BIP 1.6 5μMF3 / B3 0.2 20μMLB 0.4 Betaine 5M 3 TargetRNA 1 <![CDATA[ddH2O]]> upto25

[0135] The primers, the ratio of inner to outer primers, and the betaine concentration in the reaction amplification system were optimized. The system optimization was performed using the principle of controlling a single variable in the LAMP system, and the results are as follows: Figure 3 , Figure 4 and Figure 5 The results showed that the optimal primer set was primer group 5, and the optimal reaction system (25 μL) was as follows: 12.5 μL of 2×LAMP Master Mix, 1.6 μL each of inner primers FIP and BIP (40 μM), 0.2 μL each of outer primers F3 and B3 (5 μM), 0.4 μL of loop primer LB (20 μM), 3 μL of betaine (5 M), 1 μL of RNA sample to be tested, and pure water to make up to 25 μL.

[0136] 2. Establishment of a CRISPR / Cas12b detection system targeting the BWYV Rep gene

[0137] 2.1 crRNA primer design, ligation and purification

[0138] crRNA design: Based on the LAMP amplification product sequence, a T-rich sequence was selected as the detection target site, and a 2023 bp detection site after PAM was designed using the website https: / / www.ezassay.com / rna. The scaffold sequence of the T7 promoter (SEQ ID NO.32: CCCTATAGTGAGTCGTATTAATTTC) + Cas12b was utilized.

[0139] (SEQ ID NO.33:

[0140] The sequence GTGCCACTTCTCAGATTTGAGAAGCTCAACGGGCTTTGCCACCTGGAAAGTGGCCATTGGCACACCCGTTGAAAA ATTCTGTCCTCTAGAC) + target sequence (target DNA, 23 bp after the PAM sequence, SEQ ID NO.34: TATCATCTCCAAGAAGCCAGTCC) constitutes crRNAR, and the T7 promoter reverse complement (SEQ ID NO.35: GAAATTAATACGACTCACTATAGGG) constitutes crRNAF. The T7 promoter allows the annealed DNA double strand to be recognized and transcribed by T7 polymerase, and the scaffold sequence can bind to Cas12b. After annealing crRNAF and crRNAR to obtain the DNA double strand, in vitro transcription with T7 polymerase yields the desired crRNA.

[0141] Table 3 shows the crRNA information for BWYV detection.

[0142]

[0143] Oligonucleotide chain annealing: The crRNA oligonucleotide chain was annealed to form double-stranded DNA. The synthesized crRNAF and crRNAR dry powders were centrifuged at 12000 rpm for 5 min and diluted to a working concentration of 10 μM. The oligonucleotide chain annealing system is shown in Table 4, and the annealing program is as follows:

[0144] 95℃, 2min; 95℃, 90sec; 1℃ per cycle; GOTO step2, 70×; 4℃, ∞.

[0145] Table 4. Annealing system for crRNA oligonucleotide chains

[0146] Reagent Name Volume (μL) 5×Annealing Buffer for DNA Oligos 10 BWYVT7crRNAF 10 BWYVcrRNAR 10 <![CDATA[ddH2O]]> 20

[0147] The concentration of crRNA DNA double strands was measured using a UV-Vis spectrophotometer (METASH).

[0148] T7 in vitro transcription: The T7 in vitro transcription system is shown in Table 5. The reaction program is 37℃ for 16 hours.

[0149] Table 5. T7 in vitro transcription system

[0150] Reagent Name Volume (μL) NTPBufferMix 10 DTT 1 T7 RNApolymerase Mix 2 TemplateDNA 4 <![CDATA[ddH2O]]> upto20

[0151] The total reaction volume (30 μL) was increased to 30 μL by adding 2 μL of T7 polymerase, 10 μL of NTPmix, 1 μg of annealed double-stranded DNA, RNase-free ddH2O, and 1 μg of RNase-free ddH2O.

[0152] Remove DNA template from the system: After completing T7 in vitro transcription, add 20 μL RNase-free ddH2O and 2 μL LDNase I (RNase-free) to the system and react at 37°C for 15 min.

[0153] crRNA purification (LicL precipitation method):

[0154] (1) Transfer 50 μL of the post-transcriptional product to a 1.5 mL centrifuge tube and add RNase-free ddH2O to a total volume of 180 μL;

[0155] (2) Add 25M Licl solution, vortex to mix, and incubate at 20℃ for 30min;

[0156] (4) Centrifuge at 4℃ and 12000rpm for 15min, and discard the supernatant (aqueous phase);

[0157] (8) Add 500 μL of pre-cooled 75% ethanol to wash the precipitate, centrifuge at 12000 rpm for 15 min at 4℃, and discard the supernatant (aqueous phase).

[0158] (9) Repeat step (8) once;

[0159] (9) Centrifuge the empty tube at 12000 rpm for 2 min, and then leave it open for 5 min;

[0160] (10) Add 50 μL ddH2O water to dissolve the precipitate and store at 20℃.

[0161] 2.2 Design and Synthesis of ssDNA Probes

[0162] Table 6 ssDNA probes

[0163] Reagent Name sequence ssDNA probe (test strip) 6-FAMTTATTBiotin (SEQ ID NO.7)

[0164] The probe sequence is shown in Table 6. It was synthesized by Xi'an Qingke Biotechnology Co., Ltd. The dry powder in brown tubes was stored in the dark. It was centrifuged at 12,000 rpm for 5 min, diluted to a working solution concentration of 2 μM, and stored at 20℃ for later use.

[0165] 2.3 Optimization of the CRISPR / Cas12b detection system

[0166] Table 7 Components of the Testing System

[0167] Reagent Name Volume (μL) 10×Cas12b reaction buffer 3 5μM AapCas12b protease 1 500nM crRNA 5 2μM ssDNA probe 12 Target 4 <![CDATA[ddH2O]]> up to 30

[0168] 2.3.1 Screening for optimal crRNA concentration

[0169] To optimize the analytical performance of the detection system, the crRNA concentration in the CRISPR detection system was optimized. 0.8, 1.5, 3.0, 4.5, and 6.0 μL of crRNA at a concentration of 28.8 ng / μL were added to the system, resulting in final crRNA concentrations of 25 nM, 50 nM, 100 nM, 150 nM, and 200 nM, respectively. After preparing the detection mixture containing Cas12b protein, ssDNA probe, PCR amplification product containing the target sequence, buffer, and different volumes of ssDNA probe, the mixture was thoroughly mixed and incubated at 37°C for 30 min. The product was detected using a Cas12 nucleic acid test strip by inserting the test strip into the reaction system and observing the results within 5-10 min. The results are as follows: Figure 6 As shown, within the range of 25nM to 100nM, the T-line color of crRNA becomes darker with increasing concentration. Therefore, 100nM was chosen as the crRNA concentration in the detection system in subsequent experiments.

[0170] 2.3.2 Screening for optimal ssDNA probe concentration

[0171] To optimize the analytical performance of the detection system, the concentration of ssDNA probes in the CRISPR detection system was optimized. 0.8, 1.5, 3.0, 6.0, 4.0, and 12.0 μL of 10 μM ssDNA probes were added to the system, resulting in final ssDNA probe concentrations of 50 nM, 100 nM, 200 nM, 400 nM, and 800 nM, respectively. After preparing the detection mixture containing Cas12b protein, crRNA, PCR amplification products containing the target sequence, buffer, and different volumes of ssDNA probes, the mixture was thoroughly mixed and incubated at 37°C for 30 min. The products were detected using Cas12 nucleic acid test strips by inserting the test strip into the reaction system and observing the results within 5-10 min.

[0172] Theoretically, the intensity of the control line (T line) on the test strip is directly proportional to the concentration of the ssDNA probe; a higher ssDNA concentration in the detection system results in a darker T line. However, excessive probe concentration can lead to nonspecific results. The results of the ssDNA probe concentration optimization experiment are shown below. Figure 7 As shown, within the range of 50nM to 400nM, the T-line color becomes darker with increasing probe concentration. Therefore, 400nM was chosen as the ssDNA probe concentration in the detection system in subsequent experiments.

[0173] 3. One-pot microfluidic detection based on RT-LAMP-CRISPR / Cas12b

[0174] This method integrates RT-LAMP amplification, the RNA sample to be tested, and CRISPR / Cas12b onto a microfluidic chip. The microfluidic chip structure is shown in the attached figure. Figure 8 As shown in Table 7, 4 μL of the RNA sample to be tested was pre-loaded into the sample loading chamber, and the CRISPR / Cas12b detection system was pre-loaded into the detection chamber.

[0175] The RT-LAMP system (Table 2) was scaled down to 7.5 μL and mixed with 10% raffinose solution at a 1:1 ratio. The mixture was then uniformly dispensed into the lower layer of the detection chamber through the microchannel via the injection port of the microfluidic chip.

[0176] The loaded microfluidic chip was placed in a constant temperature heater and reacted at 57°C for 1 hour.

[0177] After the reaction is complete, insert the Cas12 nucleic acid test strip into the microfluidic chip detection chamber and observe the results within 5-10 minutes. If both the control line (C line) and the test line (T line) show red bands, the result is positive; if the control line (C line) shows a red band but the test line (T line) does not show color, the result is negative.

[0178] 3.2 Sensitivity Test of One-Pot Microfluidic Detection System with RT-LAMP-CRISPR / Cas12b

[0179] To evaluate the sensitivity of the one-pot microfluidic detection system based on RT-LAMP-CRISPR / Cas12b, serially diluted RNA was added to the detection system and incubated at 57°C for 1 hour. After the reaction, detection was performed using Cas12 nucleic acid test strips. The results are as follows: Figure 9 As shown, the one-pot microfluidic detection sensitivity of RT-LAMP-CRISPR / Cas12b is 1–103 ng / μL.

[0180] 3.3 Specificity test of the one-pot microfluidic detection system of RT-LAMP-CRISPR / Cas12b

[0181] To verify the specificity of the RT-LAMP-CRISPR / Cas12b one-pot microfluidic detection system for BWYV detection, this method was used to detect Western yellow beet virus (BWYV), pepper cryptovirus 2 (PCV2), and cucumber mosaic virus (CMV). The results are as follows: Figure 10 As shown, only the BWYV virus sample showed a red band on the T line of the Cas12 nucleic acid test strip, while the negative control, PCV2, and CMV samples did not show corresponding bands on the T line.

[0182] Example 2 Field Sample Detection

[0183] Tests were conducted on chili pepper samples from the field. Figure 11 The results show the field detection results of a one-pot microfluidic assay using RT-LAMP-CRISPR / Cas12b. The colorimetric results of the test strips are highly consistent with those of the PCR bands. These results demonstrate that the detection system of this invention exhibits excellent specificity, sensitivity, and reproducibility for detecting BWYV. Furthermore, it is simple to operate, requires no expensive instruments, and offers visualization advantages.

[0184] In an embodiment of the present invention, a microfluidic detection method for beet western yellow virus (BWYV) based on an RT-LAMP-CRISPR / Cas12b microfluidic detection kit achieves efficient, sensitive, and convenient virus detection by integrating isothermal amplification and CRISPR / Cas12b-mediated specific detection and visualization of results. Its detailed working principle is as follows:

[0185] First section: Sample loading onto the microfluidic chip

[0186] The extracted viral RNA was then added to the sample loading chamber of the microfluidic chip. The microfluidic chip is designed with multiple independent fluid channels and reaction chambers, enabling precise dispensing and reaction control of small-volume samples. Through microfluidic technology, the sample RNA is effectively delivered to the detection chamber while avoiding sample cross-contamination and diffusion, thus improving the specificity and sensitivity of the detection.

[0187] Second paragraph: Preloading of the CRISPR / Cas12b detection system

[0188] In the detection chamber of the microfluidic chip, a CRISPR / Cas12b detection system containing specific crRNA and probes is pre-loaded. The crRNA (CRISPR RNA) sequence is designed to specifically recognize and bind to the target sequence of BWYV. Once bound to the target RNA, the Cas12b protein is activated, cleaving the nearby probe and releasing a signal. This pre-loading ensures the automation and efficiency of the detection process, enabling the system to respond rapidly to the appearance of amplification products within the detection chamber.

[0189] Section 3: Preparation and Mixing of the RT-LAMP Amplification System

[0190] In step 4, the RT-LAMP amplification system containing the primers is mixed with raffinose (as a stabilizer or enhancer) and then added to the injection well of the microfluidic chip. RT-LAMP is a highly efficient isothermal amplification technique that can rapidly amplify viral RNA at a constant temperature. The primers are specifically targeted at the BWYV genome sequence, and through the synergistic effect of circular primers and inner primers, a stable hairpin structure is formed, achieving efficient RNA amplification. This process does not require expensive thermal cycling equipment and is suitable for portable and on-site detection applications.

[0191] Section 4: Aggregation of Samples and Amplification System and Reaction Initiation

[0192] In step 5, the sample RNA from step 2, propelled by the flow path from step 4, moves along the channels of the microfluidic chip and accumulates at the bottom of the detection chamber in step 3. At this point, the RNA is thoroughly mixed with the RT-LAMP amplification system, initiating the isothermal amplification reaction. The isothermal heater is maintained at a suitable temperature (typically 57°C) to ensure the efficient execution of the RT-LAMP reaction. As the viral RNA amplifies, the concentration of the target sequence within the detection chamber rapidly increases, providing sufficient trigger signals for the CRISPR / Cas12b system, promoting probe cleavage and signal release.

[0193] Section 5: Detection of Amplification Products and Interpretation of Results

[0194] After the amplification reaction is completed (step 6), the amplification products are specifically detected using the CRISPR / Cas12b system (step 7). The activated Cas12b protein cleaves the probe, releasing a visual signal. These signals are displayed as red bands on the Cas12 nucleic acid test strip. The test strip design includes a control line (C line) and a test line (T line): when both the C line and T line show red bands, the result is positive; when only the C line shows a red band and the T line does not show color, the result is negative. The control line ensures the validity of the detection process and the proper functioning of the reagents, while the test line displays the specific virus detection result. This simple visual reading method requires no professional equipment, facilitating rapid on-site judgment of test results and improving the practicality and convenience of the test.

[0195] Through the five steps described above, the detection method of the RT-LAMP-CRISPR / Cas12b-based microfluidic detection kit for beet western yellow virus of this invention combines efficient RNA extraction, specific isothermal amplification, accurate CRISPR / Cas12b-mediated detection, and convenient visualization of results, providing a rapid, sensitive, and easy-to-use virus detection solution. This method not only improves the accuracy and reliability of detection but also significantly shortens the detection time and reduces the detection cost, demonstrating broad prospects for industrial application and promotional value.

[0196] Application Example 1: Detection Method of Beetroot Western Aflatoxin Based Microfluidic Detection Kit using RT-LAMP-CRISPR / Cas12b

[0197] This embodiment demonstrates the specific steps and procedures for virus detection using the RT-LAMP-CRISPR / Cas12b-based microfluidic detection kit for beet western yellow virus (BWYV) of the present invention.

[0198] Step 1: RNA extraction

[0199] RNA was extracted from leaves infected with BWYV using TRIzol reagent according to the manufacturer's instructions. Specific procedures included:

[0200] 1. Grind approximately 100 mg of leaf tissue evenly and add 1 mL of TRIzol reagent.

[0201] 2. Centrifuge at 12,000×g, 4℃, for 10 minutes, and collect the supernatant.

[0202] 3. Add 200 μL of chloroform, shake vigorously, and let stand for 3 minutes.

[0203] 4. Centrifuge again at 12,000×g, 4℃, for 15 minutes, and collect the supernatant.

[0204] 5. Add an equal volume of isopropanol to precipitate the RNA, centrifuge at 10,000×g, 4℃, for 10 minutes.

[0205] 6. Wash the RNA precipitate in 75% ethanol, centrifuge at 8,000×g, 4℃, for 5 minutes, dry, and then dissolve in 30 μL of RNAase-free water.

[0206] The concentration of the extracted RNA was determined using NanoDrop to ensure it met the requirements for subsequent amplification and detection.

[0207] Step 2: Loading the sample into the microfluidic chip

[0208] 100 μL of extracted RNA sample was added to the sample dispensing chamber of the microfluidic chip. The microfluidic chip is made of common resin material and is designed with multiple independent fluid channels and reaction chambers to ensure that the sample can be accurately and uniformly distributed to each detection unit.

[0209] Step 3: Preloading of the CRISPR / Cas12b detection system

[0210] A CRISPR / Cas12b detection system containing specific crRNA and probes is pre-loaded into the detection chamber of the microfluidic chip. The specific configuration is as follows:

[0211] The crRNA sequence was designed to target the RdRp gene region of BWYV to ensure high specificity and high sensitivity.

[0212] The probe uses an oligonucleotide sequence labeled with 6-carboxyfluorescein (6-FAM) and biotin, which releases a signal when cleaved by Cas12b.

[0213] Step 4: Preparation and mixing of the RT-LAMP amplification system

[0214] At room temperature, the RT-LAMP amplification system containing BWYV-specific primers (including dNTPs, Bst DNA polymerase, buffer, etc.) was mixed thoroughly with 5 μL of raffinose solution. The mixture was then added to the injection wells of the microfluidic chip.

[0215] Step 5: Aggregation of sample and amplification system and reaction initiation

[0216] Using a pressure-driven system within the microfluidic chip, the RNA sample and RT-LAMP amplification system accumulate at the bottom of the detection chamber, initiating an isothermal amplification reaction. The entire microfluidic chip is then placed in a constant-temperature heater, maintaining the temperature at 57°C for 30 minutes of RT-LAMP reaction. During this process, viral RNA is efficiently amplified, generating a large amount of target DNA sequence, providing sufficient trigger signals for the CRISPR / Cas12b system.

[0217] Step 6: Detection of amplification products and reading of results

[0218] After amplification, the amplification products are specifically detected using a CRISPR / Cas12b system. The amplification products in the detection chamber are then transferred into a Cas12 nucleic acid test strip via a microfluidic chip. The test strip design includes a control line (C line) and a test line (T line).

[0219] Positive result: Red bands appeared in both the C and T lines, indicating the presence of BWYV virus in the sample.

[0220] Negative result: Only the C line showed a red band, and the T line did not show color, indicating that BWYV virus was not detected in the sample.

[0221] The quality control line ensures the effectiveness of the testing process and the proper functioning of the reagents, while the test line displays the specific virus test results. Results can be quickly determined visually, requiring no specialized equipment, making it suitable for rapid on-site testing applications.

[0222] Application Example 2: Detection Method of Beetroot Western Aflatoxin Based Microfluidic Detection Kit using RT-LAMP-CRISPR / Cas12b

[0223] This embodiment further illustrates the specific operation and optimization process of using the microfluidic detection kit of the present invention to perform BWYV detection under different conditions, so as to improve the sensitivity and specificity of detection.

[0224] Step 1: RNA extraction

[0225] 100 mg samples were taken from healthy and BWYV-infected beet stem tissues, and RNA was extracted using the Qiagen RNeasyMini Kit according to the manufacturer's instructions. Specific steps included:

[0226] 1. Add the sample tissue to RLT lysis buffer and lyse thoroughly.

[0227] 2. Remove proteins and other impurities by column purification and wash the RNA precipitate.

[0228] 3. Wash the purification column with 70% ethanol, centrifuge, and then dry at room temperature.

[0229] 4. Dissolve the RNA precipitate in 30 μL of RNase-free water and store at 80°C for later use.

[0230] The extracted RNA was tested using Agilent Bioanalyzer to ensure its integrity and purity met the testing standards.

[0231] Step 2: Loading the sample into the microfluidic chip

[0232] 50 μL of extracted RNA sample is added to the sample dispensing chamber of the microfluidic chip, and the sample flow path is controlled by a microfluidic valve to prevent cross-contamination.

[0233] Step 3: Preloading of the CRISPR / Cas12b detection system

[0234] The pre-installed CRISPR / Cas12b detection system is pre-loaded in the detection chamber, including:

[0235] A 1μM specific crRNA, designed to target the CP gene sequence of BWYV, ensures high specificity for virus recognition.

[0236] The probe is labeled with 0.5 μM 6-FAM and Biotin. When Cas12b is activated, the probe is cleaved to release the signal.

[0237] Step 4: Preparation and mixing of the RT-LAMP amplification system

[0238] The RT-LAMP amplification system containing BWYV-specific primers (including buffer, dNTPs, Bst DNA polymerase, MgSO4, etc.) was mixed with 10 μL of raffinose solution. The mixture was injected into the detection chamber through the injection well of the microfluidic chip to form a homogeneous amplification reaction system.

[0239] Step 5: Aggregation of sample and amplification system and reaction initiation

[0240] The RNA sample and RT-LAMP amplification system are aggregated in the detection chamber via an electrically controlled valve on the microfluidic chip, initiating the RT-LAMP reaction. The chip is then placed in a portable thermostat, maintaining the temperature at 63°C for 40 minutes of isothermal amplification. This process utilizes microfluidic technology to achieve efficient reaction control and uniform amplification product generation.

[0241] Step 6: Detection of amplification products and reading of results

[0242] After amplification, the amplification products were specifically detected using the CRISPR / Cas12b system. The products in the reaction chamber were transferred into a Cas12 nucleic acid test strip via a chip, and the color change on the test strip was observed.

[0243] Positive result: Both the control line (C line) and the test line (T line) show red bands, indicating the presence of BWYV virus in the sample.

[0244] Negative result: Only the control line (C line) shows a red band, and the test line (T line) does not show color, indicating that BWYV virus was not detected in the sample.

[0245] In this embodiment, by optimizing the RT-LAMP reaction time and the concentration of the CRISPR / Cas12b detection system, the detection sensitivity was improved, enabling the method to maintain high accuracy even under low viral load conditions.

[0246] The two specific embodiments described above detail the operational procedures and optimization strategies of the RT-LAMP-CRISPR / Cas12b-based microfluidic detection kit for beet western yellow virus in different application scenarios. These embodiments not only verify the feasibility and efficiency of the method of the present invention, but also demonstrate its flexibility and adaptability in practical applications, further highlighting the innovation and practical value of the present invention in the field of rapid virus detection.

[0247] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A detection method of a RT-LAMP-CRISPR / Cas12b-based sugar beet western yellows virus microfluidic detection kit, characterized in that, The method comprises the following steps: Step 1, extracting RNA of the sample to be detected; Step 2, adding the sample RNA to be detected into the sample chamber of the microfluidic chip; Step 3, preloading a CRISPR / Cas12b detection system containing crRNA and probes in the detection chamber of the microfluidic chip; Step 4, mixing the RT-LAMP amplification system containing primers with the raffinose, and then adding into the injection hole; Step 5, the sample of step 2 is pushed to the bottom of step 3 under the push of step 4; Step 6, placing the microfluidic chip after step 5 into a constant temperature heater for amplification and detection, and obtaining a detection product; Step 7, performing Cas12 nucleic acid test strip detection on the detection product, and if red bands appear on the quality control line and the detection line of the test strip, the result is positive; If a red band appears on the quality control line of the test strip, and the detection line does not develop color, the result is negative; the quality control line of the test strip is C line; and the detection line is T line; The CRISPR / Cas12b detection system in step 3 is: 10x Cas12b reaction buffer 3 μL, 5 μM AapCas12b protease 1 μL, 500 nM crRNA 5 μL, 2 μM ssDNA probe 12 μL, and pure water is added to 30 μL; The RT-LAMP amplification system in step 4 is: 2x LAMP Master Mix 12.5 μL, 40 μM inner primers FIP and BIP 1.6 μL each, 5 μM outer primers F3 and B3 0.2 μL each, 20 μM loop primer LB 0.4 μL, 5 M betaine 3 μL, 1 μL of sample RNA to be detected, and pure water is added to 25 μL; the RT-LAMP amplification primers include the following primer pairs: the F3 / B3 nucleotide sequence is shown in SEQ ID NO. 1 and SEQ ID NO. 2; the FIP / BIP nucleotide sequence is shown in SEQ ID NO. 3 and SEQ ID NO. 4; the LB nucleotide sequence is shown in SEQ ID NO. 5; the CRISPR / Cas12b detection system includes the crRNA nucleotide sequence shown in SEQ ID NO. 6; and the ssDNA sequence is shown in SEQ ID NO.

7.

2. The detection method of the RT-LAMP-CRISPR / Cas12b based sugar beet western yellows virus microfluidic detection kit according to claim 1, characterized in that, In step 6, the amplification and detection conditions are 57°C for 1 hour.

3. A RT-LAMP-CRISPR / Cas12b based microfluidic detection kit for detecting Beet western yellows virus according to the detection method of claim 1, characterized in that, The RT-LAMP-CRISPR / Cas12b-based sugar beet western yellows virus microfluidic detection kit includes an RT-LAMP amplification system and a CRISPR / Cas12b detection system, and the RT-LAMP amplification primers include the following primer pairs: the F3 / B3 nucleotide sequence is shown in SEQ ID NO. 1 and SEQ ID NO. 2; the FIP / BIP nucleotide sequence is shown in SEQ ID NO. 3 and SEQ ID NO. 4; and the LB nucleotide sequence is shown in SEQ ID NO. 5; The CRISPR / Cas12b detection system includes the crRNA nucleotide sequence shown in SEQ ID NO. 6; and the ssDNA sequence is shown in SEQ ID NO.

7. Also included is raffinose at a concentration of 0.1 g / ml.

4. The RT-LAMP-CRISPR / Cas12b based sugar beet western yellows virus microfluidic detection kit according to claim 3, characterized in that, Also included is a microfluidic chip comprising an injection hole for the isothermal amplification of the primer and the raffinose, a sample loading chamber for the sample to be tested, a detection chamber for the detection using the crRNA and the probe, a 1000 μm microchannel connecting the injection hole and the sample loading chamber, and a 1000 μm Tesla valve connecting the sample loading chamber and the detection chamber.

5. A detection system for implementing the RT-LAMP-CRISPR / Cas12b-based sugar beet western yellows virus microfluidic detection kit according to claim 3, characterized in that, It comprises: a sample loading module for loading the sample RNA to be tested into the sample loading chamber of the microfluidic chip; a loading module for preloading the CRISPR / Cas12b detection system containing the crRNA and the probe in the detection chamber of the microfluidic chip; a mixing module for mixing the raffinose with the RT-LAMP amplification system containing the primer and the RNA to be tested in the Tesla valve microchannel; an aggregation module for the addition module to aggregate at the bottom of the loading module under the action of the mixing module; an amplification module for placing the completed microfluidic chip in a constant temperature heater for amplification and detection to obtain the detection product; a detection module for Cas12 nucleic acid test strip detection of the detection product, and red bands appear on the quality control line and the detection line of the test strip, and the result is positive; a red band appears on the quality control line of the test strip, and the detection line does not develop color, and the result is negative; the quality control line of the test strip is C line; and the detection line is T line.

Images