Pig chimeric embryo culture medium and application thereof in effectively improving in-vitro chimeric ability of pig embryonic stem cells

Abstract

The invention discloses a pig chimeric embryo culture medium and application thereof in effectively improving the in-vitro chimeric ability of pig embryonic stem cells, and belongs to the technical field of bioengineering. According to the pig chimeric embryo culture medium disclosed by the invention, a neutral culture environment for promoting synchronous development of stem cells and embryos is created by accurately regulating and controlling growth factors, nutrient substances and other key components in the culture medium. On the basis, overexpression of anti-apoptosis factors, optimization of microinjection conditions and adoption of a laser-assisted incubation means are combined, so that the chimeric efficiency is further improved, integration of the stem cells and embryos is effectively supported, the chimeric efficiency is improved, and a reliable in-vitro tool is provided for evaluating the chimeric ability and pluripotency of the pig stem cells.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and more particularly to a porcine chimeric embryo culture medium and an application thereof in effectively improving the in vitro chimerism ability of porcine embryonic stem cells. Background Art

[0002] Stem cell chimerism has become a key method in regenerative medicine and transgenic animal production. By injecting exogenous stem cells into embryos to achieve the integration of stem cells and embryonic cells, the function of stem cells in the embryonic development process is brought into play, providing an important way to study embryonic development and produce transgenic animals. In large animals such as pigs, this technology not only improves the regenerative potential and gene modification efficiency of chimeric individuals, but also provides an effective in vitro tool for evaluating the chimerism ability and pluripotency of stem cells.

[0003] However, the existing porcine embryonic stem cell chimerism technology has significant shortcomings. First, the in vivo chimerism operation is costly and complicated, which limits the promotion and application of this technology. Second, there are significant physiological differences between stem cells and embryos. The existing culture medium cannot provide a unified and suitable growth environment for both, which leads to limited survival rate and functional integration ability of stem cells in embryos, affecting the developmental potential of chimeric embryos.

[0004] Therefore, providing a porcine chimeric embryo culture medium and its application in effectively improving the in vitro chimerism ability of porcine embryonic stem cells is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a porcine chimeric embryo culture medium and its application in effectively improving the in vitro chimerism ability of porcine embryonic stem cells. By precisely regulating the growth factors, nutrients and other key components in the culture medium, a neutral culture environment is created that can promote the synchronous development of stem cells and embryos, and combined with other auxiliary means, the chimerism efficiency is maximized.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A porcine chimeric embryo culture medium is prepared by mixing embryonic stem cell culture medium (pEPSCM) without XAV-939 and WH-4-023 with porcine zygotic culture medium-3 (PZM-3) at a ratio of 1:1, adding Y-27632 to a final concentration of 10 μM, supplementing activin A to a final concentration of 20 ng / mL, and supplementing fetal bovine serum to a final concentration of 10%.

[0008] Furthermore, the porcine chimeric embryo culture medium contains the following components: KnockOut TMDMEM / F-12 (ThermoFisher) was mixed with embryo water (Sigma) 1:1 and contained 0.9% non-essential amino acid solution, 0.9 mM glutamine, 0.45% penicillin-streptomycin, 0.225% N2 (ThermoFisher), 0.225% B27 (ThermoFisher), 10.15% fetal bovine serum, 0.0315 mg / ml vitamin C, and 0.045% mycoplasma antibiotic Primocin. TM , 20 ng / ml activin A, 0.09 μM CHIR99021, 4.5 ng / ml leukemia inhibitory factor (LIF), 10 μM Y-27632, 0.045 mM β-mercaptoethanol, 47.62 mM sodium chloride, 4.41 mM potassium chloride, 155.24 μM potassium dihydrogen phosphate, 177.14 μM magnesium sulfate heptahydrate, 11.06 mM sodium bicarbonate, 3.24 μM gentamicin, 90 μM sodium pyruvate, 2.25 mM hypotaurine, 0.45% amino acid solution, 1.28 mM calcium lactate, and 1.35 mg / ml bovine serum albumin.

[0009] The composition of the porcine chimeric embryo culture medium is as follows: the total amount of the basal culture medium accounts for 90% (pEPSCM is 45%, PZM3 is 45%), supplemented with 10% fetal bovine serum, and contains 20 ng / ml activin A and 10 μM Y-27632.

[0010] pEPSCM: Basic Medium KnockOut TM DMEM / F-12 supplemented with 1% non-essential amino acid solution, 1mM glutamine, 1% penicillin-streptomycin, 0.5% N2 supplement, 0.5% B27 supplement, 0.07mg / ml vitamin C, 0.1% mycoplasma antibiotic Primocin TM , 20 ng / ml activin A, 0.2 μM CHIR99021, 10 ng / ml leukemia inhibitory factor (LIF), 0.1 mM β-mercaptoethanol, 0.15 μM WH-4-023 and 2.5 μM XAV939, 0.3% fetal bovine serum.

[0011] PZM3: Add 105.83 mM sodium chloride, 9.8 mM potassium chloride, 344.97 μM potassium dihydrogen phosphate, 393.64 μM magnesium sulfate heptahydrate, 24.57 mM sodium bicarbonate, 7.2 μM gentamicin, 0.2 mM sodium pyruvate, 1 mM glutamine, 5 mM hypotaurine, 1% amino acid solution (Sigma), 1% non-essential amino acid solution (Sigma), 2.84 mM calcium lactate, and 3 mg / ml bovine serum albumin to the embryo water and adjust the osmotic pressure to 297 mOsm.

[0012] XAV-939 blocks the Wnt signaling pathway by increasing the level of AXIN protein and promoting the phosphorylation and degradation of β-catenin; WH-4-023, as an inhibitor of Lck / Src kinase, indirectly affects the Wnt signal by inhibiting Src kinase. The Wnt signaling pathway plays a key role in regulating the direction of stem cell differentiation and promoting the formation of specific cell types. Therefore, the withdrawal of XAV-939 and WH-4-023 can relieve the inhibition of Wnt signaling and optimize the differentiation process of stem cells.

[0013] Y-27632 supports the normal proliferation and differentiation of stem cells by inhibiting apoptosis, promoting cell proliferation, and improving cell attachment.

[0014] Fetal bovine serum is rich in nutrients, hormones and growth factors, which are essential for the growth and maintenance of pluripotency of stem cells, and significantly promote the development of the embryo.

[0015] Activin A plays an important role in regulating stem cell proliferation and maintaining their pluripotency, and significantly promotes the increase in the number of embryonic inner cell mass.

[0016] In order to further optimize the chimerism efficiency of stem cells and embryos, the present invention optimizes the culture system of chimeric embryos by using other auxiliary means.

[0017] (1) Overexpression of the anti-apoptotic factor BCL2 and the fluorescent marker mCherry in porcine embryonic stem cells not only enhances the anti-apoptotic ability of stem cells, but also facilitates monitoring of cell survival status and distribution through fluorescent labeling technology.

[0018] (2) Pig parthenogenetics were obtained in vitro. Uncleaved embryos were selected after 24 hours of embryonic development (the first day), and embryos at the morula stage were selected after 96 hours of embryonic development (the fourth day) to ensure that the selected embryos were in the most suitable chimera state.

[0019] (3) After digesting the porcine embryonic stem cells, 10-12 stem cells are injected into the embryo at the mulberry stage using a microinjection instrument, and then the culture medium is replaced with an optimized porcine chimeric embryo culture medium to provide a good environment for cell attachment and integration.

[0020] (4) The chimeric embryos were treated with a laser membrane rupture instrument after being cultured in the porcine chimeric embryo culture medium for 18 hours. Specifically, a thinning treatment was performed on one-fourth of the zona pellucida area. This was beneficial for promoting the integration of stem cells and embryos and improving the chimerism efficiency.

[0021] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses a porcine chimeric embryo culture medium and its application in effectively improving the in vitro chimerism ability of porcine embryonic stem cells, which has the following beneficial effects:

[0022] The porcine chimeric embryo culture medium of the present invention is prepared by mixing pEPSCM from which XAV-939 and WH-4-023 are removed with PZM-3 in a 1:1 ratio, and adding Y-27632, activin A and fetal bovine serum. This optimized formula significantly improves the proliferation and differentiation ability of stem cells, creates an ideal growth environment, promotes the overall development of the embryo, and is the basis for achieving efficient chimerism.

[0023] On this basis, the present invention combines the following auxiliary means to further improve the chimerism efficiency: overexpressing the anti-apoptotic factor BCL2 in porcine embryonic stem cells, enhancing the anti-apoptotic ability of cells and improving the survival rate. Optimizing the cell injection conditions to put the chimeric embryo in the best state, effectively supporting the integration of stem cells and embryos. Combining laser-assisted hatching technology to promote the integration of stem cells and embryos and improve the chimerism efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0025] Figure 1 The piggybac TRE6H-BCL2-Hygro vector map is shown;

[0026] Figure 2 The effect of laser membrane rupture on the embryonic zona pellucida is shown. One quarter of the embryonic zona pellucida is selected for local thinning. The scale bar is 1:50 μm.

[0027] Figure 3 The fluorescence marker mCherry and bright field images of chimeric embryos at the D4 and D7 stages are shown in this figure. The distribution of exogenous stem cells in the chimeric embryo can be observed through the mCherry fluorescence marker, while the bright field image shows the overall morphology and developmental status of the embryo;

[0028] Figure 4 The staining and colocalization of the trophoblast marker (CDX2) and the stem cell marker mCherry are shown;

[0029] Figure 5 The staining and colocalization of the inner cell mass marker (SOX2) and the stem cell marker mCherry are shown;

[0030] Figure 6 The staining and colocalization of the primitive endoderm marker (SOX17) and the stem cell marker mCherry are shown;

[0031] Figure 7 The staining and localization of the cell structure marker (E-cadherin) and stem cell marker mCherry are shown;

[0032] Figure 8 The proliferation of stem cells in chimeric embryos is shown when they are delayed in vitro culture until the tenth day. DETAILED DESCRIPTION

[0033] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] Example 1

[0035] (I) Reagent sources and preparation

[0036] source:

[0037] a: pig follicular fluid

[0038] Fresh ovarian tissue of pigs was obtained from COFCO Meat Food Co., Ltd., Wuhan, Hubei Province (collection time: September 2023-August 2024), placed in a 38°C saline thermos, and transported to the laboratory within 1 hour. Subsequently, a syringe equipped with a 12G needle was used to extract 2 to 8 mm of follicular fluid from the surface of the ovary and transferred to a 50 mL centrifuge tube. The centrifuge tube was placed in a 38°C incubator for 30 minutes to allow the cumulus granulosa cell-oocyte complex (COCs) to settle at the bottom of the centrifuge tube. Then, the upper follicular fluid was separated by centrifugation at 3000 rpm for 30 minutes, and the supernatant was filtered through a 0.22 μm filter to obtain sterile porcine follicular fluid.

[0039] b: Porcine oocyte in vitro maturation culture medium: The following components were added to the M199 basal culture medium without HEPES (ThermoFisher-11150059): 10% porcine follicular fluid, 1 mg / mL cysteine, 0.44 mg / mL sodium pyruvate, 10 ng / mL epidermal growth factor, 50 ng / mL insulin, 5 IU / mL gonadotropin, 5 IU / mL chorionic gonadotropin and 11.3 ng / mL kanamycin.

[0040] c: Operating solution: Embryo water-based culture medium supplemented with 10% NCSU23, 22mM sodium chloride, 5.5mM glucose, 0.57mM cysteine, 1% glutamine, 2.25mM hypotaurine, 8.28mM taurine, 5% fetal bovine serum, 2mM sodium hydroxide, and the osmotic pressure was adjusted to 297mOsm.

[0041] NCSU23: 100 ml embryo water is supplemented with 6.3542 g sodium chloride, 0.6563 g potassium chloride, 0.1619 g sodium dihydrogen phosphate, 0.5864 g magnesium sulfate heptahydrate, 0.0750 g kanamycin, and 10 mg phenol red.

[0042] d: PVA-TLHEPES solution: Dissolve 6.6622 g of sodium chloride, 0.2311 g of potassium chloride, 0.1680 g of sodium bicarbonate, 0.0410 g of sodium dihydrogen phosphate, 1.443 ml of sodium lactate, 0.1017 g of magnesium chloride hexahydrate, 0.2940 g of calcium chloride dihydrate, 2.3830 g of HEPES, 0.0275 g of sodium pyruvate, 0.0750 g of kanamycin, 0.5000 g of polyvinyl alcohol, and 0.0100 g of phenol red in 1 L of ultrapure water and adjust the osmotic pressure to 297 mOsm.

[0043] e: Electrofusion solution: The components of the electrofusion solution include 0.3 mol / L mannitol, 1 mmol / L calcium chloride dihydrate, 0.1 mmol / L magnesium chloride hexahydrate, and 0.5 mmol / L HEPES, and the pH is adjusted to 7.2-7.4.

[0044] (II) Acquisition and culture of pig parthenogenetic embryos:

[0045] a: Collection and culture of GV-stage oocytes: Porcine ovaries were obtained from COFCO Meat Food Co., Ltd., Wuhan, Hubei Province (collection time: September 2023 to July 2024), placed in a 38°C saline thermos, and transported to the laboratory within 1 hour. Subsequently, a syringe equipped with a 12G needle was used to extract follicular fluid from 2-8mm follicles (GV stage) on the surface of the ovary and injected into a 50mL centrifuge tube. The centrifuge tube was placed in an incubator at 38°C and allowed to stand for 30 minutes. At this point, the cumulus-oocyte complex (COCs) will settle at the bottom of the centrifuge tube. After pouring off the upper follicular fluid, an equal volume of PVA-TLHEPES solution was added and gently inverted to resuspend the COCs. Finally, the liquid was poured into a 100mm culture dish, and a 500μm-caliber glass needle was used under a stereomicroscope to select COCs with good morphology, followed by culture in porcine oocyte in vitro maturation medium for 42 hours, and then mature oocytes were collected.

[0046] b: Collection of mature oocytes: After 42 hours of culture, take a 0.5mL centrifuge tube, add 400μL of HEPES-free M199 basal culture medium containing 0.1% (v / v) hyaluronidase, and then place the cultured mature COCs into the centrifuge tube, digest at 38.5°C for 5 minutes, and centrifuge at 1000rpm for 1 minute. Use a 200μm glass needle to draw COCs from the bottom of the centrifuge tube and wash them three times in PVA-TLHEPES solution to fully remove the cumulus granulosa cells on the zona pellucida of the oocyte. Finally, use a glass needle to blow and suck the oocyte under a stereomicroscope, and select the oocyte that discharges the first polar body, which is the mature oocyte.

[0047] c: Acquisition and culture of parthenogenetic embryos: Connect the electrofusion tank (3.2mm) and the electrofusion instrument, add 550μl of electrofusion solution to the electrofusion tank, and set the electrofusion parameters as follows: electric pulse time 40μs, 2 pulses, 640V voltage. After washing the selected mature oocytes in the electrofusion solution, transfer them to the electrofusion tank. Use a mouth pipette to quickly move the position of the oocytes so that the contact surface of the injected oocytes is perpendicular to the direction of the electric pulse electric field and then start the electric pulse. After the electric pulse is completed, the parthenogenetic embryos are obtained (marked as day 0 at this time), sucked out, washed in PZM-3 that was balanced in advance the day before, and finally transferred to the embryo culture well containing PZM-3 and cultured in a 38.5℃ constant temperature incubator. After four days of culture, the embryos generally develop to the mulberry stage, and after seven days of culture, the embryos generally develop to the blastocyst stage.

[0048] (III) Construction of a porcine embryonic stem cell line overexpressing the anti-apoptotic factor BCL2:

[0049] a: Preparation of mouse fetal fibroblast feeder layer: Healthy ICR mice of appropriate age were naturally mated, and the 13.5D fetus was removed from the mother's uterus. The blood was washed off with phosphate buffered saline (PBS) in a clean bench. The placenta and fetal membranes were peeled off with sterile tweezers, washed and transferred to a clean plate filled with PBS. After carefully separating the head, tail, limbs and internal organs of the fetus, the remaining part was transferred to a 1.5ml centrifuge tube and chopped into small particles with a diameter of no more than 0.2mm with sterile scissors. Each embryo was resuspended with 500-1000ml 0.05% trypsin (Sigma) and transferred to a 50ml centrifuge tube. After digestion in a 37℃ water bath for 5min, the mixture was mixed with a pipette and then placed in a 37℃ water bath for digestion for 5min. After terminating digestion with an equal volume of D10 culture medium (DMEM-Gibco basal medium supplemented with 10% fetal bovine serum, 1% glutamine and 1% penicillin-streptomycin), the cells were inoculated into large dishes (100 mm). The culture conditions were 5% CO2, 37°C and saturated humidity. The next day, the medium was changed to remove cells that were not attached to the wall. When the cells proliferated to more than 90% confluence, 3 ml of 0.05% trypsin was added to each large dish and digested at 37°C for 3 minutes, then transferred to a centrifuge tube and an equal system of D10 culture medium was added to terminate digestion. Centrifuge at 200g for 3-5 minutes and discard the supernatant, resuspend with D10 culture medium and pass to the P1 generation at a ratio of 1:3. When the P1 generation cells proliferated to 90% confluence, they were treated with 1 mg / ml working concentration of mitomycin C for 12 hours to stop cell proliferation. After washing the cells three times with DPBS (ThermoFisher), the cells were digested and collected. Resuspend the cell pellet with somatic cell freezing solution and dispense into cell freezing tubes, freeze the cells using gradient cooling method, and finally transfer to a liquid nitrogen tank for long-term storage.

[0050] b: Establishment and cryopreservation of porcine embryonic stem cell lines: Embryos were flushed out from the uterus of sows 5.5 days after mating and transferred to pre-heated embryo manipulation solution. Use a pipette with a diameter slightly smaller than the embryo to remove the zona pellucida and separate the inner cell mass (ICM) by repeated blowing and suction. The separated ICM was transferred to a small dish containing pEPSCM, and after two rinses, it was transferred to a porcine embryonic stem cell culture well with 10μM Y27632. Incubate in an incubator at 38.5°C, 5% CO2, and 5% O2 for 2 days. On the third day, pEPSCM containing 10μM Y-27632 was added to the culture well. On the fourth day, the original culture medium was removed, and new pEPSCM containing 10μM Y27-632 was added. From then on, new pEPSCM containing 10μM Y27-632 was replaced every day until clones grew out. This process takes about 7 to 10 days. After the clones are formed, they are replaced with normal pEPSCM without Y27-632 until the clones grow to a certain size and morphology, at which time they are marked as P0. The P0 clones are picked out with a glass needle and transferred to a PCR tube containing 10 μL 0.05% trypsin and digested in a 37°C incubator for 3 minutes. When the clones are slightly loose, they are blown apart with a pipette and inoculated onto the feeder cells of a 48-well plate (the feeder cells are revived two days in advance), and porcine embryonic stem cell culture medium containing 10 μM Y27-632 is added. When the clones grow to a certain morphology, normal subculture is performed. The subculture freezing step is to culture porcine embryonic stem cells in a small dish (35 mm), discard the culture medium, and wash away the residual culture medium with 1 mL PBS. Add 750 μL of 0.05% trypsin and digest in a 37°C incubator for 3 minutes, followed by terminating the digestion process with an equal volume of D10 culture medium. Next, centrifuge at 200g for 3 minutes at room temperature, discard the supernatant, and resuspend the cells with 1.5mL pEPSCM. After that, inoculate on mouse fetal fibroblast feeder cells at a ratio of 1:3, and add 5% fetal bovine serum and 5μM Y-27632 to promote cell growth and stability. After 12 to 24 hours, replace the culture medium with normal pEPSCM, and pay attention to changing the culture medium once a day. After 2 to 3 days, the cells can be passaged for the next round or frozen.

[0051] c: Overexpression of anti-apoptotic factor BCL2 (sequence as shown in SEQ ID NO.1), fluorescently labeled with mCherry:

[0052] BCL2 sequence:

[0053] ATGGCGCACGCTGGGAGAACAGGGTATGATAACCGGGAAATAGTGATGAAGTACATCCACTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCCGGAGACGCGGGCGCCGCGTCCCCGGGGGCCGCTCCCGCACCGGGCATCTTCTCCTGTACTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTGCGCCAGGCCGGCGATGACTTCTCTCGTCGCTACCGCCGCGACTTTGCCGAGATGTCCAGCCAGCTGCACCTGACTCCCTTCACCGCGAGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGGATGGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGATCCAGGATAACGGAGGCTGGGATGCCTTTGTGGAGCTGTATGGGCCCAGCATGCGGCCTCTATTTGATTTCTCCTGGCTGTCTCTGAAGGCGCTGCTCAGTCTGGCCCTGGTGGGAGCTTGCATCAC CCTGGGTGC CTATCTGGGCCATAAG ; SEQ ID NO.1.

[0054] (1) Construction of plasmid: Piggybac TRE6H-BCL2-Hygro (vector map see Figure 1 ):

[0055] 1) Using porcine ovarian cDNA as a template and BCL2-F / R as primers, perform PCR amplification; the specific primer sequences are as follows:

[0056] BCL2-F:

[0057] GTACCACTTCCTACCCTCGTAAAGGAAGCTT ATGGCGCACGCTGGGAG AAC ; SEQ ID NO.2;

[0058] BCL2-R:

[0059] CCTGGGTGCCTATCTGGGCCATAAGGGATCCGGTGTCGACGACTACAA AG; SEQ ID NO. 3.

[0060] The PCR reaction system was prepared according to the PrimeSTAR GXL DNA Polymerase instruction manual: 5× PrimeSTAR GXL Buffer 10 μL, dNTP Mixture (2.5 mM each) 4 μL, BCL2-F (10 μM) 1.5 μL, BCL2-R (10 μM) 1.5 μL, ovarian cDNA template 0.5 μg, PrimeSTAR GXL DNA Polymerase 1 μL, and double distilled water to make up to 50 μL.

[0061] The PCR reaction procedure is as follows:

[0062]

[0063] The PCR product was identified by electrophoresis. If the band size was correct, the PCR product was purified and recovered according to the FastPure Gel DNA Purification and Recovery Kit operating instructions. The concentration was measured with Nanodrop and then stored in a -20℃ refrigerator.

[0064] 2) Plasmid linearization

[0065] Plasmid piggybac-TRE6H-EOMES-HygroB See TianXu, Peng Su, Linhui Wu, OCT4regulates WNT / β-catenin signaling and prevents mesoendoderm differentiation by repressing EOMES in porcine pluripotent stem cells; Cellular Physiology.

[0066] The enzyme digestion system was configured according to the NEB high-fidelity enzyme operating system: 5 μg plasmid piggybac-TRE6H-EOMES-HygroB, 2.5 μl high-fidelity enzyme HindIII, 2.5 μl high-fidelity enzyme BamH1, 5 μl NEBuffer TM r2.1, double distilled water to 50μl. PCR reaction system at 37℃ for two hours. Electrophoresis identification of enzyme digestion products, if the band size is correct, according to the FastPure Gel DNA purification and recovery kit operating instructions to purify the PCR product recovery. After measuring the concentration with Nanodrop, store in a -20℃ refrigerator.

[0067] 3) Connect

[0068] The reaction system was prepared according to the BM Seamless Cloning Kit: 100-200 ng of BCL2 PCR amplification product, 20-50 ng of linearized plasmid piggybac-TRE6H-EOMES-HygroB, 5 μL of 2×Seamless Cloning Mix, and double distilled water to make up to 10 μL.

[0069] Incubate at 50°C in a PCR instrument for 30 min.

[0070] 4) Transformation of selected bacteria: Take out DH5α (Vazyme) chemical competent cells from the -80℃ refrigerator and melt them on ice. Take 2-3μL of the ligation product and add it to 50μL of competent cells, mix gently and place on ice for 15 minutes. Heat shock in a 42℃ water bath for 45s, and then place on ice for 2min. Add 450μL of LB liquid culture medium without antibiotics and revive in a shaker at 37℃ 200r / min for 1h. Centrifuge at 2500g for 3min, discard 400μL of the supernatant, resuspend the bacterial precipitate with the remaining culture medium and add it to an LB solid culture dish containing 0.1% AMP antibiotics. Spread it evenly and invert it in a 37℃ incubator for 12-14h. Pick a single colony for PCR identification. If the identification is correct, perform plasmid extraction, and remove endotoxins from the plasmid according to the Omega Endo-free Plasmid DNA MiniKitII kit instructions. After measuring the concentration, store in a -20℃ refrigerator.

[0071] (2) pcDNA3.1-mCherry was used to visualize and label stem cells and was purchased from Addgene (Catalog No.: 128744)

[0072] After the embryonic stem cells that have been frozen and stored after passage are revived (generally, embryonic stem cells within 20 generations are revived), the culture medium is discarded and washed with DPBS. 750μL 0.05% trypsin is added to each small dish and digested in a 37°C incubator for 3 minutes. Use a pipette to blow the clones into single cells and add an equal volume of D10 culture medium to terminate the digestion. Centrifuge at 200g for 2-3 minutes at room temperature and discard the supernatant. Add 1mL Opti-MEM (ThermoFisher) to resuspend and rinse once and centrifuge again. Discard the supernatant and resuspend the cells with 100μL Opti-MEM and add plasmids (2μg Piggybac TRE6H-BCL2-Hygro, 2μg pcDNA3.1-mCherry). Use a 200μL pipette to carefully transfer the cell suspension to a 2mm electric transfer cup, mark it and place it in the Nucleofector TMUse the 2bManual electroporator program to perform electroporation. As soon as possible after electroporation, use a fine-tipped pipette to transfer the cells to a new layer of mouse fetal fibroblast feeder cells.

[0073] 4. Cell digestion and injection

[0074] Porcine embryonic stem cells were inoculated in a 35 mm culture dish, and the culture medium was discarded. The cells were washed with 1 mL of PBS to remove the residual culture medium. 700 μL of type II collagenase was added and digested in a 37°C incubator for 6 minutes until cell clones were observed floating under a microscope. Subsequently, the supernatant was transferred to a 1.5 mL centrifuge tube, and an equal volume of D10 culture medium was added to terminate the digestion. Next, the cells were centrifuged at 1000 rpm for 3 minutes at room temperature, and the supernatant was discarded. The cells were resuspended in 500 μL TrypLE (ThermoFisher), digested in a 37°C incubator for 2 minutes, and digested again with an equal volume of D10 culture medium. Centrifuged at 1000 rpm for 3 minutes at room temperature, the supernatant was discarded, and 500 μL of pEPSCM containing 10 μM Y-27632 was added to resuspend the cells. At this time, the cells were in the state of cell clones.

[0075] Embryos at the 8-cell stage after parthenogenetic activation and cultured in PZM-3 for 3 days were selected and placed in a drop of operating solution containing 0.01% cytochalasin (MCE) (20 μL per drop); digested cells were placed in a drop of PVA / PBS (0.25 g PVA (Sigma) dissolved in 100 ml PBS solution) solution (20 μL per drop). The injection plate also includes a needle wash drop containing 25% pancreatin (20 μL per drop). 10-12 porcine embryonic stem cells were drawn up using a hydraulic syringe and injected into the embryo. Embryos at the mulberry stage after parthenogenetic activation and cultured in PZM-3 for 4 days were selected, and the above-mentioned porcine embryonic stem cell injection into the embryo was performed in the same manner. The injected embryos were then placed in PZM-3 culture medium and cultured until the seventh day, and the number of blastocysts was counted under a stereomicroscope. The results are shown in Table 1.

[0076] Table 1 Statistics on the effect of stem cell injection on chimeric embryo development at different embryonic stages

[0077]

[0078] As shown in Table 1, injection of stem cells at the 8-cell embryonic stage will result in embryonic development arrest.

[0079] The embryos injected on the fourth day obtained in the cell digestion and injection in the above step (IV) were placed in a mixture of PZM-3 and pEPSCM in different ratios and cultured until the seventh day. The number of blastocysts was observed under a stereo microscope, and the number of blastocysts containing mCherry fluorescence markers was observed under a fluorescence microscope. The results are shown in Table 2.

[0080] Table 2 Statistics on the effects of different ratios of Pzm3 and pEPSCM mixed culture medium on the development of chimeric embryos

[0081]

[0082] As shown in Table 2, the overall embryonic development effect was the best when the ratio of PZM-3 to pEPSCM was 1:1.

[0083] The embryos injected on the fourth day obtained in the cell digestion and injection of the above step (IV) were placed in PZM-3 and pEPSCM (1:1), PZM-3 and pEPSCM without XAV939 (1:1), PZM-3 and pEPSCM without XAV939 and WH-4-023 (1:1) and mixed cultured until the seventh day. The number of blastocysts was observed under a stereo microscope, and the number of blastocysts containing mCherry fluorescent markers was observed under a fluorescence microscope. The blastocysts were then collected for immunofluorescence staining.

[0084] The immunofluorescence staining procedure is as follows:

[0085] Fixation: The chimeric embryos were placed in a fixative solution (0.4 g PFA (Sigma) dissolved in 10 ml PBS) at room temperature for 30 minutes.

[0086] Washing: Wash three times with washing solution (0.05 g PVA (Sigma) dissolved in 100 ml PBS).

[0087] Permeabilization: The embryos were transferred to a permeabilization solution (20 μl Triton-X100-Sigma dissolved in 10 ml PBS), left to stand at room temperature for 30 minutes, and then washed again three times with a washing solution.

[0088] Blocking: Transfer the embryos into blocking solution (Biyuntian P0023B) and let stand at room temperature for 2 hours.

[0089] Primary antibody incubation: The embryos were incubated in an antibody diluent (Biyuntian) containing 0.5% SOX2 antibody (SantaCruz, marking inner cell mass, mouse antibody) for 24 hours.

[0090] Washing: Wash again three times with washing solution.

[0091] Secondary antibody incubation: embryos were transferred to antibody diluent containing 0.1% (v / v) fluorescent secondary antibody (Beyotime AlexaFluor488) and incubated at room temperature for 1 hour.

[0092] DAPI staining: Finally, the blastocyst was placed on a glass slide with a mounting solution (Biyuntian) containing DAPI (Biyuntian nuclear stain) for pressing.

[0093] The cells were observed under a fluorescence microscope and the number of inner cell masses was counted. The results are shown in Table 3.

[0094] Table 3 Statistics of the effects of XAV-939 and WH-4-023 on the development of chimeric embryos in culture medium

[0095]

[0096] As shown in Table 3, the removal of XAV-939 and WH-4-023 can significantly promote the embryonic chimerism efficiency and the development of the inner cell mass.

[0097] The embryos injected on the fourth day obtained in the above step (IV) of cell digestion and injection were placed in a mixture of PZM-3 and pEPSCM (1:1) without XAV939, WH-4-023, and activin A, and set as the group with 0 ng activin A added; the embryos injected on the fourth day were placed in PZM3 and pEPSCM (1:1) without XAV939 and WH-4-023, and then supplemented with activin A to a concentration of 20 ng / ml, and set as the group with 20 ng / ml added; the two groups of embryos were cultured to the seventh day, and the number of blastocysts was observed under a stereo microscope, and the number of blastocysts containing mCherry fluorescence markers was observed under a fluorescence microscope. The blastocysts were then collected for immunofluorescence staining (using SOX2 antibody to mark the inner cell mass). The results are shown in Table 4.

[0098] Table 4 Effects of different concentrations of activin A on the development of chimeric embryos

[0099]

[0100] It can be seen from Table 4 that 20 ng / ml activin A has the best effect on promoting the development of chimeric embryos.

[0101] (V) Laser-assisted hatching: Before laser-assisted hatching, first culture the embryos injected on the fourth day obtained in step (IV) cell digestion and injection in porcine chimeric embryo culture medium for 18 hours to ensure that the embryos are in a suitable state and stable development. Transfer the cultured chimeric embryos to a micromanipulation platform suitable for laser operation. Start the laser membrane rupture instrument and calibrate the laser intensity and pulse parameters according to the diameter of the embryonic zona pellucida to ensure that it is suitable for the treatment of the embryonic zona pellucida. Generally, the energy and duration of the laser should be sufficient to thin the zona pellucida without causing damage to the internal structure of the embryo. Observe the embryo under a microscope and select a quarter of the zona pellucida as the target area for laser thinning. After precise positioning under a microscope, use a laser membrane rupture instrument to thin the selected quarter of the zona pellucida. The laser pulse should gradually weaken the thickness of the zona pellucida to ensure that it is thin enough for embryo hatching but not broken. After the laser thinning is completed, carefully observe the treated area under a microscope to confirm that the thickness of the zona pellucida has been significantly thinned and to ensure that the embryonic structure is not damaged. If necessary, the laser parameters can be appropriately adjusted and additional treatment can be performed. The treated chimeric embryos were cultured continuously at 38.5°C and 5% CO2 until the seventh day, i.e., the blastocyst stage, and the hatching rate and overall morphological changes were observed. Figure 2 Shown are the specific areas of the embryo that were treated with laser thinning; Figure 3 Shown are the morphological characteristics of embryos that developed to the blastocyst stage after laser assistance.

[0102] (VI) Detection of stem cell proliferation and differentiation in chimeric embryo development:

[0103] Collection step (V) Immunofluorescence staining of embryos on the 7th day after laser-assisted hatching. CDX2 is used as a marker for trophoblast cells, SOX2 is used as a marker for inner cell mass, SOX17 is used as a marker for primitive endoderm, and stem cells carry the mCherry red fluorescent marker. The specific steps are as follows:

[0104] Fixation: The chimeric embryos were placed in fixative solution (0.4 g PFA dissolved in 10 ml PBS) at room temperature for 30 minutes.

[0105] Washing: Wash three times with washing solution (0.05 g PVA dissolved in 100 ml PBS).

[0106] Permeabilization: The embryos were transferred to a permeabilization solution (20 μl Triton-X100 (Sigma) dissolved in 10 ml PBS), left to stand at room temperature for 30 minutes, and then washed again three times with a washing solution.

[0107] Blocking: Transfer the embryos to the blocking solution and incubate at room temperature for 2 hours.

[0108] Primary antibody incubation: Incubate embryos in dilutions of the following antibodies at 4°C for 24 hours:

[0109] 0.5% SOX2 antibody (SantaCruz, marking inner cell mass, mouse antibody)

[0110] 1% CDX2 antibody (BiogeneX, labeling trophoblast, mouse antibody)

[0111] 0.3% SOX17 antibody (R&D, marking primitive endoderm, sheep antibody)

[0112] 0.5% E-cadherin (abcam, cell structure marker, mouse antibody)

[0113] Washing: Wash again three times with washing solution.

[0114] Secondary antibody incubation: transfer the embryos to an antibody diluent containing 0.1% (v / v) fluorescent secondary antibody (the secondary antibody corresponding to the mouse antibody is Beyotime's anti-mouse AlexaFluor488, the secondary antibody corresponding to the rabbit antibody is Beyotime's anti-rabbit AlexaFluor549, and the goat antibody is Beyotime's horseradish enzyme-labeled rabbit anti-goat IgG (H+L)) and incubate at room temperature for 1 hour.

[0115] DAPI staining: Finally, the blastocyst was placed on a slide with a DAPI-containing mounting solution for pressing.

[0116] Observe under a fluorescence microscope to count the number of different types of cells in the chimeric embryos and the chimerism of stem cells. Figure 4 The co-localization of the embryonic trophoblast marker CDX2 and the stem cell fluorescent marker mCherry was demonstrated, indicating that the stem cells were successfully integrated into the embryo and completed the process of differentiation into the trophoblast. Figure 5 The co-localization of the embryonic inner cell mass marker SOX2 and the stem cell fluorescent marker mCherry was demonstrated, indicating that the stem cells were successfully integrated into the embryo and completed the process of differentiation into the inner cell mass. Figure 6 The co-localization of embryonic primitive endoderm marker SOX17 and stem cell fluorescent marker mCherry was demonstrated, indicating that stem cells were successfully integrated into the embryo and completed the process of differentiation into primitive endoderm. Figure 7 The co-localization of the cell structure marker (E-cadherin) and the stem cell fluorescent marker mCherry was shown, indicating that the stem cells are well integrated with the surrounding cells, helping to maintain the overall structure and integrity of the embryo. This intercellular connection helps the embryo maintain its complete morphology and function during development.

[0117] (VII) Delayed in vitro culture of chimeric embryos:

[0118] The chimeric embryos hatched on the seventh day were transferred to in vitro delay medium and half of the medium was changed every day. In vitro delay medium was a 1:1 mixture of Advanced DMEM / F-12 (ThermoFisher) and Neurobasal (ThermoFisher) supplemented with 1% N2 and 0.5% B27 medium, 1% glutamine, 1% penicillin-streptomycin, 20 ng / ml activin A and 10 μM Y-27632. On the tenth day of culture, embryos were collected for immunofluorescence staining. Figure 8 This indicates that the delayed development system of chimeric embryos significantly promotes the further proliferation of stem cells.

[0119] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A porcine chimeric embryo culture medium, characterized in that: Contains the following ingredients: KnockOut TM DMEM / F-12 is mixed with embryo water 1:1 and contains 0.9% non-essential amino acid solution, 0.9mM glutamine, 0.45% penicillin-streptomycin, 0.225% N2, 0.225% B27, 10.15% fetal bovine serum, 0.0315mg / ml vitamin C, 0.045% mycoplasma antibiotic Primocin TM , 20 ng / ml activin A, 0.09 μM CHIR99021, 4.5 ng / ml leukemia inhibitory factor, 10 μM Y-27632, 0.045 mM β-mercaptoethanol, 47.62 mM sodium chloride, 4.41 mM potassium chloride, 155.24 μM potassium dihydrogen phosphate, 177.14 μM magnesium sulfate heptahydrate, 11.06 mM sodium bicarbonate, 3.24 μM gentamicin, 90 μM sodium pyruvate, 2.25 mM hypotaurine, 0.45% amino acid solution, 1.28 mM calcium lactate, and 1.35 mg / ml bovine serum albumin.

2. The method for preparing a porcine chimeric embryo culture medium according to claim 1, characterized in that: The specific steps are as follows: pEPSCM from which XAV-939 and WH-4-023 were removed was mixed with PZM-3 at a ratio of 1:1, Y-27632 was added to a final concentration of 10 μM, activin A was supplemented to a final concentration of 20 ng / mL, and fetal bovine serum was supplemented to a final concentration of 10.15%.

3. The method for preparing a porcine chimeric embryo culture medium according to claim 2, characterized in that: The pEPSCM contains the following components: Basic medium KnockOut TM DMEM / F-12 supplemented with 1% non-essential amino acid solution, 1mM glutamine, 1% penicillin-streptomycin, 0.5% N2 supplement, 0.5% B27 supplement, 0.07mg / ml vitamin C, 0.1% mycoplasma antibiotic Primocin TM , 20 ng / ml activin A, 0.2 μM CHIR99021, 10 ng / ml leukemia inhibitory factor, 0.3% fetal bovine serum, 0.1 mM β-mercaptoethanol, 0.15 μM WH-4-023 and 2.5 μM XAV939.

4. The method for preparing a porcine chimeric embryo culture medium according to claim 2, characterized in that: The PZM-3 contains the following ingredients: 105.83 mM sodium chloride, 9.8 mM potassium chloride, 344.97 μM potassium dihydrogen phosphate, 393.64 μM magnesium sulfate heptahydrate, 24.57 mM sodium bicarbonate, 7.2 μM gentamicin, 0.2 mM sodium pyruvate, 1 mM glutamine, 5 mM hypotaurine, 1% amino acid solution, 1% non-essential amino acid solution, 2.84 mM calcium lactate, and 3 mg / ml bovine serum albumin are added to embryo water to adjust the osmotic pressure to 297 mOsm.

5. Use of the porcine chimeric embryo culture medium according to claim 1 in improving the in vitro chimerism ability of porcine embryonic stem cells.

6. A method for improving the in vitro chimerism efficiency of porcine embryonic stem cells, characterized in that: The specific steps are as follows: (1) Overexpression of the anti-apoptotic factor BCL2 and the fluorescent marker mCherry in porcine embryonic stem cells; (2) Obtaining pig parthenogenetic embryos in vitro, selecting embryos at the mulberry stage after 96 hours of embryonic development; (3) After digesting the porcine embryonic stem cells, 10-12 stem cells are injected into the embryos at the mulberry stage using a microinjection instrument, and then the culture medium is replaced with porcine chimeric embryo culture medium; (4) The chimeric embryos were treated with a laser membrane rupture instrument after being cultured in the porcine chimeric embryo culture medium for 18 hours, specifically thinning the zona pellucida in one quarter of the area.

Images