Molecular markers for the diagnosis and treatment of severe viral pneumonia

Abstract

The present invention relates to the field of biomedical technology, and specifically, to molecular markers for the diagnosis and treatment of severe viral pneumonia. TMEM176B exhibits good prognostic predictive value with a variety of interacting genes, providing a reliable molecular marker for the early judgment and screening of severe viral pneumonia; TMEM176B can be used as an intervention target for severe viral pneumonia, which has important value for clinical translation and the research and development of future drug targets.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and more particularly, to molecular markers for the diagnosis and treatment of severe viral pneumonia. Background Art

[0002] The intermittent outbreaks and large-scale epidemics of influenza viruses often trigger fatal diseases. Although vaccination and early antiviral treatment have, to some extent, improved the prognosis of patients, these prevention and treatment measures still have limitations. For example, influenza vaccines may fail, and the time window for antiviral treatment is relatively narrow. According to previous studies, the immune disorders and tissue damage caused by pathogens are more likely to lead to severe diseases. Therefore, finding more effective host markers for population screening and early intervention is of great significance for the treatment of future viral infectious diseases. Currently, although some host targets such as EN-RAGE, TNFSF14, ANXA1, FPR1, etc. have been reported, most of these studies are based on bioinformatics analysis of small sample data, and their reliability still needs to be further verified. Therefore, there is an urgent need to develop new and reliable diagnostic biomarkers to guide clinical practice.

[0003] Cell populations such as the mononuclear-macrophage system and dendritic cells not only play important roles in innate immunity but are also key mediators of adaptive immune responses and have an important position in the process of virus defense. Although many studies have focused on the roles of the development and differentiation of these cell populations in diseases, no reliable lineage-specific biomarkers have been found. Summary of the Invention

[0004] The present invention aims to find specific lineage markers of myeloid immune cells for screening high-risk populations of severe viral pneumonia. This not only helps with early diagnosis but also can minimize side effects in clinical interventions and has important translational value.

[0005] The present invention has discovered a mononuclear-macrophage-specific biomarker that is closely related to the diagnosis and treatment of severe viral pneumonia.

[0006] The first object of the present invention is to provide the use of a quantitative detection agent for a molecular marker in the preparation of a kit for the diagnosis and prognosis assessment of severe viral pneumonia; the molecular marker includes TMEM176B mRNA and / or protein.

[0007] The second object of the present invention is to provide the use of a molecule that specifically inhibits the transcription or translation of the TMEM176B gene, or is capable of specifically inhibiting the expression or activity of the TMEM176B protein in the preparation of a drug for the treatment of severe viral pneumonia.

[0008] TMEM176B shows good prognostic prediction value with multiple interacting genes, providing a reliable molecular marker for the early diagnosis and screening of severe viral pneumonia. In addition, TMEM176B, as an intervention target for severe viral pneumonia, has important clinical translational value and provides strong support for the development of future drug targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0010] Figure 1 : A. Expression of Tmem176B in different cell subtypes;

[0011] B. In BMDC cells, the expression changes of Tmem176B under unstimulated conditions and after stimulation with LPS or PolyI:C. n = 3; *, p < 0.05; **, p < 0.01, ***, p < 0.001); US, unstimulated group.

[0012] Figure 2 : Detection results of the expression level of Tmem176B in different cells.

[0013] Figure 3 : Expression pattern of Tmem176B.

[0014] A. Clustering and annotation of GSE149689;

[0015] B. Tmem176B is specifically expressed in the monocyte cluster;

[0016] C. Clustering and annotation of GSE145926;

[0017] D. Tmem176B is specifically expressed in the macrophage cluster.

[0018] Figure 4 : After influenza virus infection, Tmem176B is significantly downregulated in BMDM (A, M.O.I. = 5, 24 h.p.i.), BMDC (B, M.O.I. = 1, 24 h.p.i.) and RAW264.7 (C, M.O.I = 0.5); Student - t test. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; data are presented as mean ± standard deviation.

[0019] Figure 5 : Correlation analysis of TMEM176B and its co-expressed gene modules with inflammasome-pyroptosis genes;

[0020] A. WGCNA analysis of GSE97672;

[0021] B. WGCNA analysis of GSE163959;

[0022] C. hdWGCNA analysis of GSE149689;

[0023] D. The green module where TMEM176B is located in the GSE97672 dataset is related to inflammasome-pyroptosis related genes;

[0024] E. The turquoise module where TMEM176B is located in the GSE163959 dataset is related to inflammasome-pyroptosis related genes;

[0025] F. The turquoise module where TMEM176B is located in the GSE149689 dataset is related to inflammasome-pyroptosis related genes.

[0026] Figure 6 : Analysis of immune cell infiltration in samples of GSE163959;

[0027] A. Infiltration abundance of immune cells in samples of influenza infection;

[0028] B. Correlation analysis between each infiltrating immune cell and different gene modules, especially gene modules including TMEM176B.

[0029] Figure 7 : Pseudotime analysis of myeloid cells in GSE149689 (peripheral blood) and GSE202001 (mouse lung tissue);

[0030] A, C, Cell pseudotime plots and temporal expression changes of TMEM176B in GSE149689; B, D, Cell pseudotime plots of GSE202001 and temporal expression changes of TMEM176B; E, G, Analysis of time-differential genes in GSE149689 and GSE202001;

[0031] F, H, Branch trajectory prediction analysis in GSE149689 and GSE202001.

[0032] Figure 8 : Establishment of a prognostic model with TMEM176B and its related genes;

[0033] A. Cluster analysis of GSE202001;

[0034] B. Genes with significance < 0.1 were deleted as thresholds, eliminating genes with relatively low association with NLRP3;

[0035] C. The Venn diagram showed 185 intersecting genes, which were co-expressed genes of TMEM176B that were simultaneously related to NLRP3 and cell differentiation;

[0036] D - E. GO and KEGG analyses were performed on the 185 genes;

[0037] F - H. A random forest model was used in the training set of GSE157344 to obtain 27 genes affecting prognosis;

[0038] I - K. Different expression patterns (Wilcoxon test, p < 0.05) of the characteristic gene values of the 27 - gene module in patients of different ages (threshold 65), genders, and SOFA scores (threshold 5);

[0039] Figure 9 : After infection with influenza virus A / PR / 8 / 34, the prognosis of Tmem176b - / - mice was improved compared to wild - type mice:

[0040] Wild - type and Tmem176b - / - C57BL / 6 mice at 6 - 8 weeks of age were infected intratracheally with 750 PFU of influenza A / PR / 8 / 34, and their survival was monitored for 14 days after infection. There were 11 males and 17 females of each genotype; compared with wild - type mice, Tmem176b - / - mice had significantly reduced weight loss and mortality.

[0041] Figure 10 : Tmem176b - / - alleviated lung tissue damage in infected mice;

[0042] The results of pulmonary pathology experiments on wild - type and Tmem176b - / - C57BL / 6 mice infected with 100 PFU of influenza A / PR / 8 / 34; lung injury scores were evaluated by H&E staining on the 3rd and 5th days after infection;

[0043] Figure 11 : Tmem176b - / - reduced the inflammatory response in myeloid immune cells after infection with influenza virus A / PR / 8 / 34 in vitro; the contents of IL - 1β, TNF, and IL - 6 in the supernatants of wild - type and Tmem176b - / - BMDC and BMDM infected with A / PR8 influenza virus for 24 hours were detected by ELISA. Detailed implementation methods

[0044] Reference will now be made in detail to embodiments of the present invention, one or more examples of which are described below. Each example is provided by way of explanation and not limitation of the present invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the present invention. For example, features illustrated or described as part of one embodiment can be used in another embodiment to yield a still further embodiment.

[0045] (Specific embodiments of the present invention will be described in detail below. One or more examples provided below are for illustration only and should not be construed as limiting the present invention. Indeed, those skilled in the art can make various modifications and variations to the present invention without departing from the scope or spirit of the present invention. For example, features described in one embodiment can be used in another embodiment to yield a further embodiment.)

[0046] In the present disclosure, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Through further guidance, the following definitions are used to better understand the teachings of the present invention. The terms used in the specification of the present invention herein are for the purpose of describing specific embodiments only and are not intended to limit the present invention.

[0047] In the present disclosure, unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Also, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology-related terms and laboratory procedures used herein are terms and conventional procedures widely used in the respective fields. At the same time, in order to better understand the present disclosure, definitions and explanations of relevant terms are provided below.

[0048] As used herein, the terms "and / or", "or / and", and "and / or" cover any one of the two or more related listed items, as well as any and all combinations of the related listed items. The said any and all combinations include combinations of any two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in the present invention, this technical solution undoubtedly includes the technical solution connected by "logical AND", and undoubtedly also includes the technical solution connected by "logical OR". For example, "A and / or B" includes three parallel solutions: A, B, and A + B. Another example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, it includes combinations of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D (that is, the technical solution connected by "logical AND").

[0049] As used in the present invention, the terms "comprising", "containing", and "including" are synonyms, which are inclusive or open-ended and do not exclude additional, unrecited members, elements, or method steps.

[0050] The numerical ranges expressed by endpoints in the present invention include all the numerical values and fractions included within the range, as well as the recited endpoints.

[0051] As used herein, the mention of "about" a certain value or parameter includes (and describes) embodiments directed to the value or parameter itself. For example, the description of "about X" includes the description of "X".

[0052] In the present invention, when referring to concentration values, their meanings include fluctuations within a certain range. For example, it can fluctuate within the corresponding precision range. For example, for 2%, fluctuations within the range of ±0.1% are allowed. For larger numerical values or those that do not require overly precise control, larger fluctuations are also allowed. For example, for 100 mM, fluctuations within the ranges of ±1%, ±2%, ±5%, etc. are allowed. When referring to molecular weight, fluctuations within the range of ±10% are allowed.

[0053] As used herein, unless otherwise indicated, the singular forms of the articles "a", "an", and "the" include plural referents.

[0054] In the present invention, when referring to descriptions such as "a plurality of" and "a variety of", unless otherwise specified, it means greater than or equal to 2 in quantity.

[0055] In the present invention, among the technical features described in an open-ended manner, there are included closed-ended technical solutions composed of the listed features, as well as open-ended technical solutions including the listed features.

[0056] As used herein, the term "primer" or "primer sequence" refers to a linear oligonucleotide that hybridizes to a target DNA template to produce a target DNA:primer hybrid and primes a DNA synthesis reaction. The upper and lower limits of primer length are determined empirically. The lower limit of primer length is the minimum length required to form a stable duplex when hybridizing to a target nucleic acid under nucleic acid amplification reaction conditions. Very short primers (usually less than 3 nucleotides in length) do not form thermodynamically stable duplexes with the target nucleic acid under such hybridization conditions. The upper limit is often determined by the likelihood of duplex formation in regions other than the predetermined nucleic acid sequence in the target nucleic acid. Generally, suitable primer lengths range from about 3 nucleotides in length to about 40 nucleotides in length. The primer can be an RNA oligonucleotide, a DNA oligonucleotide, or a chimeric sequence.

[0057] As used herein, the term "diagnosis" or variations thereof refers to determining the nature or characteristics of a disorder or disease or condition (such as severe viral pneumonia), detecting and / or classifying severe viral pneumonia in a subject. Diagnosis can be accompanied by determination of the severity of severe viral pneumonia.

[0058] As used herein, the term "treatment" and variations thereof or "amelioration" refer to therapeutic treatment, where the aim is to reverse, alleviate, improve, inhibit, slow down, or stop the progression or severity of severe viral pneumonia, its associated conditions, and / or symptoms. The term "treatment" includes reducing or alleviating at least one adverse effect or symptom of severe viral pneumonia. A treatment is generally "effective" if one or more symptoms or clinical markers are reduced. Alternatively or in addition, a treatment is "effective" if the progression of the disease is slowed down or stopped.

[0059] In the present invention, "preferred", "better", "more preferred", and "preferably" are only used to describe embodiments or examples with better effects, and it should be understood that they do not constitute a limitation on the protection scope of the present invention. In the present invention, "optionally", "optional", and "option" mean optional, that is, it refers to any one of the two parallel options of "having" or "not having". If "optional" appears multiple times in a technical solution, without special instructions and without contradictions or mutual restrictions, each "optional" is independent.

[0060] All documents mentioned in the present invention are incorporated herein by reference as if each of them were individually incorporated by reference. Unless it conflicts with the object and / or technical solution of the present invention, the cited documents involved in the present invention are incorporated by reference in their entirety and for all purposes. When the present invention involves cited documents, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also incorporated by reference. When the present invention involves cited documents, the examples and preferred modes of the relevant technical features cited can also be incorporated into the present invention as references, but only to the extent that the present invention can be implemented. It should be understood that when the cited content conflicts with the description in the present invention, the present invention shall prevail or be modified adaptively according to the description of the present invention.

[0061] The present invention relates to the use of a quantitative detection agent for molecular markers in the preparation of a kit for the diagnosis and prognosis evaluation of severe viral pneumonia;

[0062] The molecular markers include TMEM176B mRNA and / or protein.

[0063] The term "quantitative detection agent for molecular marker (such as TMEM176B) mRNA" in the present invention should not be merely understood as a detection agent for molecular marker (such as TMEM176B) mRNA, but should include other detection reagents known to those skilled in the art that can reflect the expression level of molecular marker (such as TMEM176B) mRNA. For example, the expression level of molecular marker (such as TMEM176B) mRNA can be indirectly detected by quantitatively detecting the cDNA obtained by reverse transcription of molecular marker (such as TMEM176B) mRNA.

[0064] In the present invention, unless otherwise stated, "molecular marker (such as TMEM176B) mRNA" and "molecular marker (such as TMEM176B) protein" can be replaced by "marker", "biochemical marker", "marker polypeptide", "severe viral pneumonia marker". It specifically refers to the molecule to be used as the target for analyzing the experimental sample of the patient.

[0065] The molecular marker mRNA used as a marker in the present invention is expected to include its full-length ribonucleotide sequence, or a naturally occurring variant, or a fragment of the full-length sequence and the variant, especially a fragment that can be detected and its specific sequence determined, more preferably a fragment that can be distinguished from other RNA sequences in the blood. Preferably, it contains at least 7, 8, 9, 10, 11, 12, 15 or 20 consecutive ribonucleotides of the full-length ribonucleotide sequence.

[0066] The molecular marker proteins used as markers in the present invention are expected to include naturally occurring variants of said proteins and fragments of said proteins or said variants, in particular immunologically detectable fragments. Immunologically detectable fragments preferably comprise at least 5, 6, 7, 8, 9, 10, 11, 12, 15 or 20 consecutive amino acids of said marker polypeptide. For example, the expression "TMEM176B protein" includes the complete protein sequence of TMEM176B and the marker polypeptides as defined above.

[0067] Those skilled in the art will recognize that ribonucleotides / proteins / polypeptides released by cells or ribonucleotides present in the extracellular matrix may be damaged (e.g., during an inflammatory process) and may be degraded or cleaved into such fragments. As will be appreciated by those skilled in the art, mRNA, proteins or fragments thereof may also exist as part of a complex. Such complexes can also be used as markers in the sense of the present invention. Additionally, in alternative embodiments, the marker polypeptide or its variant may carry post-translational modifications. Non-limiting examples of post-translational modifications are glycosylation, acylation and / or phosphorylation. "Naturally occurring variants" should be understood to mean that genes in higher animals are usually accompanied by a high frequency of polymorphisms. There are also many molecules that generate isoforms containing mutually different amino acid sequences during the splicing process.

[0068] In some embodiments, the molecular marker further comprises the mRNA and / or protein corresponding to at least one of the following molecules:

[0069] AFT3, SAT1, CLK1, CRIP1, AHNAK, NR4A2, KDM6B, RSRP1, GRP183, F5, DUSP1, CSF3R, SLC38A2, SAMSN1, GSR, CD37, FOS, CKAP4, HP, LY86, SMCHD1, HES1, JUND, LST1, LIMD2 and NAPSA.

[0070] In some embodiments, the molecular marker further comprises the mRNA and / or protein corresponding to at least one of the following molecules:

[0071] ATF3, SAT1 and CLK1.

[0072] In some embodiments, the quantitative detection agent comprises a reagent for detecting changes in the mRNA of the molecular marker, which is applicable to at least one of the following methods: sequencing, polymerase chain reaction (PCR), isothermal amplification reaction, resonance light scattering method, biomass spectrometry, electrochemical analysis, gel electrophoresis, capillary electrophoresis, microarray, CRISPR-Cas detection system.

[0073] Among them, nucleic acid sequencing can be Maxam-Gilbert sequencing, chain termination method, shotgun sequencing, bridge PCR, single molecule real-time sequencing, ion semiconductor (Ion Torrent sequencing), synthesis sequencing, ligation sequencing (SOLiD sequencing), chain termination (Sanger sequencing), massively parallel signature sequencing (MPSS), polymerase cloning sequencing, 454 pyrosequencing, Illumina (Solexa) sequencing, DNA nanoball sequencing, Heliscope single molecule sequencing, single molecule real-time (SMRT) sequencing, nanopore DNA sequencing, tunneling current DNA sequencing, hybridization sequencing, mass spectrometry sequencing, microfluidic Sanger sequencing, microscopy-based techniques, RNAP sequencing, and in vitro viral high-throughput sequencing.

[0074] Among them, PCR is preferably qRT-PCR and digital PCR.

[0075] Among them, broad isothermal techniques can be further divided into the following methods: methods that rely on primer displacement to initiate repeated template copying (illustrated below, HDA (helicase-dependent amplification), exonuclease-dependent amplification (EP1866434), recombinase polymerase amplification (RPA), recombinase-mediated amplification method (RAA), loop-mediated amplification (LAMP), rolling circle amplification technique (RCA), multiple displacement amplification (MDA), cross-priming amplification technique (CPA)) and methods that rely on the continuous reuse or de novo synthesis of a single primer molecule, SDA (strand displacement amplification and nucleic acid-based amplification (NASBA and TMA)).

[0076] Among them, according to the type of nucleic acid molecule detected, CRISPR / Cas technology nucleic acid detection can be divided into DNA (CRISPR / Cas9, CRISPR / Cas12, and CRISPR / Cas12 recognize DNA sequences) and RNA (CRISPR / Cas13 recognizes RNA sequences) detection. Further, the CRISPR-Cas includes one or more of the following: CRISPR-Cas12 detection system, CRISPR-Cas13 detection system, and a Cas detection system having bypass cleavage activity similar to that of Cas12 and / or Cas13. Among them, the CRISPR-Cas12 detection system is preferably the CRISPR-Cas12a detection system, and the CRISPR-Cas13 detection system is preferably the CRISPR-Cas13a detection system.

[0077] In some embodiments, the quantitative detection agent includes a probe and / or primer that can specifically bind to the molecular marker mRNA or cDNA.

[0078] In some embodiments, the probe and / or the primer is labeled with a detectable label.

[0079] In some embodiments, the quantitative detection agent includes a reagent for detecting changes in the molecular marker protein, and is applicable to at least one of the following methods:

[0080] Immunoassay, biological mass spectrometry, lectin-based detection method, and aptamer-based detection method.

[0081] As a method for determining the molecular marker of the present invention, for example, as long as it is a method for specifically determining the molecular marker protein, any known method such as immunoassay and mass spectrometry can be used. Among the reagents used in determining the marker protein of the present invention, antibodies, lectins, aptamers, etc. can be used as detection agents.

[0082] As for the immunoassay, there is no particular limitation, and various enzyme immunoassays, radioimmunoassays (RIA), enzyme-linked immunosorbent assays (ELISA), double monoclonal antibody sandwich immunoassay, monoclonal polyclonal antibody sandwich immunoassay, immunostaining, immunofluorescence, Western blotting, biotin-avidin method, immunoprecipitation, colloidal gold agglutination method, immunochromatography, latex agglutination method (LA), and immunoturbidimetry (TIA), etc. can be cited.

[0083] As the reagent used in the immunoassay, commercially available antibodies against molecular markers such as anti-TMEM176B can be used, or antibodies can be prepared by conventional methods based on the amino acid sequences of known molecular markers such as TMEM176B.

[0084] As long as it is an antibody that can detect molecular marker proteins such as TMEM176B, the animal species and clone from which it is derived are not particularly limited. Antibodies derived from rabbits, goats, mice, rats, guinea pigs, horses, sheep, camels, chickens, etc. can be cited, and both monoclonal antibodies and polyclonal antibodies are acceptable. In addition, antibodies suitable for specifically binding to all subtypes of molecular marker proteins such as TMEM176B can be used. Of course, recombinant antibodies, Fab, Fab', or F(ab')2 fragments can also be used.

[0085] As the mass spectrometry method, there is no particular limitation, and a mass spectrometer that combines an ion source using electrospray ionization (ESI), matrix-assisted laser desorption ionization (MALDI), surface-enhanced laser desorption ionization (SELDI), etc. with a time-of-flight analyzer (TOF), an ion trap analyzer (IT), a Fourier transform analyzer (FT), etc. can be used. LC-MS, CE-MS, etc. that are formed by connecting a mass spectrometer to a separation device such as high-performance liquid chromatography (HPLC) or capillary electrophoresis (CE) can be used. In addition, as methods for obtaining mass spectrometry data, data-independent analysis (DIA), data-dependent analysis (DDA), multiple reaction monitoring method (MRM), etc. can be cited. Mass spectrometry also includes cases where a sample is subjected to stable isotope labeling with an iTRAQ reagent (SCIEX Corporation), etc.

[0086] In some embodiments, the quantitative detection agent includes an antibody.

[0087] In some embodiments, the antibody is a monoclonal antibody or a polyclonal antibody.

[0088] In some embodiments, at least one component in the kit is a solid, and the solid includes at least one of freeze-dried microspheres, freeze-dried cakes, freeze-dried powders, and spots that depend on the presence of a solid medium.

[0089] In the present disclosure, terms such as "biological sample" and "sample" refer to animal samples; they can be tissues or organs, tissue lysates from animals (preferably including at least mammals, such as primates, including humans); cells (cells in a subject, directly taken from a subject, or maintained in culture or from a cultured cell line), cell lysates (or lysate fractions) or cell extracts; solutions containing one or more molecules derived from cells or cell materials; or solutions containing natural or non-naturally occurring nucleic acids, which are or can be assayed as described in the present disclosure. In some embodiments, the biological sample detected by the kit contains mononuclear macrophages. In some embodiments, the biological sample includes one or more of the following: blood, bronchoalveolar lavage fluid, lung tissue, nasal lavage fluid, sputum, and exhaled breath condensate. In some embodiments, the bronchoalveolar lavage fluid is bronchoalveolar lavage fluid. In some embodiments, the blood is peripheral blood.

[0090] According to another aspect of the present invention, it also relates to the use of a molecule that specifically inhibits the transcription or translation of the TMEM176B gene, or is capable of specifically inhibiting the expression or activity of the TMEM176B protein in the preparation of a drug for treating severe viral pneumonia.

[0091] It is easy to understand that according to the content described in the present invention, inhibiting the expression of the TMEM176B gene at the protein level or mRNA level will be effective. The inhibition can be to partially weaken the expression of the TMEM176B gene or to silence its expression.

[0092] The molecules should be understood to include but not limited to nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins, and interfering lentiviruses, preferably selected from nucleic acid molecules, antibody drugs, or interfering lentiviruses.

[0093] In some embodiments, the nucleic acid molecules are selected from: antisense oligonucleotides, double-stranded RNA (dsRNA), microRNA (miRNA), small interfering RNA (siRNA), and short hairpin RNA (shRNA).

[0094] The embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. For the experimental methods without specific conditions indicated in the following examples, the guidelines given in the present invention are preferably referred to, and it is also possible to follow the experimental manuals or conventional conditions in the art, or refer to other known experimental methods in the art, or follow the conditions recommended by the manufacturer.

[0095] In the following specific examples, for the measurement parameters of raw material components, if there is no special description, there may be slight deviations within the weighing accuracy range. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0096] Unless otherwise specified, the reagents used in the context of the present invention are all commercially available. The experimental methods used in the present invention, such as bioinformatics analysis, cell experiments, DNA extraction, genome sequencing, primer design, PCR, Western blot, immunohistochemistry, etc., are all conventional methods and techniques in the art.

[0097] The specific materials and methods involved in the present invention are as follows:

[0098] Public data sources and analysis: To study the molecular interactions of TMEM176B in different types of samples, six gene sets were extracted from the GEO database (http: / / www.ncbi.nlm.nih.gov / gds / ) and selected as the research objects. The following table lists the detailed information of the datasets involved.

[0099]

[0100]

[0101] Relevant genes related to inflammasomes and pyroptosis that are classic and widely studied were collected in combination with representative literature for correlation analysis. Inflammation-related genes: NLRC4, NLRP1, NLRP2, NLRP3, NLRP6, NLRP7, NOD1, NOD2, PLCG1, PRKACA, PYCARD, SCAF11, TIRAP, TNF. Pyroptosis-related genes: AIM2, CASP1, CASP3, CASP4, CASP5, CASP6, CASP8, CASP9, ELANE, GPX4, GSDMA, GSDMB, GSDMC, GSDMD, IL-18, IL-1B, IL6. All data were analyzed using R 4.3.1. Single-cell analysis and annotation were achieved through Package Seurat 4.4. and Package SingleR 2.4.0 (https: / / github.com / dviraran / SingleR). Weighted gene co-expression network (WGCNA) analysis and high-dimensional WGCNA (hdWGCNA) analysis were achieved through Package WGCNA 17.2-1 (https: / / horvath.genetics.ucla.edu / html / CoexpressionNetwork / Rpackages / WGCNA / ) and Package hdWGCNA 0.2.24 (https: / / smorabit.github.io / hdWGCNA / articles / basic_tutorial.html). Pseudotime analysis was performed using Package monocle 2.30.0 (https: / / cole-trapnell-lab.github.io / monocle-release / ).

[0102] Mouse: Tmem176B - / - C57BL / 6J mice were constructed by GemPharmatech (Jiangsu, China) using the CRISPR / Cas9 system. Tmem176B - / - The genomes of the mice were confirmed by PCR1 (forward: AGCTGAAAGACTGAGGCATGTC; reverse: AACATGGTTGCATTCCGAGC) and PCR2 (forward: ATTCTGACTGCCACTGATG; reverse: AASGGCCAGTTCACTGAGCTG). A single KO band was obtained from the micelles of the PCR1 reaction, and the PCR2 reaction without products was identified as homozygous. Tmem176B - / -Mice were bred and maintained under specific pathogen-free conditions at the Institute of Biophysics, Chinese Academy of Sciences, Beijing. WT C57BL / 6J mice were purchased from GemPharmatech, Jiangsu, China. Age- and sex-matched mice at 6 - 8 weeks old were used. All mice were housed under pathogen-free conditions in the animal breeding unit and transferred to the ABSL2 facility for experiments involving H1N1 PR8 infection. The experimental use of mice in this invention was conducted in accordance with the guidelines of the National Institutes of Health on the use of live animals.

[0103] Cells and viruses: Inductive culture of bone marrow-derived macrophages (BMDMs) and bone marrow-derived dendritic cells (BMDCs). Bone marrow progenitor cells were cultured in 30% L929 cell supernatant for 6 days for BMDM and GM-CSF (20 ng / ml; Peprotech), and IL-4 (10 ng / ml; Peplotech) for BMDC. BMDM, RAW264.7, MDCK, A549 cells were cultured in DMEM (Dulbecco's Modified Eagle Medium), and BMDC, THP-1 (Procell Life Science & Technology, Wuhan, China) cell line was cultured in ATCC-modified 1640 medium. The above media were routinely supplemented with 10% FBS (fetal bovine serum) and 1% penicillin / streptomycin, and cells were cultured in a 5% CO2 incubator at 37°C. Induction of BMDM polarization: On the 6th day of BMDM inductive culture, the fresh stimulation medium was replaced with RPMI 1640 medium containing 20 ng / ml M-CSF (PeproTech), 100 ng / mL LPS (Sigma), and 50 ng / mL murine IFN-γ (PeproTech) for M1 polarization; and 10 ng / mL murine IL-4 (PeproTech) and 10 ng / mL murine IL-13 (PeproTech) for M2 polarization. At 37°C, the mouse-adapted virus strain A / Puerto Rico / 8 / 34 (H1N1) was cultured for 2 days from the allantoic cavity of 10 - 11-day-old sterile embryonated eggs and subjected to plaque assay to determine the virus titer.

[0104] In vitro infection with influenza virus: Cells were incubated with influenza virus in 0.1% BSA-PBS at 200 μL / well for 1.5 hours, thoroughly washed, and then incubated for several hours in complete medium according to the experimental design shown in the legend.

[0105] Cytokine assay: After collecting the cell supernatants of the experimental groups, the concentration of IL-1β in the cell supernatants was measured using murine IL-6, TNF-α, IL-1β ELISA kits (NeoBioscience) and determined by a multifunctional microplate reader (TECAN).

[0106] RNA extraction and qPCR: Total RNA was extracted using the RNeasy Mini Kit (Qiagen 74104). The RevertAid First Strand cDNA Synthesis Kit (Thermo K1622) and the PowerUp TM SYBR TM Green Master Mix (Thermo A25741) were used to perform qPCR in a two-step method. The primers used for qPCR were as follows: Tmem176b (mouse): forward primer (5'-3'): ACTCCAGTAGAATTGCCACAG; reverse primer (5'-3'): CATCAGCATCCACATCCACC. Tmem176b (human): forward primer (5'-3'): GGCAGAAGGAGGAGTGTAGAG; reverse primer (5'-3'): CAGGAACGGGCACGGATT. Gapdh (mouse): forward primer (5'-3'): CATCACTGCCACCCAGAAGACTG; reverse primer (5'-3'): ATGCCAGTGAGCTTCCCGTTCAG. GAPDH (human): forward primer (5'-3'): TGTGAACCATAGAAGTATG; reverse primer (5'-3'): TTCACCATACAAGTGT.

[0107] Hematoxylin and eosin (H&E) staining of lung tissue: Lung injury was evaluated using a semi-quantitative scoring system. The degree of edema, interstitial and alveolar hemorrhage, atelectasis, and thickening of the lung septum was scored according to the following criteria: 0 = no injury, 1 = 25% of the lung area damaged, 2 = 50% of the lung area injured, 3 = 75% of the lung area damaged, 4 = the entire lung area damaged. The infiltration score was evaluated according to the degree of infiltration of inflammatory cells around three large blood vessels and the main bronchus: 0 = no inflammatory cells, 1 = a small amount of inflammatory cells; 2 = more uneven distribution of inflammatory cells; 3 = relatively uniform distribution of a large number of inflammatory cells, rarely aggregating into clusters; 4 = aggregation of a large number of inflammatory cells. The scoring results were analyzed blindly by experienced pathologists.

[0108] Statistical analysis: Pearson correlation analysis was used to obtain correlation analysis, and p < 0.05 indicated a significant correlation. All experimental values were expressed as the mean ± standard deviation of individual samples. One-way analysis of variance (ANOVA) or student-t test was performed using GraphPad Prism 9.0 according to the data characteristics to evaluate statistical significance. p < 0.05 was considered statistically significant.

[0109] Example 1 - Screening of Myeloid Immune Cell Biomarkers Associated with Severe Viral Pneumonia

[0110] Based on the screening of previous research reports, the inventors found that TMEM176B is an endosomal membrane protein specifically expressed in myeloid immune cells and is basically not expressed in lymphoid immune cells. After bone marrow-derived dendritic cells (BMDCs) are isolated from bone marrow precursor cells, Tmem176B is significantly downregulated after being stimulated with LPS (0.5 μg / ml) or the viral mimic molecule poly I:C (12.5 μg / ml) for 10 h or 24 h on the 8th day of induction. For details, see Figure 1 . Subsequently, we detected the expression level of Tmem176B in multiple cell lines in vitro (about 5×10 5 / sample, n≥3), see Figure 2 . It can be seen that this molecule is expressed in myeloid immune cells and is basically not expressed in alveolar epithelial cells such as A549. In addition, we further obtained data through the GEO public datasets (GSE145926, GSE149689) and performed bioinformatics analysis and found that TMEM176B is specifically expressed in the monocyte-macrophage cluster, and the expression specificity of this molecule was confirmed again through the public database. For details, see Figure 3 . In addition, the expression of this gene is downregulated after influenza infection in multiple myeloid cells such as bone marrow-derived macrophages (BMDM) from mouse primary cells, bone marrow-derived dendritic cells (BMDC) from mouse primary cells, and the mouse monocyte macrophage cell line RAW264.7. For details, see Figure 4 .

[0111] Subsequently, we analyzed the biological functions participated by TMEM176B by combining multiple single-cell sequencing and ordinary transcriptome sequencing datasets of viral pneumonia, and found that TMEM176B and its interacting genes participated in important biological processes such as inflammatory activation ( Figure 5 ), immune cell infiltration ( Figure 6 ), myeloid cell development and differentiation ( Figure 7 ), etc. These important biological processes are closely related to the prognosis of diseases after virus infection. Based on this, we speculate that this gene may be an important biomarker for disease prognosis. Furthermore, we first performed dimensionality reduction clustering analysis on GSE202001 ( Figure 8 A), and then screened out a group of intersection genes that are correlated with both NLRP3 and myeloid cell differentiation ( Figure 8 B, C) and performed GO and KEGG analysis ( Figure 8D, E). GO analysis showed that these genes were mainly involved in macrophage activation, myeloid cell differentiation, phagocytosis, early endosomes, immune receptor activity, and MAP kinase tyrosine phosphatase activity. KEGG analysis also showed that these genes were involved in inflammation and cell differentiation. The above results reflected the potential regulatory role of Tmem176B in the immune response. Therefore, we speculated that this gene might affect the prognosis and further established a prognostic model. Furthermore, we screened out a total of 27 genes that interacted with TMEM176B and could affect the prognosis through the random forest algorithm. And this set of molecules had good discrimination for the prognosis of viral pneumonia and different clinical characteristic populations reflecting the prognosis, as shown in Figure 8 F-K. Further training of these 27 molecules yielded a prognostic model with AUC values under the ROC curve of 1 and 0.986 in the training and internal validation sets, respectively. Finally, external validation of the model was performed using an independent dataset, and the AUC under the ROC curve was 0.905. This means that this set of genes has reliable discrimination for the severity of viral pneumonia and helps to identify high-risk severe cases through genetic testing at an early stage.

[0112] Example 2 - Effect of TMEM176B on the prognosis of influenza-infected mice

[0113] We further knocked out TMEM176B in C57B6L / J mice using the Crisper / Cas9 gene editing technology. After intranasal infection with influenza A PR8, the body weight and survival rate of the mice were monitored. There were significant prognostic differences between wild-type mice and TMEM176B knockout mice ( Figure 9 ), and the pathological damage of the lung tissue in wild-type mice was more severe ( Figure 10 ).

[0114] Example 3 - Effect of TMEM176B on the inflammatory response of myeloid immune cells

[0115] Excessive inflammation derived from myeloid immune cells is strongly associated with pathological damage of lung tissue. Subsequently, we infected primary bone marrow-derived macrophages (BMDM) and dendritic cells (BMDC) with virus in vitro and compared the differences in the release of inflammatory factors before and after TMEM176B knockout. ELISA was used to detect cytokines such as IL-6, TNF-α, and IL-1β secreted in the supernatants of the two cell lines. The results showed that the release of the above inflammatory factors decreased after TMEM176B knockout, as shown in Figure 11 . The above results confirmed that this gene could act as a protective gene in the body and play a protective role by controlling the overactivation of inflammation in myeloid immune cells. The above research provided evidence support for TMEM176B as a biomarker for severe viral pneumonia.

[0116] Discussion

[0117] As can be seen from the above results, TMEM176B is specifically expressed in myeloid immune cells, but hardly expressed in alveolar epithelial cells, and there are significant differences in the expression of this gene between virus-infected cells and normal cells. By combining biological algorithms to analyze the biological processes involved in this gene and its interacting genes, it was found that this gene participates in a variety of important biological processes, and in vivo and in vitro gene knockout experiments further confirmed the key role of this gene in inflammatory activation and pathological damage during virus infection. These findings all provide potential possibilities for TMEM176B to be used as an intervention target for severe viral pneumonia. In addition, we further screened and trained a total of 27 genes including TMEM176B and its interacting genes as a prognostic model, which showed good prognostic predictive value in both internal and external datasets, providing a reliable host biomarker for the early diagnosis and screening of severe viral pneumonia. This finding has important value for clinical translation and the development of future drug targets.

[0118] The above-described embodiments merely represent several implementation manners of the present invention. The description thereof is relatively specific and detailed, but it should not be construed as a limitation to the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the invention patent shall be subject to the appended claims, and the description and drawings can be used to explain the content of the claims.

Claims

1. Use of a quantitative detection agent for a molecular marker in the preparation of a kit for prognosis assessment of severe viral pneumonia; The molecular marker includes TMEM176B mRNA and / or protein; The severe viral pneumonia is caused by influenza virus A / PR / 8 / 34 infection.

2. The application according to claim 1, characterized in that, The quantitative detection agent includes a reagent for detecting changes in the mRNA of the molecular marker, which is applicable to at least one of the following methods: sequencing, polymerase chain reaction (PCR), isothermal amplification reaction, resonance light scattering method, biomass spectrometry, electrochemical analysis, gel electrophoresis, capillary electrophoresis, microarray, CRISPR-Cas detection system.

3. The application according to claim 2, wherein The quantitative detection agent includes a probe and / or primer that can specifically bind to the mRNA or cDNA of the molecular marker.

4. The application according to claim 1, wherein The quantitative detection agent includes a reagent for detecting changes in the protein of the molecular marker, which is applicable to at least one of the following detection methods: immunoassay, biomass spectrometry, lectin-based detection method, and aptamer-based detection method.

5. The application according to any one of claims 1 to 4, characterized in that, The biological sample detected by the kit contains monocytes-macrophages.

6. The application according to claim 5, wherein The biological sample includes one or more of the following: blood, bronchoalveolar lavage fluid, lung tissue, nasal lavage fluid, sputum, and exhaled breath condensate.

Images