CrRNA target spot and CRISPR-Cas13a system for detecting Hendea virus

Abstract

The invention discloses a crRNA target spot and a CRISPR-Cas13a system for detecting a Hendea virus. The CRISPR-Cas13a system comprises Cas13a protein and crRNA, or a complex formed by the Cas13a protein and the crRNA; the crRNA comprises an anchoring sequence used for being combined with Cas13a protein and a guide sequence targeting a Hendea virus target sequence; the Hendea virus target sequence is located at the 632 to 659 sites of a Hendea virus genome. Experiments prove that the crRNA disclosed by the invention can realize high-sensitivity and high-specificity detection on Hendea virus nucleic acid by activating Cas13a, and the sensitivity reaches one copy (1copy / [mu] L); the method has an important application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular diagnosis, and in particular relates to a crRNA target and a CRISPR-Cas13a system for detecting Hendra virus. Background Art

[0002] Hendra virus (HeV), belonging to the genus Henipavirus of the family Paramyxoviridae, is a zoonotic virus that can infect humans and animals. The natural host of Hendra virus is fruit bats, which are generally transmitted from fruit bats to horses, and then from horses to humans. The mortality rate of humans infected with Hendra virus is high. Hendra virus is classified as a biosafety level IV biological factor and is listed in the list of priority research diseases by the World Health Organization (WHO). When humans are infected with Hendra virus, they mainly show symptoms such as fever, cough, sore throat, headache and muscle pain. These symptoms are atypical, which brings great difficulties to the early diagnosis of Hendra virus infection. Therefore, it is particularly important to establish a rapid, highly sensitive and highly specific early diagnosis method for Hendra virus to prevent the spread of Hendra virus.

[0003] Clustered regularly interspaced short palindromic repeats (CRISPR) and related proteins (Cas) are an acquired immune system first discovered in archaea. As the research deepened, researchers found that after binding to the target RNA, the Cas13a protein was activated and could cut non-target RNA. By connecting detectable target groups at both ends of the non-target RNA, the target RNA can be indirectly detected by detecting the target group, which is the CRISPR-Cas13a detection method.

[0004] The main detection methods for Hendra virus at present include PCR-based, enzyme-linked immunosorbent assay-based, and isothermal amplification-based methods. The PCR-based method has the advantage of high sensitivity, but the operation is cumbersome and needs to be completed in the laboratory. A single test takes several hours, and the first outbreak of Hendra virus is often in suburban horse breeding sites far away from the city. These detection methods cannot meet the needs of early rapid screening. The enzyme-linked immunosorbent assay-based and isothermal amplification-based methods are simpler in operation than the PCR-based detection methods, but the sensitivity is also reduced. In summary, the existing detection methods cannot maintain high sensitivity while meeting the requirements of rapidity and simplicity. It is urgent to develop a rapid, simple, highly sensitive, and highly specific detection method for the detection of Hendra virus. Summary of the invention

[0005] Based on the technical problems existing in the prior art, the present invention provides a CRISPR-Cas13a system and its application that can be applied to the rapid detection of Hendra virus nucleic acid, which is a CRISPR system and its application that can be used for integrated detection of Hendra virus. The present invention develops a detection method based on the combination of CRISPR-Cas13a and lateral flow chromatography test paper, which can detect Hendra virus quickly, simply, with high sensitivity and high specificity.

[0006] To achieve the above objectives, the present invention is based on the principles of the CRISPR-Cas13a system and the selection principles of the target sequence, designs 5 crRNAs according to the Hendra virus gene sequence, and selects the crRNA with the best activation effect on the CRISPR-Cas13a system for Hendra virus nucleic acid detection.

[0007] The first object of the present invention is to provide a crRNA target for detecting Hendra virus, wherein the Hendra virus target sequence is SEQ ID NO.1.

[0008] A second object of the present invention is to provide a CRISPR-Cas13a system for detecting Hendra virus, wherein the CRISPR-Cas13a system comprises a Cas13a protein and crRNA, or a complex formed by the two; The crRNA includes an anchor sequence for binding to the Cas13a protein and a guide sequence targeting the Hendra virus target sequence; the Hendra virus target sequence is shown in SEQ ID NO.1.

[0009] In certain embodiments, the crRNA sequence is shown as SEQ ID NO.2.

[0010] In certain embodiments, the Cas13a protein is LwCas13a protein.

[0011] The third object of the present invention is to provide a kit for detecting Hendra virus, which comprises the above-mentioned CRISPR-Cas13a system for detecting Hendra virus.

[0012] In certain embodiments, the kit further comprises RAA amplification primers for specifically amplifying the Hendra virus target sequence; the RAA amplification primers consist of the single-stranded DNA molecule shown in SEQ ID NO.4 and the single-stranded DNA molecule shown in SEQ ID NO.5.

[0013] A fourth object of the present invention is to provide any of the following substances: A1) the above-mentioned crRNA; A2) the above-mentioned Cas13a protein and crRNA, or a complex formed by the two; A3) The primer pairs described above.

[0014] A fifth object of the present invention is to provide any of the following applications: B1) Use of the above system, the above kit or the above substance in detecting or assisting in detecting Hendra virus or its nucleic acid; B2) Use of the above system, the above kit or the above substance in the preparation of a product for detecting or assisting in the detection of Hendra virus or its nucleic acid; B3) Use of the above system, the above kit or the above substance in detecting or assisting in detecting whether a sample to be tested contains Hendra virus or its nucleic acid; B4) Use of the above system, the above kit or the above substance in the preparation of a product for detecting or assisting in detecting whether a sample to be tested contains Hendra virus or its nucleic acid; B5) Use of the above system, the above kit or the above substance in screening or assisting screening of Hendra virus prevention and treatment drugs; B6) Use of the above system, the above kit or the above substance in preparing a product for screening or assisting screening of Hendra virus prevention and treatment drugs; B7) Use of the above-mentioned substance in the preparation of the above-mentioned kit.

[0015] The sixth object of the present invention is to provide an application as described above for detecting the crRNA target of Hendra virus, wherein the application is for preparing crRNA or preparing RAA amplification primers for specifically amplifying the Hendra virus target sequence or preparing a positive control for detecting Hendra virus.

[0016] A seventh object of the present invention is to provide a method for detecting or assisting in detecting Hendra virus, comprising the following steps: C1) using the nucleic acid of the sample to be tested as a template, and using a primer pair consisting of a single-stranded DNA molecule shown in SEQ ID NO.4 and a single-stranded DNA molecule shown in SEQ ID NO.5 to perform RAA amplification to obtain a RAA product; C2) preparing a CRISPR-Cas13a detection system containing the following components: the RAA product, the Cas13a protein, the crRNA, reporter RNA, NTP, T7 RNA polymerase, and RNase inhibitor; and replacing the PCR product with water as a negative control; C3) reacting the CRISPR-Cas13a detection system and detecting the reaction product to determine whether the sample to be tested contains Hendra virus.

[0017] In certain embodiments, in step C1), the reaction conditions for RAA amplification are: 39° C. for 30 minutes.

[0018] In certain embodiments, the use is for non-diagnostic purposes.

[0019] The eighth object of the present invention is to provide a CRISPR reaction system that can be used to detect Hendra virus, the reaction system comprising an RT-RAA primer pair for amplifying Hendra virus, crRNA for recognizing Hendra virus, and a CRISPR reaction system.

[0020] The ninth object of the present invention is to provide an application of the CRISPR reaction system as described above: the application is any one or more of the following c1-c10: c1) Detect or assist in the detection of Hendra virus; c2) Prepare products for detecting or assisting in detecting Hendra virus; c3) Detecting or assisting in the detection of Hendra virus nucleic acid; c4) Preparing products for detecting or assisting in detecting Hendra virus nucleic acid; c5) Detecting or assisting in detecting whether the sample to be tested contains Hendra virus; c6) preparing products for testing or assisting in testing whether the sample to be tested contains Hendra virus; c7) Detecting or assisting in detecting whether the sample to be tested contains Hendra virus nucleic acid; c8) preparing products for testing or assisting in testing whether the sample to be tested contains Hendra virus nucleic acid; c9) Screening or assisting in the screening of drugs for the prevention and treatment of Hendra virus; c10) Prepare screening or assist in screening of Hendra virus prevention and treatment drug products.

[0021] The tenth object of the present invention is to provide an integrated device for detecting Hendra virus, wherein the integrated device can implement the above reaction system or the reagents of the above method, and optionally a readable carrier recording the corresponding method.

[0022] In certain embodiments, the readable carrier comprises a judgment standard A of the CRISPR-Cas13a fluorescence detection system: set up at least 3 groups of independent repeated experiments, and compare whether the mean difference of the fluorescence value at the 60th minute between the groups is significant (using t test, P<0.05). If the sample to be tested is significantly different from the negative control group (using ddH2O as a template), the sample to be tested contains or is a candidate for containing Hendra virus, otherwise the sample to be tested does not contain or is a candidate for not containing Hendra virus.

[0023] In certain embodiments, the readable carrier comprises a CRISPR-Cas13a test paper system judgment standard B: the system is dropped on the test paper after the reaction and the reading is performed 2-5 minutes later. If the test paper has no "T" line and a "C" line, the sample to be tested contains or the candidate contains Hendra virus; if the test paper has a "T" line and a "C" line, the sample to be tested does not contain or the candidate does not contain Hendra virus; if the test paper does not have a "C" line, the test paper is invalid and the test paper needs to be replaced and re-tested.

[0024] In certain embodiments, the integrated device further comprises instructions.

[0025] Compared with the prior art, the present invention has at least the following beneficial effects: 1. The present invention is based on CRISPR-Cas13a nucleic acid detection technology. Through design, construction and screening, it finally provides a target sequence for Hendra virus detection and a specific crRNA that can target the target sequence. The crRNA can achieve highly sensitive and specific detection of Hendra virus nucleic acid by activating Cas13a, with a sensitivity of one copy (1 copy / μL).

[0026] 2. The detection technology based on RT-RAA of the present invention has the technical advantages of simple operation, stable system and has been widely used in the field of clinical molecular diagnosis. The RT-RAA technology is combined with CRISPR based on Cas13a protein. Through design, construction and screening, a crRNA that can efficiently target viral gene sequences is finally provided, and the crRNA of the CRISPR-Cas13a system is activated. The RT-RAA-CRISPR system constructed using this target can specifically detect the corresponding viruses and achieve high-sensitivity detection of the corresponding pathogens, and can detect viruses as low as a single copy, such as Hendra virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Results of plasmid PCR+CRISPR fluorescence screening of crRNA Figure 2 For use 10 3 Results of screening of RAA primer combinations with plasmids and preliminarily screened crRNA copies / µL Figure 3 For use 10 1 The curve of the number of copies / µL of plasmid and the initial screening of RAA primer combinations for crRNA screening Figure 4 For use 10 1 Results of crRNA screening using plasmid copies / µL and the initially screened RAA primer combination (60min).

[0028] Figure 5 For use 10 0 The results of screening the plasmid copies / µL and the optimal crRNA pair RAA primer combination.

[0029] Figure 6 The graph shows the optimal RAA primer combination and the optimal crRNA CRISPR-Cas13a detecting HeV nucleic acid of different concentrations.

[0030] Figure 7 The results of CRISPR-Cas13a detection of HeV nucleic acid of different concentrations for the optimal RAA primer combination and the optimal crRNA (60min).

[0031] Figure 8 Test strip diagram of CRISPR-Cas13a with the optimal RAA primer combination and the optimal crRNA for detecting different concentrations of HeV nucleic acid.

[0032] Fig. 9 Grayscale value diagram of the test paper T line for detecting HeV nucleic acid of different concentrations by CRISPR-Cas13a with the optimal RAA primer combination and the optimal crRNA.

[0033] Fig.10 CRISPR-Cas13a targeting HeV nucleic acid showed no cross-reaction when detecting other pathogens (test paper image).

[0034] Fig.11 CRISPR-Cas13a targeting HeV nucleic acid showed no cross-reaction when detecting other pathogens (grayscale value diagram of T line detected by test paper). DETAILED DESCRIPTION

[0035] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0036] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0037] The reagents and their sources involved in the following examples are as follows: Recombinase-mediated strand displacement nucleic acid amplification (RAA) kit (Hangzhou Zhongce, S001ZC), NTP Mix (BBI, B600057), RNase inhibitor (Murine RNase inhibitor, Novozyme, R301-03), 2× Taq MasterMix (Novozyme, P111-01), T7 RNA Polymerase (NEB, M0251L), T7 transcription kit (T7 Quick HighYield RNA Synthesis kit, NEB, E2050S), fluorescent reporter RNA (RNaseAlertTM QC System v2, Thermo Fisher, 4479769), MgCl2 (Thermo Fisher, AM9530G), HEPES (Solerbo, 15630-080), LwaCas13a protein (GenScript, Z03486), 2×Super PfxMasterMix (Kangwei Century, CW2965M), anhydrous ethanol (Sinopharm Group Shanghai Testing, 20210809), chloroform (Sinopharm Group Shanghai Testing, 20200908), RNA Clean XP Kit (BECKMANCOULTER, A63987), Tris balanced phenol (Sollarbio, T0250), RNase-free ddH2O (Biomed, RA114-02), test paper reporting RNA (Tianyi Huiyuan, 203130347), CRISPR detection test paper (Hangzhou Zhongce, 211108004).

[0038] Seven viral nucleic acids, including CHIKV (Chikungunya virus), JEV (Japanese encephalitis virus), TBEV (TBEV), YFV (yellow fever virus), DENV (dengue virus), ZIKV (Zika virus), and IBV (influenza B virus), were extracted respectively.

[0039] Example 1. Hendra virus nucleic acid detection kit and detection method based on CRISPR-Cas13a system (I) Hendra virus nucleic acid detection kit based on CRISPR-Cas13a system 1. Preparation of crRNA A total of 5 crRNAs were designed in the Hendra virus HeV conserved sequence (SEQ ID NO.3): HeV-crRNA1, HeV-crRNA2, HeV-crRNA3, HeV-crRNA4, and HeV-crRNA5. The target sequences corresponding to each HeV-crRNA sequence are as follows: The target sequence of HeV-crRNA1 is as follows: TTTGTTAGAGCAGACGTGTGACGCTTAA, located at the 637-664th position of HeV genome (GeneID: KM275290.1 / 1-2016); the target sequence of HeV-crRNA2 is as follows: GATTTGGATTTTGTTAGAGCAGACGTGT, located at the 628-655th position of HeV genome (GeneID: KM275290.1 / 1-2016); the target sequence of HeV-crRNA3 is as follows: AGACGTGTGACGCTTAATCAGAAACTCA, located at the 648-675th position of HeV genome (GeneID: KM275290.1 / 1-2016); the target sequence of HeV-crRNA4 is as follows: TGGATTTTGTTAGAGCAGACGTGTGACG (SEQ ID NO.1), located at positions 632-659 of the HeV genome (GeneID: KM275290.1 / 1-2016); the HeV-crRNA5 target sequence is as follows: GAGGGAAAGATGACCAGGAATCCAAACC, located at positions 590-617 of the HeV genome (GeneID: KM275290.1 / 1-2016); The synthesis method of the above crRNA is as follows: 1. Synthesis of primer sequences The sequences in Table 1 were synthesized.

[0040] Table 1. Primer sequences

[0041] 2. PCR amplification The sequence synthesized in step 1 above was diluted to 10 μM with ddH2O to prepare a PCR reaction system. The PCR reaction system was prepared as shown in Table 2.

[0042] Table 2. PCR amplification system

[0043] PCR reaction conditions: 95°C for 5 min thermal denaturation; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, for a total of 35 cycles; 72°C for 10 min automatic extension; PCR products were stored at 4°C. Five PCR products were obtained by amplifying the HeV-gRNA primer pairs shown in Table 1.

[0044] 3. PCR product purification The five PCR products obtained in step 2 were purified using Tris-balanced phenol. The specific steps are as follows: 700 μL of Tris-balanced phenol was added with an equal volume of chloroform, mixed by oscillation, and centrifuged briefly, and the supernatant was discarded; 600 μL of phenol-chloroform mixture was added to 200 μL of PCR product, mixed, and centrifuged at 12,000 rpm for 10 min; the supernatant was transferred to a new 1.5 mL centrifuge tube, anhydrous ethanol was added to make the ratio of supernatant to ethanol 3:7, and centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded; 200 μL of 75% ethanol was added, and the supernatant was discarded at 12,000 rpm for 10 min (this step was performed three times in total). The obtained precipitate was dried at room temperature (about 10 min), and five purified PCR products were obtained.

[0045] The above five purified PCR products were added to 40 μL of RNase-free water, the concentrations were detected by ultra-micro spectrophotometer, and the products were stored at -80°C.

[0046] 4. Transcription Take 1 μg of the 5 purified PCR product aqueous solutions obtained in step 3, and use the T7 transcription kit (NEB) to transcribe crRNA. The crRNA transcription system is shown in Table 3.

[0047] Table 3. crRNA transcription system

[0048] After the above crRNA transcription system was mixed, transcription was carried out at 37°C overnight.

[0049] The crRNA sequences obtained by transcription are named HeV-crRNA1, HeV-crRNA2, HeV-crRNA3, HeV-crRNA4, and HeV-crRNA5, among which the HeV-crRNA4 sequence is specifically as follows GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCGUCACACGUCUGCUCUAACAAAAUCCA (SEQ ID NO.2), wherein positions 1-38 of sequence 2 are anchor sequences for binding to Cas13a protein; positions 39-66 of SEQ ID NO.2 are guide sequences targeting HeV target sequences.

[0050] The HeV-crRNA4 target sequence is as follows: TGGATTTTGTTAGAGCAGACGTGTGACG (SEQ ID NO.1), located at positions 632-659 of the HeV genome (GeneID: KM275290.1 / 1-2016). The prepared HeV-crRNA4 was used for subsequent CRISPR-Cas13a detection.

[0051] 5. crRNA purification The specific steps are as follows: oscillate and mix the magnetic beads (RNA Clean XP), add 36 μL of magnetic beads and 100 μl of isopropanol to 20 μL of transcription product, blow 10 times to mix the magnetic beads and transcription system, and let it stand at room temperature for 10 minutes. Place the reaction system on a magnetic stand and let it stand for 10 minutes to separate the magnetic beads. Gently aspirate the liquid in the system to avoid the magnetic beads being aspirated, add 200 μL of 70% ethanol (RNase free ddH2O water) to the magnetic beads, incubate at room temperature for 30 seconds, and aspirate the ethanol; repeat this process to wash the magnetic beads 3 times. Dry the system at room temperature to remove the ethanol in the system for about 10 minutes. Add 30 μL RNase free ddH2O water, pipette 10 times, let stand for 5 min, then place on a magnetic stand to clarify the system, aspirate the supernatant, put it into a 1.5 mL centrifuge tube, and determine the concentration of the purified crRNA using an ultra-micro spectrophotometer. Dilute to 100 ng / μL and store at -80°C for standby use.

[0052] The above crRNA sequence was used for the following CRISPR-Cas13a detection of Hendra virus.

[0053] 2. Preparation of Plasmid Standards 1. Plasmid sequence Plasmid-HeV is a recombinant plasmid obtained by inserting the following sequence from the Hendra virus genome: AAGAAACCCACCTAATAACCGCCCTCAGGCAGACTCAGGAGGGAAAGATGACCAGGAATCCAAACCTGCCCAAAATGATTTGGATTTTGTTAGAGCAGACGTGTGACGCTTAATCAGAAACTCATATAAGCTCCAAATCATTCTCTATGACACACTCTTATAAATAAATTTAAGAGAGTGGATTGAGATTGAGTTATGGACTTGTGTCATAATATACCTT (SEQ ID NO. 3) into the pUC57 vector (Beijing Tianyi Huiyuan Company).

[0054] 5 μg of recombinant plasmid was extracted from Beijing Tianyi Huiyuan Company.

[0055] According to the formula: copies / μL = 6.02 × 10 23 × (ng / μL) ×10 -9 / (DNA Length × 660), the above 5 μg of recombinant plasmid was diluted with 20 μL of water to obtain a copy number of 1.68 × 10 11 copies / μL of Plasmid-HeV.

[0056] 2. Dilution The above plasmids were diluted in 10-fold gradients to obtain plasmid standards of different concentrations.

[0057] 3. Design of RAA amplification primers and acquisition of RAA amplification products 1. Design of RAA amplification primers According to the RPA primer design in the reference (PMID: 27246147), the HeVVirus-specific RAA primer for CRISPR detection has a T7 transcription sequence at the 5' end of the primer, so that the double-stranded DNA (dsDNA) amplified by RAA can be recognized and transcribed by T7 RNA polymerase. The primer sequence is shown in Table 4 and was synthesized by Beijing Tianyi Huiyuan Company.

[0058] Table 4. HeV-RAA amplification primers

[0059] 2. Obtaining RAA amplification products Using the plasmid standard as a template, the primers designed in step 1 were used to perform RAA amplification to obtain RAA amplification products. The RAA amplification system is shown in Table 5.

[0060] Table 5. RAA amplification system

[0061] Add 47.5 μL of the mixed solution to the basic reaction unit containing the lyophilized powder to fully and evenly dissolve the lyophilized powder. Add 2.5 μL of B Buffer (a component in the RAA amplification kit) to the cap of each reaction tube, close the cap, centrifuge and collect and mix evenly. Place the above reaction tubes at 39°C for 30 minutes to obtain RAA amplification products.

[0062] (II) Method for detecting Hendra virus nucleic acid based on CRISPR-Cas13a system 1. Preparation of plasmid PCR + CRISPR-Cas13a fluorescence detection system 1. According to the PCR primer design principles and references (PMID: 32160714), the upstream and downstream primers of plasmid PCR were designed, and the T7 promoter sequence was introduced at the 5′ end of the upstream primer for subsequent transcription. The upstream primer: HeV-PCR-F sequence is aattctaatacgactcactatagggACCTAATAACCGCCCTCAGG (where 1-25 is the T7 promoter sequence). The downstream primer HeV-PCR-R sequence is ATGACACAAGTCCATAACTCAATC. The upstream and downstream primers were synthesized by Beijing Tianyi Huiyuan Company.

[0063] 2. Obtaining plasmid PCR products The sequence synthesized in step 1 above was diluted to 10 μM with ddH2O, and the plasmid PCR reaction system was prepared according to Table 6 Table 6. Plasmid PCR system

[0064] Plasmid PCR reaction conditions: thermal denaturation at 95°C for 5 min; 35 cycles at 95°C for 15 s, 60°C for 15 s, and 72°C for 12 s; automatic extension at 72°C for 5 min; and storage of PCR products at 4°C.

[0065] 3. Take 5 μL of the plasmid PCR amplification product obtained above as a template and prepare the CRISPR-Cas13a detection system according to Table 7 below.

[0066] Table 7 CRISPR-Cas13a fluorescence detection system

[0067] The PCR tube containing the reaction system shown in Table 7 above was placed in a fluorescent quantitative PCR instrument, and the channel excitation light wavelength was set to 490 nm, the emission light wavelength was set to 520 nm, 37°C, the value was read every 2 min, and the reading was performed 30 times for a total of 60 minutes to detect the change in fluorescence intensity in the system.

[0068] Result determination: If the mean fluorescence intensity value of the test sample detection system is statistically significantly different from the mean fluorescence intensity value of the negative control (ddH2O) within the same detection time, the test sample contains or is a candidate for containing Hendra virus; otherwise, the test sample does not contain or is a candidate for not containing Hendra virus; 2. Preparation of RAA+CRISPR-Cas13a fluorescence detection system Use the primers HeV-RAA-F3 and HeV-RAA-R3 in 1 of step (I) above to perform RAA amplification on the nucleic acid of the sample to be tested to obtain a RAA amplification product; Take 5 μL of the RAA amplification product obtained above as a template and prepare the CRISPR-Cas13a detection system as shown in Table 8 below.

[0069] The negative control was prepared by replacing the RAA product in Table 8 with ddH2O and keeping other reagent components unchanged.

[0070] Table 8. CRISPR-Cas13a fluorescence detection system

[0071] The PCR tube containing the reaction system shown in Table 8 above was placed in a fluorescent quantitative PCR instrument, and the channel excitation light wavelength was set to 490 nm, the emission light wavelength was set to 520 nm, 37°C, the value was read every 2 min, and the reading was performed 30 times for a total of 60 minutes to detect the change in fluorescence intensity in the system.

[0072] Result determination: If the mean fluorescence intensity value of the test sample detection system is statistically significantly different from the mean fluorescence intensity value of the negative control (ddH2O) within the same detection time, the test sample contains or is a candidate for containing Hendra virus; otherwise, the test sample does not contain or is a candidate for not containing Hendra virus; 3. Preparation of CRISPR-Cas13a test paper detection system Use the primers HeV-RAA-F3 and HeV-RAA-R3 in 1 of step (I) above to perform RAA amplification on the nucleic acid of the sample to be tested to obtain a RAA amplification product; Take 5 μL of the RAA amplification product obtained above as a template and prepare the CRISPR-Cas13a detection system as shown in Table 9 below.

[0073] The negative control was prepared by replacing the RAA product in Table 9 with ddH2O and keeping other reagent components unchanged.

[0074] Table 9. CRISPR-Cas13a test paper detection system

[0075] Put the tube cap on the reaction tube containing the reaction system shown in Table 9, invert it 5-6 times to mix, and centrifuge it at low speed for 10 seconds. Place the above reaction tube at 37°C for 30 minutes. After the reaction is completed, add the entire reaction system (50 μL) to the sample well of the CRISPR test paper.

[0076] Result determination: After the detection reaction, the system is dropped on the test paper and the reading is made 2-5 minutes later. If the test paper has no "T" line and a "C" line, the sample to be tested contains or the candidate contains Hendra virus; if the test paper has a "T" line and a "C" line, the sample to be tested does not contain or the candidate does not contain Hendra virus; if the test paper does not have a "C" line, the test paper is invalid and the test paper needs to be replaced and repeated.

[0077] (III) Condition optimization of the method for detecting Hendra virus nucleic acid based on the CRISPR-Cas13a system 1. Screening of optimal RAA primers and optimal crRNA 1. The diluted concentration of the mixture prepared in step (a) is 10 2The plasmid standard with 100 copies / μL was used as a template, and plasmid PCR amplification was performed using the method in Table 6 of (II) above to obtain the plasmid PCR amplification product.

[0078] Take 5 μL of the plasmid PCR amplification product and perform fluorescence detection using the method in Table 7 of (II) and the 5 crRNAs prepared in (I). The results are as follows: Figure 1 shown.

[0079] Figure 1 The results showed that after 60 minutes, the five groups of crRNAs were significantly different from their respective negative control groups, among which the fluorescence value of crRNA4 was (38424±1535)RFU, which was better than the fluorescence value of crRNA1 (29276±5966)RFU, the fluorescence value of crRNA2 (18901±7543)RFU, the fluorescence value of crRNA3 (35236±4719)RFU, and the fluorescence value of crRNA5 (37873±5056)RFU. crRNA4 was selected as the primary screening crRNA for the next experiment.

[0080] 2. The diluted concentration of the mixture prepared in step (a) is 10 3 With the plasmid standard of 10 copies / μL as template, the upstream and downstream primers of RAA were combined in pairs (F1&R1, F1&R2, F1&R3, F2&R1, F2&R2, F2&R3, F3&R1, F3&R2, F3&R3) and amplified according to the method in Table 5 of (a) (b) (c) and (d) for PCR amplification.

[0081] Take 5 μL of the above amplified product and perform fluorescence detection according to the method in Table 8 in (II). The crRNA is HeV-crRNA4. The result is as follows: Figure 2 shown.

[0082] Figure 2 The results showed that in the three repeated experiments, the fluorescence values ​​of F1R2, F1R3, and F2R1 were high in the first, F1R3, and F3R3 were high in the second, and F1R3 and F3R3 were high in the third. Based on the three results, F1R3 was selected as the RAA primer for initial screening and the next experiment was carried out.

[0083] 3. The diluted concentration of the mixture prepared in step (a) is 10 1 The plasmid standard with 100 copies / μL was used as a template and the RAA primer F1R3 that was initially screened was used for amplification according to the method in Table 5 of (a) (b) (c) (d) (e) 3 (f) (g) 2 (h) 3 (h) 5 (h) 3 (h) 2 (h) 5 (h) 3 (h) 3 (h) 5 ...

[0084] Take 5 μL of the above amplified product and the 5 kinds of crRNA prepared in (I) and perform fluorescence detection according to the method in Table 8 in (II). The results are as follows: Figure 3 , 4 shown.

[0085] Figure 3 Show: Use 10 1 The curve of crRNA screening by plasmid copies / µL and the RAA primer combination screened initially.

[0086] Figure 4 The fluorescence values ​​at 60 min were compared, including the fluorescence values ​​of crRNA1 (3058±120) RFU, crRNA2 (3057±40) RFU, crRNA3 (3391±65) RFU, crRNA4 (4442±472) RFU and crRNA5 (3320±44) RFU. The fluorescence values ​​of crRNA4 were higher than those of the other four groups of crRNA and the negative control group, and there were significant differences. Therefore, crRNA4 (the optimal crRNA) was selected for the next experiment.

[0087] 4. The diluted concentration of the mixture prepared in step (a) is 10 0 The plasmid standard with 10 copies / μL was used as a template, and the upstream and downstream primers of RAA were combined in pairs (F1&R1, F2&R1, F3&R1, F1&R2, F2&R2, F3&R2, F1&R3, F2&R3, F3&R3), and amplification was performed according to the method in Table 5 of (a) (b) (c) and (d) for PCR amplification.

[0088] Take 5 μL of the above amplified product and perform fluorescence detection according to the method in Table 8 of (II). The crRNA is HeV-crRNA4 (optimal crRNA). The results are as follows: Figure 5 shown.

[0089] Figure 5 The results show that in the three repeated experiments, the fluorescence value of F3R3 was high in the first experiment, the fluorescence values ​​of F3R1 and F3R3 were high in the second experiment, and the fluorescence values ​​of F3R1 and F3R3 were high in the third experiment. Based on the three results, F3R3 (i.e., HeV-RAA-F3, HeV-RAA-R3) was selected as the optimal RAA primer combination.

[0090] Example 2: Sensitivity detection of Hendra virus nucleic acid based on the CRISPR-Cas13a system.

[0091] Using the gradient diluted plasmid standard as a template, the plasmid containing the HeV gene fragment at different concentrations was detected according to the method in Example 1 to detect the sensitivity of the method of the present invention. The specific steps are as follows: 1. The plasmid standard obtained in step (a) of Example 1 was diluted with water in a gradient manner to obtain plasmid solutions containing HeV gene fragments at different concentrations: 10 2 copies / μ L, 10 1 copies / μL, 10 0 copies / μL, 10-1 copies / μL, 10 -2 copies / μL, 10 -3 copies / μL.

[0092] 2. Perform RAA amplification according to the method in step (a) 3 of Example 1, using HeV-RAA-F3 and HeV-RAA-R3 (optimal primers) as primers to obtain RAA amplification products.

[0093] 3. CRISPR fluorescence detection: Take 5 μL RAA amplification product and detect Hendra virus nucleic acid based on CRISPR-Cas13a fluorescence system according to the method in step (ii) of Example 1, and set the amplification product with water as template as negative control. The crRNA is HeV-crRNA4 (optimal crRNA).

[0094] CRISPR-Cas13a detection results Figure 6 and Figure 7 shown.

[0095] Figure 6 Shown: The curve diagram of CRISPR-Cas13a with the optimal RAA primer combination and the optimal crRNA detecting HeV nucleic acid of different concentrations.

[0096] Figure 7 Shown: Comparison of fluorescence values ​​at 60 min, 10 2 -10 0 Compared with the negative control, the fluorescence values ​​of 100 copies / μL had significant statistical differences, and the results showed that the sensitivity of the CRISPR-Cas13a detection system of the present invention in detecting Hev nucleic acid reached one copy (1 copy / μL).

[0097] 4. CRISPR test strips The plasmid standard obtained in step (a) of Example 1 was diluted with water in a gradient manner to obtain plasmid solutions containing HeV gene fragments at different concentrations: 10 3 copies / μL, 10 2 copies / μ L, 10 1 copies / μL, 10 0 copies / μL, 10 -1 copies / μL, 10 -2 copies / μL, 10 -3 copies / μL.

[0098] RAA amplification was performed according to the method in step (a) 3 of Example 1, using HeV-RAA-F3 and HeV-RAA-R3 (optimal primers) as primers to obtain a RAA amplification product.

[0099] Take 5 μL of RAA amplification product and detect HeV nucleic acid based on the CRISPR-Cas13a system according to the method in step (ii) of Example 1, and set the amplification product with ddH2O as the template as a negative control. The crRNA is HeV-crRNA4 (optimal crRNA).

[0100] RAA-CRISPR test results Figure 8 , 9 shown.

[0101] Figure 8 When HeV-crRNA4 was used to detect HeV nucleic acid, 3 -10 0 In the copies / μL group, the “T” line disappeared and the “C” line appeared. -1 copies / μL, 10 -2 copies / μL, 10 -3 copies / μL, the "T" line and "C" line of the negative control group were both visible, so it was judged that 10 3 -10 0 The copies / μL group was positive, 10 -1 copies / μL, 10 -2 copies / μL, 10 -3 The copies / μL group and the negative control group were negative.

[0102] Fig. 9 Show: 10 3 -10 0 The experiment was repeated three times in the copies / μL group, and the grayscale values ​​of the T line were all 0, 10 -1 copies / μL, 10 - 2 copies / μL, 10 -3 The experiments were repeated three times in the copies / μL group and the negative control group, and the grayscale values ​​of the T lines were all greater than 0.

[0103] comprehensive Figure 8 and Fig. 9 As a result, the sensitivity of the RAA-CRISPR test strip in detecting Hev nucleic acid reached one copy (1 copy / μL).

[0104] Example 3: Specific detection of Hendra virus nucleic acid based on CRISPR-Cas13a system Seven viruses, namely, CHIKV (Chikungunya virus), JEV (Japanese encephalitis virus), TBEV (forest encephalitis virus), YFV (yellow fever virus), DENV (dengue virus), ZIKV (Zika virus), and IBV (influenza B virus), were used to detect different viral nucleic acids according to the method in Example 1 (II) to verify the specificity of the method of the present invention. The specific steps are as follows: 1. 10 3 7 viral nucleic acids including CHIKV (Chikungunya virus), JEV (Japanese encephalitis virus), TBEV (Forest encephalitis virus), YFV (yellow fever virus), DENV (dengue virus), ZIKV (Zika virus), IBV (influenza B virus) and 10 3 The HeV plasmid with 100 copies / μL was used as the detection template, and RAA amplification was performed according to the method in step (I) 3 of Example 1 to obtain RAA amplification products. Primers HeV-RAA-F3 and HeV-RAA-R3 (optimal primers).

[0105] 2. Take 5 μL of RAA amplification product and detect HeV nucleic acid based on the CRISPR-Cas13a system according to the method in step (ii) of Example 1, and set the amplification product with ddH2O as the template as a negative control. The crRNA is HeV-crRNA4 (optimal crRNA).

[0106] CRISPR-Cas13a detection results Fig.10 and Fig.11 show Fig.10 The results show that when HeV-crRNA4 was used to detect different viral nucleic acids, only the "T" line disappeared and the "C" line appeared in the HeV group, while both the "T" line and the "C" line appeared in the other groups and the negative control group.

[0107] The experiment was repeated three times. The grayscale values ​​of T lines in the HeV group were all 0, while the grayscale values ​​of T lines in the other groups and the negative control group were all greater than 0.

[0108] comprehensive Fig.10 and Fig.11 As a result, the method of the present invention for detecting Hendra virus sites based on the CRISPR-Cas13a system has high specificity, and there is no cross reaction during the detection process.

[0109] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

[0110] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A crRNA target for detecting Hendra virus, characterized in that: The Hendra virus target sequence is SEQ ID NO.

1.

2. A CRISPR-Cas13a system for detecting Hendra virus, characterized in that The CRISPR-Cas13a system includes Cas13a protein and crRNA, or a complex formed by the two; The crRNA includes an anchor sequence for binding to the Cas13a protein and a guide sequence targeting the Hendra virus target sequence; the Hendra virus target sequence is shown in SEQ ID NO.

1.

3. The CRISPR-Cas13a system according to claim 2, characterized in that: The crRNA sequence is shown in SEQ ID NO.

2.

4. The CRISPR-Cas13a system according to claim 2 or 3, characterized in that: The Cas13a protein is LwCas13a protein.

5. A kit for detecting Hendra virus, comprising the CRISPR-Cas13a system for detecting Hendra virus according to any one of claims 2 to 4.

6. The kit according to claim 5, characterized in that: The kit also includes RAA amplification primers for specifically amplifying the Hendra virus target sequence; the RAA amplification primers are composed of the single-stranded DNA molecule shown in SEQ ID NO.4 and the single-stranded DNA molecule shown in SEQ ID NO.

5.

7. Any of the following substances: A1) the crRNA according to any one of claims 2 to 4; A2) the Cas13a protein and crRNA described in any one of claims 2 to 4, or a complex formed by the two; A3) The primer pair according to claim 6.

8. Any of the following applications: B1) Use of the CRISPR-Cas13a system according to any one of claims 2 to 4, the kit according to claim 5 or 6, or the substance according to claim 7 in detecting or assisting in detecting Hendra virus or its nucleic acid; B2) Use of the CRISPR-Cas13a system according to any one of claims 2 to 4, the kit according to claim 5 or 6, or the substance according to claim 7 in the preparation of a product for detecting or assisting in detecting Hendra virus or its nucleic acid; B3) Use of the CRISPR-Cas13a system according to any one of claims 2 to 4, the kit according to claim 5 or 6, or the substance according to claim 7 in detecting or assisting in detecting whether a sample to be tested contains Hendra virus or its nucleic acid; B4) Use of the CRISPR-Cas13a system according to any one of claims 2 to 4, the kit according to claim 5 or 6, or the substance according to claim 7 in the preparation of a product for detecting or assisting in detecting whether a sample to be tested contains Hendra virus or its nucleic acid; B5) Use of the CRISPR-Cas13a system according to any one of claims 2 to 4, or the kit according to claim 5 or 6, or the substance according to claim 7 in screening or assisting in screening for Hendra virus prevention and treatment drugs; B6) Use of the CRISPR-Cas13a system according to any one of claims 2 to 4, or the kit according to claim 5 or 6, or the substance according to claim 7 in the preparation of a product for screening or assisting in screening Hendra virus prevention and treatment drugs; B7) Use of the substance described in claim 7 in the preparation of the kit described in claim 5 or 6.

9. A method for detecting or assisting in detecting Hendra virus, comprising the following steps: C1) using the nucleic acid of the sample to be tested as a template, and using a primer pair consisting of a single-stranded DNA molecule shown in SEQ ID NO.4 and a single-stranded DNA molecule shown in SEQ ID NO.5 to perform RAA amplification to obtain a RAA product; C2) preparing a CRISPR-Cas13a detection system containing the following components: the RAA product, the Cas13a protein described in any one of claims 2-4, the crRNA described in any one of claims 2-4, a reporter RNA, NTP, T7 RNA polymerase, and an RNase inhibitor; and replacing the PCR product with water as a negative control; C3) reacting the CRISPR-Cas13a detection system and detecting the reaction product to determine whether the sample to be tested contains Hendra virus.

10. The method according to claim 9, characterized in that: In step C1), the reaction conditions for RAA amplification are: reaction at 39° C. for 30 minutes.

Images