Application of citrus CsDREB gene in citrus plant height regulation and control and dwarf variety cultivation

Abstract

The invention discloses application of a citrus CsDREB gene in citrus plant height regulation and control and dwarf variety cultivation, and belongs to the technical field of genetic engineering breeding. The invention provides a gene-CsDREB gene which has a remarkable regulation effect on the plant height of citrus, overexpression of the CsDREB gene can remarkably reduce the plant height and internode length of citrus, compared with a wild type, the plant height of a transgenic plant can be averagely reduced by 67.4%, and the higher the relative expression quantity is, the more remarkable the reduction of the plant height is; the CsDREB gene provided by the invention can be used as a candidate gene for breeding and / or breeding dwarf citrus varieties by adopting a genetic engineering method, so that the labor cost of fruit farmers is reduced, the production efficiency is improved, and experimental evidence is provided for clarifying the molecular mechanism of dwarf citrus phenotypes.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering breeding, and in particular to the application of citrus CsDREB gene in citrus plant height regulation and dwarf variety breeding. Background Art

[0002] Citrus is an important cash crop worldwide, including several high-value cultivars. Citrus fruits are widely used and are an important source of vitamins, antioxidants, minerals and dietary fiber, which are essential for human nutrition and health. Plant dwarfing is an important agronomic trait for intensive cultivation and effective management of modern orchards, which has a great impact on crop yield, lodging resistance, planting density and high harvest index.

[0003] Sweet orange production relies on grafted rootstocks, which can control plant height by reducing tree vigor. In sweet orange cultivation, growers have begun to seek to use dwarf and semi-dwarf varieties to control tree size because dwarf trees have the potential to increase planting density, increase yield, facilitate harvesting, pruning, and efficiently spray foliar fertilizers and pesticides. Therefore, the development and use of dwarf sweet orange germplasm is particularly important, and dwarf sweet oranges for high-density planting or mechanized production systems will be the key to sustainable production in the future. However, the specific molecular mechanisms that determine sweet orange plant height remain unclear.

[0004] In recent years, a number of dwarfing-related genes have been found in model plants and woody fruit trees, most of which are involved in plant hormone synthesis and signal transduction. In addition, important genes involved in growth and development, such as cell wall-related genes, homeobox genes, and transcription factors, also determine plant height, such as smallgrain and dwarf2 (SGD2), dwarftiller1 (DWT1), dwarf and delayed-flowering 1 (DDF1), and a new GRAS transcription factor in tomato (SlGRAS26). In citrus, dwarfing virus (citrus dwarfing viroid, CDVd) is a dwarfing agent that can be spread by grafting. The dwarfed sweet orange currently cultivated on rootstock has a reduction of more than 20% in the growth of branch tips and a reduction of about 50% in crown volume.

[0005] Breeding dwarf sweet orange varieties is an effective way to reduce labor costs and improve productivity. However, little is known about the genetic factors that control the size and shape of sweet orange trees. Therefore, it is urgent to clarify the molecular mechanism of the dwarf phenotype and use molecular breeding methods to create dwarf sweet orange germplasm for high-density sweet orange planting.

[0006] APETALA2 / Ethylene-Response Element-Binding Protein (AP2 / EREBP) is a plant-specific transcription factor superfamily that plays a vital regulatory role in plant growth and development as well as various stress responses. Among them, the dehydration-responsive element-binding protein (DREB) subfamily can specifically bind to DRE / CRT cis-acting elements to regulate the expression of genes related to plant development and stress response. For example, OsDREB2B in the rice AP 2 / ERF family DREB subgroup negatively regulates rice plant height by regulating the expression of gibberellin metabolism genes; the cross-talk between ethylene and gibberellin mediated by rice OsEATB inhibits internode elongation and plant development; the SlERF.J2-IAA23 module in tomato integrates light, auxin and gibberellin signaling networks to regulate hypocotyl elongation and plant height; overexpression of either SlERF.H5h or SlERF.H7 in tomato inhibits the expression of gibberellin biosynthesis gene GA20ox1, resulting in severe dwarfing of plants and reduced gibberellin content; Arabidopsis AtERF11 plays a dual role in promoting internode elongation by inhibiting ethylene biosynthesis and activating GA biosynthesis and signaling pathways. At present, there is no research and application of using DREBs to cultivate dwarf citrus. Summary of the invention

[0007] The purpose of the present invention is to provide the application of citrus CsDREB gene in citrus plant height regulation and dwarf variety breeding, so as to reveal the function of citrus CsDREB gene, provide an effective candidate gene for citrus dwarf variety breeding, and help to cultivate and / or select citrus dwarf varieties by genetic engineering means, reduce the labor cost of fruit farmers, and improve production efficiency, and provide experimental evidence for the early elucidation of the molecular mechanism of plant dwarf phenotype.

[0008] To achieve the above objectives, the present invention provides an application of the citrus CsDREB gene in regulating the height of citrus plants. The coding sequence of the citrus CsDREB gene is shown in SEQ ID NO.1. Overexpression of the citrus CsDREB gene significantly reduces the height of citrus plants.

[0009] Preferably, the higher the expression level of the citrus CsDREB gene, the lower the height of the citrus plant.

[0010] The vector and engineered bacteria containing the above-mentioned citrus CsDREB gene are used in regulating the growth of citrus plants. The vector is an overexpression vector, and the strains include Escherichia coli and Agrobacterium.

[0011] The application of the citrus CsDREB gene as described above in breeding dwarf citrus varieties.

[0012] The vector and engineered bacteria containing the above-mentioned citrus CsDREB gene are used in the cultivation of dwarf citrus varieties. The vector is an overexpression vector, and the strains include Escherichia coli and Agrobacterium.

[0013] The method for cultivating dwarf citrus germplasm using the CsDREB gene comprises the following steps:

[0014] (1) Cloning the coding sequence of the citrus CsDREB gene;

[0015] (2) constructing an overexpression vector containing the CsDREB gene;

[0016] (3) The overexpression vector containing the CsDREB gene is transformed into citrus, and the transgenic plants are identified and cultivated. The transgenic plants obtained are dwarf citrus germplasm.

[0017] Preferably, in step (1), the method for cloning the citrus CsDREB gene coding sequence is: extracting citrus total RNA, reverse transcribing it into cDNA as a template, using primers OE-CsDREB-F and OE-CsDREB-R for PCR amplification, and recovering the CsDREB coding sequence DNA fragment, wherein the nucleotide sequence of primer OE-CsDREB-F is shown in SEQ ID NO.2, and the nucleotide sequence of primer OE-CsDREB-R is shown in SEQ ID NO.3.

[0018] Preferably, in step (3), the method for transforming citrus with the overexpression vector containing the CsDREB gene is: transforming the overexpression vector containing the CsDREB gene into Agrobacterium tumefaciens by electroporation, and then transforming citrus explants mediated by Agrobacterium tumefaciens.

[0019] Preferably, in step (3), the PCR method is used to identify the transgenic plants, and the primers used are: ID-CsDREB-F and ID-CsDREB-R, ID-CsDREB-F is a sequence taken from CaMV 35S on the pLGNe vector, and ID-CsDREB-R is a primer designed based on the terminal sequence of the CsDREB gene. The nucleotide sequence of ID-CsDREB-F is shown in SEQ ID NO.4, and the nucleotide sequence of ID-CsDREB-R is shown in SEQ ID NO.5.

[0020] Preferably, qRT-PCR is used to analyze the expression of CsDREB to identify transgenic plants, and the primers used are: RT-CsDREB-F and RT-CsDREB-R, the nucleotide sequence of RT-CsDREB-F is shown in SEQ ID NO.6, and the nucleotide sequence of RT-CsDREB-R is shown in SEQ ID NO.7.

[0021] Therefore, the application of the citrus CsDREB gene provided by the present invention in citrus plant height regulation and dwarf variety breeding has the following specific technical effects:

[0022] (1) The present invention provides a gene that has a significant regulatory effect on citrus plant height, namely, the CsDREB gene. Overexpression of the CsDREB gene can significantly reduce the plant height and internode length of citrus. Compared with the wild type, the plant height of the transgenic plants can be reduced by an average of 67.4%, and the higher the relative expression level, the more significant the reduction in plant height;

[0023] (2) The CsDREB gene provided by the present invention can be used as a candidate gene for cultivating and / or breeding dwarf citrus varieties using genetic engineering methods, which can help reduce the labor costs of fruit farmers and improve production efficiency. It can also provide experimental evidence for clarifying the molecular mechanism of the dwarf citrus phenotype. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0025] Figure 1 is an agarose gel electrophoresis diagram of the PCR amplification product of the CsDREB gene clone of Example 1 of the present invention, wherein M is a DNA molecular weight standard, and DREB is a CsDREB gene;

[0026] Figure 2 This is a structural diagram of the overexpression vector of the CsDREB gene constructed in Example 2 of the present invention, wherein GUS is the β-glucosidase gene; P35S is a plant constitutive promoter derived from cauliflower mosaic virus; NOS is the terminator of the opine synthase gene;

[0027] Figure 3 This is a flow chart of citrus genetic transformation according to Example 3 of the present invention;

[0028] Figure 4The results of GUS staining identification of transgenic plants in Example 4 of the present invention, wherein DREB-OE-1, DREB-OE-2 and DREB-OE-3 represent three transgenic plants, respectively, and WT is a wild-type sweet orange plant;

[0029] Figure 5 The electrophoresis results of the PCR products of the transgenic plants in Example 4 of the present invention, wherein P is the plasmid pLGNe-CsDREB;

[0030] Figure 6 The expression analysis results of CsDREB gene in transgenic plants in Example 4 of the present invention are shown, wherein ** indicates that the difference is extremely significant compared with WT (P≤0.01);

[0031] Figure 7 This is a photo of the transgenic plant in Example 5 of the present invention;

[0032] Figure 8 This is a photo of the leaves of the transgenic plant in Example 5 of the present invention;

[0033] Fig. 9 This is a photo of the internodes of the transgenic plant in Example 5 of the present invention;

[0034] Fig.10 The statistical results of plant height of transgenic plants in Example 5 of the present invention are shown, wherein ** indicates that the difference is extremely significant compared with WT (P≤0.01). DETAILED DESCRIPTION

[0035] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0036] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0037] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources, and the steps not described in detail in the examples are conventional techniques in the art.

[0038] The culture medium used in the examples is as follows:

[0039] Seed germination medium: MS + 30g / L sucrose + 2.5g / L Gelrite, PH 5.8.

[0040] Co-culture medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4-D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, PH 5.8.

[0041] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, PH 5.8.

[0042] Seedling medium: MS + 30g / L sucrose, PH 5.8.

[0043] Embodiment 1

[0044] The cloning steps of the coding sequence of the citrus CsDREB gene are as follows:

[0045] (1) Extract total RNA and synthesize cDNA.

[0046] Total RNA from sweet orange (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the quality of the RNA obtained was verified by agarose gel electrophoresis, and the RNA concentration was determined by a Nanodrop 2000 spectrophotometer. RNA with good quality was selected and cDNA was synthesized using a reverse transcription kit PrimeScript RT MasterMix (TaKaRa, CAT: RR036A).

[0047] (2) PCR amplification of the coding sequence of CsDREB gene.

[0048] According to the coding sequence of CsDREB gene obtained from NCBI (as shown in SEQ ID NO.1), primers were designed (so that the fragment to be amplified contains restriction sites).

[0049] SEQ ID NO.1:

[0050] ATGGGTGATCATGACCCTCAAAATCCTACCAACGTATCCGAATTAGACCACTATCTTCAACTTCGAGGGCCACATTCCCTTCACAATAATACTTCCACGTGTCAAAATTACCCTTCTCCCGTAAGTGAAAATTTAGCTCACCCATCATCTAACACCAGTACCATGGCCGCTG CCCCGTCAAGTCCCACCAAGAAACACCCTTCGTACAGGGGAATCCGTTGCCGGAACAGCAAATGGGTGTCGGAGATCCGGGAGCCTCGCAAGAGCACACGTATATGGCTCGGTACATATCCTACTCCTGAAATGGCAGCGGCCGCTTATGATGTTGCAGCCCTAGCCCTAAAA GGAAGTGATGCTGTGCTCAATTTCCCTAACTTTGTTTCAACCTACCCGGTGCCTGCTTCTTCTTCTTCTGTAGACATACGTAACGCCGCTGCAGCTGCGGCTGCTTTCTTGTGCTCGAAGAAAGGCCGAAAGTGTAAGTGATCCTGATGAGAATCAAAGAATGGAACAGTCGC GCAGCAATGATGTGATTGGAGAATTTGTTGACGAGGACGCCCTTTTGAACATGCCTAATTTGCTAGTGGACATGGCAGAGGGAATGATGGTGTCCCCGCCTAGAATAAACTCTTCGCCGTCTGATGATTCGCCGGAGAATTCTGATGGAGAACGTTTGTGGAGCTACTTTTGA

[0051] Use primers OE-CsDREB-F (sequence as shown in SEQ ID NO.2), OE-Cs DREB-R (sequence as shown in SEQ ID NO.3), and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q), and use the citrus cDNA obtained in step (1) as a template. Prepare the reaction system according to the instructions attached to the high-fidelity enzyme PrimeSTAR Max DNA Polymerase and perform PCR amplification.

[0052] The PCR amplification program was: 94°C, 5 min; 94°C, 15 s, 58°C, 15 s, 72°C, 1 min, 38 cycles; 72°C extension for 10 min. The amplified product was subjected to agarose gel electrophoresis. The results were as follows: Figure 1 As shown, the obtained DNA fragment of the CsDREB gene coding sequence is 754 bp in length (including the restriction site). The amplified fragment was sent to the company for sequencing, and the sequence was consistent with the coding sequence of the citrus CsDREB gene. Under ultraviolet light, a clean blade was used to cut the agarose gel block containing the target fragment, and the DNA fragment was recovered using a gel recovery kit (BioFlux, CAT: BSC02M1).

[0053] SEQ ID NO.2:GCGGTACCATGGGTGATCATGACCCTCA

[0054] SEQ ID NO.3:

[0055] GCGTCGACTCACTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTG

[0056] TAATCAAAGTAGCTCCACAAACG

[0057] Embodiment 2

[0058] The overexpression vector of CsDREB gene was constructed. The specific steps are as follows:

[0059] The CsDREB gene coding sequence DNA fragment and the overexpression vector pLGNe recovered in Example 1 were double-digested with restriction endonucleases KpnI and SalI (ThermoFisher), and the digestion conditions were carried out according to the instructions attached to the restriction endonucleases KpnI and SalI. After double digestion, agarose gel electrophoresis was performed, and then the target fragment was recovered using a gel recovery kit, and the recovered target fragment was ligated overnight at 4°C using a T4 DNA Ligase kit (Promega, CAT: M1801).

[0060] The ligation product was transformed into E. coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the CsDREB overexpression vector pLGNe-CsDREB. The structure of the pLGNe-CsDREB recombinant vector is as follows: Figure 2 shown.

[0061] Embodiment 3

[0062] The CsDREB overexpression vector pLGNe-CsDREB obtained in Example 2 was genetically transformed into citrus, as follows Figure 3 As shown, the specific steps are as follows:

[0063] (1) Obtain epicotyls of citrus seedlings.

[0064] Fresh citrus fruits were washed and surface disinfected with 75% ethanol. The seeds were taken out under sterile conditions, the seed coats were peeled off, and the seeds were placed on seed germination medium. They were cultured in the dark at 28°C for 2 weeks, and then cultured under 16h light / 8h dark conditions for 1 week. The epicotyls of the germinated seedlings were cut into 1 cm stem segments under sterile conditions as explants for Agrobacterium tumefaciens-mediated genetic transformation.

[0065] (2) The overexpression vector pLGNe-CsDREB was transformed into Agrobacterium.

[0066] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The specific steps are as follows: pre-thaw frozen Agrobacterium competent cells EHA105 (50 μL) on ice; add 2 μL of the plasmid of the overexpression vector to the competent cells, mix by blowing, and place on ice for 5 minutes; transfer the mixed solution to the bottom of the pre-dried electric shock cup, put the electric shock cup into the card slot and adjust it to the correct position, adjust the electric shock device to the "Agr" gear, press the electric shock button, check the electric shock data to ensure that the electric shock is successful; add 1 mL of LB liquid culture medium to the electric shock cup, mix by blowing with a pipette, transfer to a sterile centrifuge tube, and culture on a shaker at 260 r / min and 28°C for 60 minutes; centrifuge the bacterial solution at 10000 r / min for 1 minute, discard the supernatant (about 100 μL of resuspended bacteria remains), apply it to LB solid culture medium after resuspension, and culture it inverted in the dark at 28°C for 2 days; after the bacterial plaque grows, pick a single clone and perform PCR verification on the single colony using the system and primers in Example 1.

[0067] The PCR reaction conditions were: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 38 cycles; 72°C for 10 min.

[0068] (3) Prepare Agrobacterium tumefaciens bacterial solution.

[0069] Before transfection, streak the Agrobacterium (containing the pLGNe-CsDREB vector) for transfection on LB solid medium containing 50 mg / L kanamycin; pick a single colony and inoculate it into 25 mL LB liquid medium containing the same antibiotics, and culture it at 28°C with shaking overnight; dilute the bacterial solution to OD=0.1 and continue to culture it to OD=0.5, centrifuge it at 5000r / min for 10min, discard the supernatant, and resuspend it in MS liquid medium at pH 5.4 for transfection.

[0070] (4) Transformation of citrus epicotyls.

[0071] The citrus epicotyl stem segments obtained in step (1) are immersed in the Agrobacterium solution obtained in step (2) for 13 minutes and then wiped dry with sterile filter paper. The stem segments are transferred to a co-cultivation medium and cultured in the dark at 26°C for 2 days. After the co-cultivation is completed, the epicotyls are transferred to a screening medium and cultured in the dark at 28°C for 7 days. Thereafter, the epicotyls are cultured at 28°C and 16 h light / 8 h dark. The screening medium is used for subculture every two weeks, and then the cells are identified by GUS staining.

[0072] (5) Seedling culture of transformants.

[0073] When the seedlings grow to more than 1 cm, they are cut and grafted onto sweet orange (Wanjin orange) seedlings in sterile test tubes and cultured in seedling medium; when the seedlings grow to about 5 cm, they are grafted onto trifoliate orange seedlings and cultured in a 28°C greenhouse.

[0074] Embodiment 4

[0075] The CsDREB overexpressing transgenic plants obtained in Example 3 were verified, and the specific steps were as follows:

[0076] (1) Identification of transgenic plants by GUS staining.

[0077] Take a small piece of the transgenic plant leaf obtained in the initial screening and perform GUS histochemical staining for 24 hours. The results are as follows: Figure 4 As shown, the edges of the leaves of the positive plants appeared blue, while the leaves of the WT plants did not show color.

[0078] (2) PCR identification of transgenic plants.

[0079] 100 mg of leaves of transgenic plants were taken, and genomic DNA was extracted using a DNA extraction kit (Adlai, CA T: DN15), and PCR was used to detect the integration of the CsDREB gene coding sequence in the citrus genome. The detection primers were ID-CsDREB-F (sequence as shown in SEQ ID NO.4, located in the 35S region) and ID-CsDREB-R (sequence as shown in SEQ ID NO.5, located in the CDS region), and the obtained genomic DNA was used as a template. The PCR system was the same as that in Example 1, and the PCR reaction conditions were: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0080] The wild-type sweet orange was used as the negative control (WT) and the plasmid pLGNe-CsDREB was used as the positive control (P). The amplified products were subjected to agarose gel electrophoresis. Figure 5 As shown, a 960 bp amplified fragment could be obtained from the positive plants, while no amplification was obtained from the WT plants.

[0081] SEQ ID NO.4:TCGTTGAAGATGCCTCTGCCGACAG

[0082] SEQ ID NO.5:

[0083] GCGTCGACTCACTTATCATCATCATCCTTGTAATCCTTATCATCATCCTTGTAATCAAAGTAGCTCCACAAACG

[0084] (3) qRT-PCR analysis of transgenic plants.

[0085] Total RNA from leaves of transgenic plants was extracted using a kit (Aidelai, CAT No: RN09), and then cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A). The expression of the target gene was detected by qRT-PCR. The detection primers were RT-CsDREB-F (sequence as shown in SEQ ID NO.6) and RT-CsDREB-R (sequence as shown in SEQ ID NO.7). The qRT-PCR reaction conditions were: 95℃3min, 94℃10s; 56℃10s, 72℃10s, 40 cycles; 72℃10min. 2 -△△Ct The relative expression of CsDREB gene in transgenic plants was calculated by the following method: the water-treated sample was defined as the reference factor, that is, its CsDREB expression level was 1, and then the multiple of the gene expression in transgenic citrus relative to the reference factor was calculated. -△△Ct , is its relative expression level.

[0086] SEQ ID NO.6:ACCATGGCCGCTGCC

[0087] SEQ ID NO.7: CATAAGCGGCCGCTGC

[0088] The results are as follows Figure 6 As shown, the CsDREB gene was expressed at a higher level in the transgenic plants than in the wild-type plants, and was at least 400 times higher than that in the wild-type plants.

[0089] Embodiment 5

[0090] The phenotypes of CsDREB overexpressing transgenic plants were investigated.

[0091] Photos of the three transgenic plants are shown below. Figure 7 and Fig. 9 As shown in Figure 2, compared with wild-type plants, transgenic plants were significantly dwarfed and had shorter internodes. The higher the relative expression level, the more significant the reduction in plant height (see Fig. 9), the quantitative results of plant height are as follows Fig.10 As shown, overexpression of the CsDREB gene can significantly reduce the height of sweet orange plants.

[0092] Therefore, the present invention provides a gene that has a significant regulatory effect on the plant height of citrus, namely the CsDREB gene. Overexpression of the CsDREB gene can significantly reduce the plant height and internode length of citrus. Compared with the wild type, the plant height of the transgenic plants can be reduced by an average of 67.4%, and the higher the relative expression level, the more significant the reduction in plant height. The provided CsDREB gene can be used as a candidate gene for cultivating and / or breeding dwarf citrus varieties using genetic engineering methods, which can help reduce the labor costs of fruit farmers and improve production efficiency, and can also provide experimental evidence for clarifying the molecular mechanism of the dwarf citrus phenotype.

[0093] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Application of the citrus CsDREB gene in regulating the growth of citrus plants, characterized in that: The coding sequence of the citrus CsDREB gene is shown in SEQ ID NO.

1. Overexpression of the citrus CsDREB gene significantly reduces the plant height of citrus plants.

2. The use of the citrus CsDREB gene according to claim 1 in regulating the growth of citrus plants, characterized in that: The higher the expression level of the citrus CsDREB gene, the lower the height of the citrus plants.

3. Use of the vector and engineered bacteria containing the citrus CsDREB gene of claim 1 in regulating the growth of citrus plants, characterized in that: The vector is an overexpression vector, and the strains include Escherichia coli and Agrobacterium.

4. Use of the citrus CsDREB gene as claimed in claim 1 in breeding dwarf citrus varieties.

5. Use of the vector and engineered bacteria containing the citrus CsDREB gene of claim 1 in cultivating dwarf citrus varieties, characterized in that: The vector is an overexpression vector, and the strains include Escherichia coli and Agrobacterium.

6. A method for cultivating dwarf citrus germplasm using the CsDREB gene described in claim 1, characterized in that: The steps include: (1) Cloning the coding sequence of the citrus CsDREB gene; (2) constructing an overexpression vector containing the CsDREB gene; (3) The overexpression vector containing the CsDREB gene is transformed into citrus, and the transgenic plants are identified and cultivated. The transgenic plants obtained are dwarf citrus germplasm.

7. The method for cultivating dwarf citrus germplasm using CsDREB gene according to claim 6, characterized in that: In step (1), the cloning method of the citrus CsDREB gene coding sequence is: extracting citrus total RNA, reverse transcribing it into cDNA as a template, using primers OE-CsDREB-F and OE-CsDREB-R for PCR amplification, and recovering the CsDREB coding sequence DNA fragment, wherein the nucleotide sequence of primer OE-CsDREB-F is shown in SEQ ID NO.2, and the nucleotide sequence of primer OE-CsDREB-R is shown in SEQ ID NO.

3.

8. The method for cultivating dwarf citrus germplasm using CsDREB gene according to claim 6, characterized in that: In step (3), the method for transforming citrus with the overexpression vector containing the CsDREB gene is as follows: transforming the overexpression vector containing the CsDREB gene into Agrobacterium tumefaciens by electroporation, and then transforming citrus explants mediated by Agrobacterium tumefaciens.

9. The method for cultivating dwarf citrus germplasm using CsDREB gene according to claim 6, characterized in that: In step (3), the transgenic plants are identified by PCR, and the primers used are: ID-CsDREB-F and ID-CsDREB-R, ID-CsDREB-F is a sequence taken from CaMV 35S on the pLGNe vector, and ID-CsDREB-R is a primer designed based on the terminal sequence of the CsDREB gene. The nucleotide sequence of ID-CsDREB-F is shown in SEQ ID NO.4, and the nucleotide sequence of ID-CsDREB-R is shown in SEQ ID NO.

5.

10. The method for cultivating dwarf citrus germplasm using CsDREB gene according to claim 6, characterized in that: qRT-PCR was used to analyze the expression of CsDREB to identify transgenic plants. The primers used were: RT-CsDREB-F and RT-CsDREB-R. The nucleotide sequence of RT-CsDREB-F is shown in SEQ ID NO.6, and the nucleotide sequence of RT-CsDREB-R is shown in SEQ ID NO.7.

Images