Primer, probe and kit for distinguishing sansevieria glauca and sansevieria barbata

Abstract

The invention relates to a primer, a probe and a kit for distinguishing sansevieria glauca and sansevieria clavata. The nucleotide sequence of the DNA probe is as shown in SEQ ID NO.1. The invention also relates to a kit for distinguishing sansevieria glauca from sansevieria clavata. The primers comprise 1 to 2k-F and 1 to 2k-R; the nucleotide sequence of the primer 1-2k-F is as shown in SEQ ID NO. 2; the nucleotide sequence of the primer 1-2k-R is as shown in SEQ ID NO.3. The kit comprises the probe and the primer. A PCR amplification product is subjected to Sanger sequencing, sequencing results are compared, the comparison result shows that a 23 bp insertion site exists at the site of sansevieria glauca and sansevieria barbata, and the sansevieria glauca and sansevieria barbata can be distinguished, and an oligonucleotide fluorescent probe is designed according to the site, so that the detection sensitivity is improved, and the detection accuracy is improved. Therefore, the sansevieria valeriana and the sansevieria glauca can be reliably and effectively distinguished.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and in particular to a primer, a probe and a kit for distinguishing between silver-veined tiger tail orchid and clavate tiger tail orchid. Background Art

[0002] Tiger tail orchid (Sansevieria trifasciata) belongs to the genus Tiger tail of the Liliaceae family. It is an evergreen perennial succulent plant native to tropical Africa. It is a desert plant that is drought-resistant, moisture-resistant and shade-resistant. It can adapt to various harsh environments and has both ornamental and medicinal value. Its reproduction is mainly through the cutting and scarring of the leaves to grow young shoots. There are many cultivated varieties of Tiger tail orchid. The common varieties of Tiger tail orchid are Golden Edge Tiger Tail, Short Leaf Tiger Tail, Green Tiger Tail, Silver Veined Orchid, Tiger Tail, Diamond Orchid, Buddha's Hand Tiger Tail, Rod-Leafed Tiger Tail, etc. Silver Veined Tiger Tail and Rod-Leafed Tiger Tail are different varieties of Tiger Tail, both of which have high ornamental value. The appearance of the two is very similar in the seedling stage. The leaf shape of the Silver Veined Tiger Tail in the seedling stage is extremely similar to that of the Rod-Leafed Tiger Tail. Therefore, there are certain limitations in the external morphological identification of the two in the seedling stage.

[0003] Molecular identification technology is a technology that identifies molecular-level information based on differences in biological genomes. Compared with the subjectivity and complexity of traditional morphological feature identification, molecular identification technology can visualize and simplify the differences between species in the form of sequence data, so as to obtain more reliable identification results more efficiently.

[0004] Chloroplast genome (cpDNA) molecular markers are of great significance in the field of plant science, especially in phylogeny, evolutionary biology, species identification, population genetics, ecology and conservation biology. The chloroplast genome is usually a single circular molecule with a size ranging from 120-160kb, containing a series of genes encoding photosynthesis, electron transfer and other biosynthetic pathways, which has high genetic stability, low recombination rate and maternal inheritance. These characteristics make the chloroplast genome an efficient and reliable molecular marker that can provide high-resolution information, especially suitable for analyzing distantly related plants and evaluating population structure, gene flow and historical dynamics. By comparing the chloroplast genomes of different species or populations, researchers can gain a deeper understanding of how plants adapt to various ecological environments and the evolutionary mechanisms behind them, thereby providing a scientific basis for biodiversity conservation and sustainable use. Summary of the invention

[0005] In order to solve the problems existing in the above technology, the present invention provides a primer and a probe for distinguishing between Sansevieria argentea and Sansevieria clavata, wherein the nucleotide sequence of the DNA probe is shown in SEQ ID NO.1; The primers include 1-2k-F and 1-2k-R; The nucleotide sequence of the primer 1-2k-F is shown in SEQ ID NO.2; The nucleotide sequence of the primer 1-2k-R is shown in SEQ ID NO.3.

[0006] Wherein, the probe is marked with a tracer marker.

[0007] Wherein, the tracer label is one or more of an isotope label and a non-isotope label.

[0008] Wherein, the non-isotope label is an enzyme or a colored group.

[0009] And a kit for distinguishing silver-veined tiger tail orchid and stick-leafed tiger tail orchid, the kit comprises the above-mentioned probe and primer.

[0010] Based on the alignment results of the chloroplast genomes of Tigertail orchid with silver veins and Tigertail orchid with rod leaves, this application found that there is a differential site in the 1.2 kb region. Through this one site, we can distinguish Tigertail orchid with silver veins and Tigertail orchid with rod leaves, which is an ideal site for molecular markers. We intercepted the 120 bp sequence upstream and downstream of the differential site as a reference sequence to select homologous sequences to design primers. PCR amplification was performed using the DNA of Tigertail orchid with silver veins and Tigertail orchid with rod leaves as templates. A single bright band consistent with the expected size was amplified in both templates, proving that the differential site fragment obtained from the chloroplast genome sequence analysis exists and can be amplified and subsequently identified.

[0011] The PCR amplification products were sequenced by Sanger sequencing, and the sequencing results were compared. The comparison results showed that there was a 23 bp insertion site at this site in Sansevieria argenteum, which could distinguish Sansevieria argenteum from Sansevieria clavata. Based on this site, an oligonucleotide fluorescent probe was designed, and molecular biological methods such as RPA (Recombinase Polymerase Amplification) could be used to detect the leaf tissues of Sansevieria argenteum and Sansevieria clavata. Molecular identification could be achieved by the presence or absence of fluorescent signals, so that Sansevieria clavata and Sansevieria argenteum could be reliably and effectively distinguished. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0013] Figure 1 It is the electrophoresis band of molecular marker PCR amplification of the silver vein tiger tail orchid and the rod-leaf tiger tail orchid varieties of the present invention, wherein the electrophoresis bands are Marker D2000, silver vein tiger tail orchid, and the rod-leaf tiger tail orchid from the left, and the band size is about 300 bp; Figure 2is the sequencing comparison result of the differential sites between the silver veined tiger tail orchid and the club-leaved tiger tail orchid of the present invention; Figure 3 The nucleic acid test strips of the present invention are the test results of DNA amplification products of Sansevieria argentea and Sansevieria clavata, wherein from left to right are respectively negative controls: rice leaf DNA; Sansevieria clavata leaf DNA; and Sansevieria argentea leaf DNA. DETAILED DESCRIPTION

[0014] The technical scheme in the embodiment of the present invention is described clearly and completely below in conjunction with the accompanying drawings in the embodiment of the present invention. In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein, and those skilled in the art can make similar generalizations without violating the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below.

[0015] 1. Materials and methods: 1.1 Experimental instruments High-speed refrigerated centrifuge: ThermoFisher, Micro 21R; Constant temperature water bath: Jinghong, DK-S24; Ultra-micro-spectrophotometer: ThermoFisher, NanoDrop2000; PCR instrument: ThermoFisher, Applied Biosystems VeritiPro; Gel electrophoresis instrument: Liuyi, DYY-8C; Gel imaging system: VILBER, FUSION FX7; 1.2 Experimental Reagents Plant genomic DNA extraction kit: Tiangen, DP305; 2×Phanta Max Master Mix (Dye Plus): Norwegian, P525; D2000 molecular weight standard: Tiangen, MD114; 1.3 Experimental methods Sample grinding: Use liquid nitrogen to grind the sample tissue into a uniform powder.

[0016] DNA extraction: refer to the instruction manual to extract DNA from leaf tissues of Sansevieria clavata and Sansevieria silver-veined plants and detect the concentration.

[0017] Acquisition of chloroplast genome: The whole chloroplast genome of the sample is sequenced, and after removing low-quality data, the clean reads are assembled to obtain relatively complete chloroplast genome data.

[0018] Sequence alignment: MAFFT software was used to align the chloroplast genomes of Sansevieria clavata and Sansevieria silver veins.

[0019] PCR primer design: According to the alignment results of the chloroplast genomes of Sansevieria clavata and Sansevieria silver-veined, the differential sites that can distinguish Sansevieria clavata and Sansevieria silver-veined were selected, the differential sites and their upstream and downstream 120 bp sequences were extracted, and primers were designed using Primer-BLAST. The PCR primer pairs 1-2k-F=SEQ ID NO.2=tccaatgtaaagacggttttcgg and 1-2k-R=SEQ ID NO.3=gttcgagtcccgggca were screened and synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0020] PCR amplification verification: Configure the PCR reaction system according to Table 1, and set the PCR program according to Table 2 for PCR amplification.

[0021] Table 1 PCR system

[0022] Table 2 PCR program

[0023] Gel electrophoresis: Use 1.5% agarose gel electrophoresis to detect the band size of PCR products.

[0024] Sequencing: PCR products whose electrophoresis band size is consistent with the expected results are sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.

[0025] Sequence alignment: DNAMAN was used to align the differential sites of the chloroplast genomes of Sansevieria clavata and Sansevieria silver veins.

[0026] Probe design: Following the probe design principles, an oligonucleotide probe of 45-50 nt in length was designed at the chloroplast gene-specific site of Sansevieria argentea, labeled with a FAM fluorescent group at the 5' end, modified with a C3-spacer at the 3' end, and a d-Spacer (THF tetrahydrofuran) was inserted in the middle of the probe at a distance of more than or equal to 35 nt from the 5' end.

[0027] Probe sequence = SEQ ID NO.1 = 5'- CTCCCAAGCACACGTACTAACTAATTAGAAGATAGATAATAGACTAATTAGA-3'; The sequence after inserting THF tetrahydrofuran = 5'- CTCCCAAGCACACGTACTAACTAATTAGAAGATAG(THF)TAATAGACTAATTAGA-3'; 2. Experimental Results 2.1 Differential site selection and amplification verification like Figure 1 As shown, the fragments of about 120 bp upstream and downstream of the differential site were amplified and verified, and the results of agarose nucleic acid electrophoresis detection were consistent with expectations. The target fragments were amplified in both the silver-veined Sansevieria and the stick-leafed Sansevieria varieties.

[0028] 2.2 Differential site sequencing and comparison After assembling the chloroplast genome sequences of two Sansevieria varieties, the difference sites can be screened out, such as Figure 2 shown.

[0029] 2.3 Molecular marker probe design Following the probe design principles, an oligonucleotide probe with a length of 45-50 nt was designed at the chloroplast gene-specific site of Sansevieria argentea, a FAM fluorescent group was labeled at the 5' end, and the 3' end was modified with C3-spacer. A d-Spacer (THF tetrahydrofuran) was inserted in the middle of the probe at a distance of 35 nt or more from the 5' end to design a fluorescent molecular labeled oligonucleotide probe. The results are shown in Table 3.

[0030] Table 3 Fluorescent probe sequences based on specific sites

[0031] 3. Identification method DNA amplification: Use primers 1-2k-F / 1-2k-R, fluorescent probes and amplification kits to prepare the amplification system according to the system in Table 4, and use sterile water instead of DNA template as a negative control. After preparing the amplification system, add 2 μL of Starter and place it in a 40℃ water bath for reaction for 30 min before use.

[0032] Table 4. Sample DNA isothermal amplification system

[0033] Nucleic acid test strip detection: Take 10 μl of the amplified product, dilute it 10 times with Diluent buffer, and then add it dropwise to the test strip. After the chromatography reaction for 5 minutes, check the test line (T) and quality control line (C).

[0034] Experimental Results The results of nucleic acid test strips showed that the quality control line of the negative control test strips showed color, proving that the test strips can be used for detection experiments. In this experiment, the oligonucleotide fluorescent probe successfully combined with the DNA of the leaves of the silver veined tiger tail orchid, causing the fluorescent modified substance to show color, while the DNA of the leaves of the rod-leaved tiger tail orchid did not combine with the probe, and the result was that the test line did not show color ( Figure 3 ). According to the test results, the molecular marker probe can be used to distinguish between Sansevieria clavata and Sansevieria silver vein.

[0035] 4. Conclusion Based on the alignment results of the chloroplast genomes of Sansevieria argentei and Sansevieria clavipes, we found a differential site in the 1.2 kb region. Through this site, we can distinguish Sansevieria argentei and Sansevieria clavipes, which is an ideal site for molecular markers. We intercepted the 120 bp upstream and downstream sequences of the differential site as reference sequences and selected homologous sequences to design primers. PCR amplification was performed using DNA from Sansevieria argentei and Sansevieria clavipes as templates. A single bright band with the expected size was amplified in both templates, proving that the differential site fragment obtained from the chloroplast genome sequence analysis exists and can be amplified and subsequently identified.

[0036] The PCR amplification products were sequenced by Sanger sequencing, and the sequencing results were compared. The comparison results showed that there was a 23 bp insertion site at this site in Sansevieria argenteum, which could distinguish Sansevieria argenteum from Sansevieria clavata. Based on this site, an oligonucleotide fluorescent probe was designed, and molecular biological methods such as RPA (Recombinase Polymerase Amplification) could be used to detect the leaf tissues of Sansevieria argenteum and Sansevieria clavata. Molecular identification could be achieved by the presence or absence of fluorescent signals, so that Sansevieria clavata and Sansevieria argenteum could be reliably and effectively distinguished.

[0037] Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

Claims

1. A primer and a probe for distinguishing between Sansevieria argentea and Sansevieria clavata, characterized in that: The nucleotide sequence of the DNA probe is shown in SEQ ID NO.1; The primers include 1-2k-F and 1-2k-R; The nucleotide sequence of the primer 1-2k-F is shown in SEQ ID NO.2; The nucleotide sequence of the primer 1-2k-R is shown in SEQ ID NO.

3.

2. The primer and probe for distinguishing between Sansevieria argentea and Sansevieria clavata according to claim 1, characterized in that: The probe is marked with a tracer label.

3. The primer and probe for distinguishing between Sansevieria argentea and Sansevieria clavata according to claim 2, characterized in that: The tracer label is one or more of an isotope label and a non-isotope label.

4. The primer and probe for distinguishing between Sansevieria argentea and Sansevieria clavata according to claim 3, characterized in that: The non-isotopic label is an enzyme or a colored group.

5. A kit for distinguishing between Sansevieria argentea and Sansevieria clavata, characterized in that: The kit comprises the probe and primers as described in any one of claims 1 to 4.

Images