Natural fissistilarin component derivative DhpB and application thereof
By structurally modifying lignans, DhpB was developed as a molecular glue drug that targets the MKRN2 protein. This solves the problems of unclear target and poor drug-likeness of existing natural lignans in the treatment of KRAS-mutant lung cancer. It achieves effective inhibition and apoptosis induction of KRAS-mutant lung cancer, and is non-toxic to normal cells.
Patent Information
- Application Number
- CN202411646514.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-18
- Publication Date
- 2026-03-27
- Estimated Expiration
- 2044-11-18
AI Technical Summary
Existing natural lignans have problems in treating KRAS-mutant lung cancer, including unclear targets and mechanisms, low bioavailability, and poor drug-likeness. Furthermore, existing targeted drugs such as Sotorasib and Adagrasib have limitations in efficacy and tolerability, with prominent issues of tumor recurrence and drug resistance.
A natural lignan derivative, DhpB, was developed. Its water solubility and druggability were improved through structural modification, and it targets the MKRN2 protein. As a molecular gel drug, it alters the protein recruitment of the E3 ligase receptor by mediating protein-protein interactions, thereby enabling the target protein to be labeled and degraded by ubiquitin.
DhpB significantly inhibits the ribosome synthesis pathway in KRAS-mutant lung cancer cells and induces tumor cell apoptosis, showing promising pharmaceutical potential. It is also non-toxic to normal cells and significantly improves water solubility and drug-likeness.
Smart Images

Figure CN119504718B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of medicine, and particularly relates to a natural seco-lignan derivative DhpB and application thereof. BACKGROUND
[0002] KRAS mutant lung cancer is a common type of non-small cell lung cancer (NSCLC) with poor prognosis, mainly due to KRAS mutation leading to enhanced tumor cell proliferation and metastasis (Cascetta et al. Cancers 2022, 14:5430). Although Sotorasib and Adagrasib and other targeted drugs have shown efficacy in clinical trials in recent years, there are still limitations in efficacy and tolerability, and tumor recurrence and drug resistance problems are still prominent (Awad et al. N Engl J Med, 84:2382-2393). Therefore, it is particularly important to develop new and efficient KRAS mutant lung cancer treatment drugs and find new anti-KRAS mutant lung cancer targets.
[0003] Research on natural products in the treatment of KRAS mutant lung cancer has made some progress. For example, catechins and soy isoflavones have shown potential to inhibit the growth of KRAS mutant tumor cells (Niloy et al. Curr Med Chem. 28, 8098-8115). In particular, seco-lignans in the Piper genus of plants have good anti-NSCLC activity (Wu et al. J Nat Prod. 2006, 69: 790-794). Natural products as anticancer drug leads have the advantages of lower toxicity and novel targets, but there are still problems such as unknown targets and mechanisms, low bioavailability, and poor drugability. Therefore, it is a challenge to modify natural products to improve their efficacy and drugability, and to clarify their mechanisms and targets against KRAS mutant lung cancer.
[0004] MKRN2 (Makorin Ring Finger Protein 2) is a protein that promotes the degradation of proteins by ubiquitination. Studies have shown that MKRN2 expression in KRAS mutant NSCLC is closely related to lymph node metastasis, cancer differentiation, and prognosis. Regulating the expression of MKRN2 can inhibit the migration and invasion of tumor cells by down-regulating the PI3K / Akt pathway (Jiang et al. J Exp Clin Cancer Res. 2018, 37:189). Therefore, it is of great significance to find small molecule compounds targeting MKRN2 for the treatment of KRAS mutant lung cancer.
[0005] Molecular glue drugs are a class of small molecule compounds that mediate protein-protein interactions, which can change the protein recruitment of E3 ligase receptors, so that the target protein is ubiquitinated and degraded. Its characteristics are that it does not need to form a specific binding pocket on the target protein, and it is suitable for targets that are traditionally difficult to handle (Lemaitre et al. Expert Opin DrugDiscov. 2024;19:433-449). Molecular glue drugs have the advantages of smaller molecular weight, higher cell permeability, better oral absorption, etc. compared with traditional PROTAC drugs, and have broad application prospects, especially in cancer treatment (Roman et al. Science.2024; 386:eadl5361). Therefore, the development of new molecular glue small molecule anticancer drugs has very promising prospects. SUMMARY
[0006] In view of the deficiencies of the prior art, the purpose of the present application is to provide a natural seco-lignan derivative DhpB and its application.
[0007] In order to solve the problems of the prior art, the present application adopts the following technical solutions:
[0008] A natural seco-lignan derivative DhpB or a pharmaceutically acceptable salt thereof, the structural formula of the natural seco-lignan derivative DhpB is as follows:
[0009] The salt is hydrochloride or phosphate.
[0010] As an improvement, the preparation method of the natural seco-lignan derivative DhpB is as follows:
[0011] Step 1, synthesis of phenyl selenide intermediate
[0012] Under the protection of inert gas nitrogen, triethylamine is added to the Peperomin B in dichloromethane ice bath solution, after reaction, trimethylsilyl trifluoromethyl sulfonate is added, and after stirring at 0℃ for 30 minutes, continue to stir at room temperature for 30 minutes, continue to add dichloromethane solution of phenyl selenyl chloride to the mixture in 2 times, each reaction for 30 minutes, finally the reaction mixture is warmed to room temperature, and stirred for 1 hour, after the reaction is completed, saturated aqueous ammonium chloride solution is added to quench the reaction, extracted with ethyl acetate to obtain a crude oily product; purified by flash column chromatography to obtain a pale yellow oily phenyl selenide intermediate;
[0013] Step 2, oxidation of benzene selenyl group
[0014] The intermediate is dissolved in tetrahydrofuran, glacial acetic acid is added, and the mixture is reacted at 0°C for 10 minutes, then 30% hydrogen peroxide is added, and the mixture is reacted at 0°C for 40 minutes. A saturated sodium chloride solution is added to the mixture, and the mixture is extracted with ethyl acetate. The ethyl acetate extract is washed with a saturated sodium bicarbonate solution to obtain a crude crystalline product. The product is purified by flash column chromatography to obtain yellow crystals of DhpB.
[0015] Step 3, synthesis of DhpB
[0016] To a stirred solution of Dhp and triethylamine in methanol, 2-(methylamino)ethanol is added, and the reaction mixture is stirred at room temperature for 12 hours. After the reaction is completed, the reaction mixture is concentrated under reduced pressure to obtain a crude product. Water is added to the crude product, and the mixture is extracted with dichloromethane. The organic layer is dried over anhydrous sodium sulfate, and concentrated. The product is purified by column chromatography to obtain a yellow compound DhpB.
[0017] As an improvement, the molar ratio of trimethylsilyl trifluoromethanesulfonate to Peperomin B in step 1 is 1:10-1:20; the molar ratio of the first addition of phenyl selenium chloride to Peperomin B is 1:1-5; and the molar ratio of the second addition of phenyl selenium chloride to Peperomin B is 1:1-2.
[0018] As an improvement, the molar ratio of glacial acetic acid to the intermediate in step 2 is 1:2-1:10; and the molar ratio of hydrogen peroxide to the intermediate is 1:2-1:10.
[0019] As an improvement, the molar ratio of 2-(methylamino)ethanol to Dhp in step 3 is 1:1-1:2.
[0020] A pharmaceutical composition comprising the natural fissistilarin derivative DhpB described above or a pharmaceutically acceptable salt thereof.
[0021] As an improvement, the carrier of the pharmaceutical composition is an excipient, a filler, a binder, a lubricant, a disintegrant, an absorption enhancer, an adsorption carrier, or a surfactant.
[0022] As an improvement, the dosage form of the pharmaceutical composition is an injection, a tablet, a soft capsule, a pill, or a granule.
[0023] Use of the natural fissistilarin derivative DhpB described above or a pharmaceutically acceptable salt thereof or a pharmaceutical composition in the preparation of a medicament for treating KRAS mutant lung cancer.
[0024] As an improvement, the effective concentration of the natural fissistilarin derivative DhpB against lung cancer cells in vitro is 2.7-10 μM.
[0025] As an improvement, the effective dose of the natural seco-lignan derivative DhpB in KRAS mutant lung cancer model animals is 10 mg / kg.
[0026] As an improvement, the target of the drug is MKRN2.
[0027] As an improvement, the drug includes a drug that inhibits lung cancer cell proliferation, a drug that induces lung cancer cell apoptosis, a drug that covalently targets MKRN2 protein, a drug that promotes ubiquitination of small ribosomal protein RPS7, or a drug that causes ribosome stress in cells.
[0028] Advantages:
[0029] Compared with the prior art, the natural seco-lignan derivative DhpB and its application have the following advantages:
[0030] 1. The DhpB of the present application is a new structure of water-soluble medicinal seco-lignan derivative, which has increased water solubility by 1000 times compared with the original type; it is the first covalent inhibitor of ubiquitinase MKRN2, which promotes the degradation of RPS7 by increasing the binding of MKRN2 and small ribosomal protein RPS7, significantly inhibits the ribosome synthesis pathway highly expressed in KRAS mutant lung cancer cells, and is a new type of ribosome synthesis inhibitor, which is non-toxic to normal cells, especially lung epithelial cells.
[0031] 2. The DhpB of the present application can effectively inhibit the in situ proliferation of KRAS mutant lung cancer cells in the lung at a corresponding dose; induce apoptosis of KRAS mutant lung cancer cells, and has good medicinal prospects in the treatment of KRAS mutant lung cancer. BRIEF DESCRIPTION OF DRAWINGS
[0032] Figure 1 The synthetic route map of the natural seco-lignan derivative DhpB of the present application.
[0033] Figure 2 CCK8 method was used to detect the proliferation inhibition effect under different drug doses and draw the dose-effect curve, (a) is the IC 50 value of DhpB and its positive drug gemcitabine (GEM) on the proliferation of different non-small cell lung cancer cells, BEAS-2B is a normal cell strain, (b) is the proliferation inhibition curve of DhpB on different non-small cell lung cancer cells, BEAS-2B is a normal cell strain (n=5), (c) is the difference comparison of the proliferation inhibition curves of DhpB and Peperomin B without α-methylene-γ-butyrolactone group on H1299 non-small cell lung cancer cells.
[0034] Figure 3Representative figures of Dhp B inhibiting the proliferation of KRAS mutant lung adenocarcinoma 3D cell spheres, wherein (a) is the cell state at day 1 and day 5 under different dosing concentrations, (b) is the 3D cell sphere size change curve from day 1 to day 5, (c) is the expression level of the proliferation level marker Ki-67 of 3D cell spheres under different dosing concentrations and the Ki-67 expression level, and (d) is the column chart of the expression level of the proliferation level marker Ki-67 of 3D cell spheres under different dosing concentrations and the Ki-67 expression level with concentration change (n=5). The results are expressed as Mean ± SD; statistical t test was used; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001.
[0035] Figure 4 (a) in FIG. 5 is a representative flow cytogram and column chart of apoptosis rate of 5 lung adenocarcinoma cells and normal lung epithelial cells under the influence of 5 μM Dhp B.
[0036] Figure 4 (b) in FIG. 6 is a representative flow cytogram and column chart of apoptosis rate of sensitive lung cancer cell H1299 under the influence of different concentrations of Dhp B. The experimental results are expressed as Mean ± SD, and statistical t test was used; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001 (n=3, gemcitabine (GEM) is a positive control drug).
[0037] Figure 5 (a) in FIG. 7 is a representative flow cytogram and column chart representing the proportion of cell cycle under the influence of 5 μM Dhp B on 5 KRAS mutant lung adenocarcinoma cells.
[0038] Figure 5 (b) in FIG. 8 is a representative flow cytogram and column chart of apoptosis rate of sensitive lung cancer cell H1299 under the influence of different concentrations of Dhp B. The above effect evaluation experiment n=3, and the experimental results are expressed as Mean ± SD, and statistical t test was used; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001.
[0039] Figure 6Figure 9. HE staining and tumor area of LLC lung adenocarcinoma mouse lung tumor after treatment of each administration group (normal saline, Dhp B 50 mg / kg group and gemcitabine (GEM) 10 mg / kg group), and representative images of Ki67 (green) and TUNEL (red) fluorescence immunohistochemistry of lung tumor after administration treatment and the expression level of tumor sections, and the fluorescence ratio was calculated after DAPI (blue) was used for cell nucleus staining. The experimental results were expressed as Median ± IQR or Mean ± SD, and t test was used for statistical analysis; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001 (n=3, gemcitabine (GEM) was a positive control drug).
[0040] Figure 7 Figure 10. Kaplan-Meier curve of the effect of different administration groups (normal saline, Dhp B 50 mg / kg group and gemcitabine (GEM) 10 mg / kg group) on the survival of model mice (n=10). The results were expressed as Mean ± SD; t test was used for statistical analysis; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001.
[0041] Figure 8 Figure 11. (a) Western Blot verification results of stably transfected sh-MKRN2 plasmid H1299 cells (left), and CCK8 inhibition rate statistical column chart of different administration treatment methods after MKRN2 knockdown cell strain (Dhp B: 5 mM; mean ± SD, n=5; right), (b) apoptosis chart and apoptosis rate results statistics of MKRN2 knockdown cell strain treated by Dhp B (Dhp B: 5 mM; mean ± SD, n=3; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001, middle); (c) Sanger sequencing verified MKRN2 WT and MKRN2 C335S mutation successful gene sequence, the mutation site is shown by a red line in the figure (left); (d-e) Dhp B treatment overexpressed MKRN2 cell proliferation and apoptosis results and statistical chart (Dhp B: 5 mM; mean ± SD, n=3; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001, lower right).
[0042] Figure 9 is the immunoprecipitation (CoIP)-MS identified proteins that significantly bind to MKRN2 in different drug treatment groups, (A) is the control group identified proteins that interact with MKRN2; (B) is the Dhp B group identified proteins that interact with MKRN2; (C) is the control group identified proteins that interact with MKRN2-C335S; (D) is the Dhp B group identified proteins that interact with MKRN2-C335S. The proteins in the fourth quadrant of the cross gate are significantly enriched with P < 0.05, log2 fold change > 2. DETAILED DESCRIPTION
[0043] The application will be further described in conjunction with the following examples, which are not intended to limit the scope of the application. Unless otherwise indicated, the reagents, methods, and equipment employed in the present application are of conventional type used in the art. The following examples are not intended to be specific experimental conditions or procedures, which are generally in accordance with conventional experimental conditions or as suggested by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the present application are commercially available.
[0044] Example 1 Preparation of compound DhpB
[0045] Step 1, synthesis of phenyl selenide intermediate
[0046] Under the protection of inert gas nitrogen, triethylamine (7.2 mL) was added to a solution of Peperomin B (1.392 g, 0.054 mmol) in dichloromethane (24 mL) in an ice bath (0 °C), and after 10 minutes of reaction, trimethylsilyl trifluoromethanesulfonate (9 mL, 0.65 mmol) was added. The mixture was stirred at 0 °C for 30 minutes, and then continued to stir at room temperature for 30 minutes. Then, a dichloromethane solution of phenyl selenyl chloride (1.866 g, 0.162 mmol and 936 mg, 0.081 mmol) was added to the mixture in two portions, each for 30 minutes of reaction. The reaction mixture was warmed to room temperature and stirred for 1 hour. After the reaction was completed, saturated aqueous ammonium chloride solution was added to quench the reaction. Extraction with ethyl acetate (3 x 50 mL) gave a crude oily product. Purification by flash column chromatography (silica gel 200-300 mesh, column 1.5 cm i.d., petroleum ether: ethyl acetate 3:1) gave a pale yellow oily phenyl selenide intermediate (458 mg).
[0047] The nuclear magnetic resonance spectrum of the pale yellow oily phenyl selenide intermediate was consistent with the literature report (Tsutsui et al. Bioorg Medi Chem Lett 2009, 15:4084-87).
[0048] Step 2, oxidative deselenylation
[0049] The intermediate (458 mg, 0.0167 mmol) was dissolved in tetrahydrofuran (10.2 mL) and glacial acetic acid (180 μL, 0.045 mmol) was added. After 10 minutes of reaction at 0 °C, 30% hydrogen peroxide (450 μL, 0.067 mmol) was added and the reaction was continued at 0 °C for 40 minutes. To the mixture, saturated sodium chloride solution (60 mL) was added and extracted with ethyl acetate (3 x 50 mL). The ethyl acetate extract was finally washed with saturated sodium bicarbonate solution (2 x 50 mL) to obtain the crude crystalline product. Purification by flash column chromatography (silica gel 200-300 mesh, column 1.5 cm i.d., petroleum ether: ethyl acetate 3:1) gave yellow crystals of Dhp (408.27 mg).
[0050] The nuclear magnetic resonance spectrum of the yellow crystals of Dhp was consistent with the literature report (Tsutsui et al. Bioorg Medi Chem Lett 2009, 15:4084-87).
[0051] Step 3, synthesis of DhpB
[0052] To a stirred solution of Dhp (856 mg, 0.2 mmol) and triethylamine (0.6 mmol) in methanol (4 mL), 2-(methylamino)ethanol (240 μL, 0.3 mmol) was added. The reaction mixture was stirred at room temperature for 12 hours. After completion of the reaction (monitored by thin layer chromatography), the reaction mixture was concentrated under reduced pressure to obtain the crude product. To the crude product, 10 mL of water was added and extracted with dichloromethane (2 x 10 mL). The organic layer was dried over anhydrous sodium sulfate and concentrated, which was purified by column chromatography (n-hexane: ethyl acetate 3:1 to 1:1) to obtain yellow compound DhpB (761 mg). The purity of the compound was determined by high performance liquid chromatography analysis and the purity was found to be 95%.
[0053] NMR data of DhpB
[0054] 1H NMR (CDCl3, 500 MHz): δ 2.29 (m, 1H), 2.24 (t, J = 9.5 Hz, 2H),2.03 (s, 3H), 2.46–2.49 (m, 1H), 2.62 (m, 1H), 3.58 (m, 2H), 3.70 (d, J =11.5 Hz, 1H), 3.78 (d, J = 11.5, 7.8, 4.6 Hz, 1H), 3.81 (s, 3H), 3.84 (s,6H), 3.91 (s, 3H), 4.01 (dd, J = 9.5, 4.6 Hz, 1H), 4.34 (dd, J = 9.5, 7.8 Hz,1H), 5.94–5.96 (m, 2H), 6.41 (br s, 1H), 6.44 (br s, 2H), 6.47 (br s, 1H).
[0055] 13 C NMR (CDCl3, 125 MHz): δ 41.4, 42.6, 47.2, 55.6, 56.3, 57.0, 59.2,59.5, 60.9, 63.3, 69.7, 101.2, 101.5, 105.2, 108.2, 134.4, 136.0, 136.9,137.3, 143.7, 149.5, 153.4, 170.7.。
[0056] Example 2 Inhibitory effect of DhpB on the proliferation of KRAS mutant lung cancer cells and normal lung epithelial cells
[0057] (1) CCK-8 experimental method
[0058] Logarithmic growth period KRAS mutant lung adenocarcinoma cells (H1299, H23, H1650, H1975, A549) and normal lung epithelial cells (BEAS-2B) were taken, wherein the mutant lung adenocarcinoma cells (H1299, H23, H1650, H1975, A549) and normal lung epithelial cells (BEAS-2B) were from Wuhan Punsai Life Science and Technology Co., Ltd.
[0059] Resuspend the cells with the culture medium and count with a cell counting plate, dilute to 1×10 5The cells were seeded in 96-well plates at 1000 cells / mL, 100 μL per well. Blank group (DMSO), experimental group (DhpB, Peperomin B, referred to as PepB) and positive drug group (GEM) were set up, 5 replicates per group. The experimental group was added with DhpB and PepB (prototype) at final concentrations of 0.5, 1, 2, 4, 8, 16, 32, 64 μM and gemcitabine (GEM) at final concentrations of 0.0625, 0.125, 0.25, 0.5, 1, 2, 4, 8 μM respectively. The blank group and the control group were added with the same volume of DMSO, and incubated at 37°C for 48 hours. 10 μL CCK-8 solution and 100 μL basic medium were added to each well, and incubated at 37°C for 1-4 hours. The absorbance (OD value) of each well was measured at 450 nm using a microplate reader, the survival rate was calculated, and the IC50 value was obtained. That is, the half-inhibitory concentration (IC50) of DhpB on KRAS mutant lung adenocarcinoma cells and normal lung epithelial cells was calculated, and the difference in anticancer activity between DhpB and its prototype PepB was compared (n=5). The results were expressed as Mean ± SD; t test was used for statistics; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001.
[0060] The composition of the basic medium used during the experiment was 90% RPMI-1640 + 10% fetal bovine serum + 1% penicillin G-streptomycin double antibody.
[0061] IC of DhpB on the proliferation of KRAS mutant lung adenocarcinoma cells 50 Values are shown in Table 1. Figure 2 DhpB significantly reduced the proliferation ability of 5 lung adenocarcinoma cell lines in the concentration range of 0.5-64 μM, among which H1299 cells were the most sensitive. There was no obvious cytotoxicity to normal lung epithelial cells BEAS-2B, and it had lower toxic side effects compared with gemcitabine.
[0062] (2) 3D cell proliferation model experimental method
[0063] Logarithmic growth phase H1299 cells were resuspended with culture medium and counted, diluted to 2x10^5 cells / mL, 100 μL per well was inoculated in 3D culture special 96-well U-shaped plate, and cultured until the cells formed balls. Take a flat-bottom 6-well plate, add 6 drops of 75 μL Collagen Mix I to each well, and place it at 37°C for 30 minutes to solidify. Select the cell balls in the 96-well U-shaped plate that are round and uniform, and use a large-diameter gun head to suck them out and plant them on the Collagen Mix I gel, and culture for 15-30 minutes to make the cells adhere. Add 75 μL of Collagen Mix II, and place it at 37°C for 30 minutes to solidify. Add 2 mL of culture medium containing 10% FBS to each well. Treat the control group (no drug) and the DhpB drug group (2.5, 5, 10 μM) respectively. Microscopically observe the cell balls within 5 days, measure the area changes by Image J software, and perform ki67 immunofluorescence staining.
[0064] 3D cell proliferation experiment results:
[0065] DhpB can significantly inhibit the proliferation of 3D lung adenocarcinoma cell balls (see Figure 3 ). Within 5 days, the area of the cell balls in the control group increased significantly, while the area of the cell balls in the drug group was significantly inhibited to varying degrees.
[0066] Example 3 DHPB induces apoptosis of KRAS mutant lung cancer cells
[0067] Experimental method
[0068] Five strains of KRAS mutant lung adenocarcinoma cells in logarithmic growth phase were counted and the cell density was adjusted using a cell counter, 2 mL per well, 2x10 5 cells were inoculated in a 6-well plate, and placed in an incubator for 24 hours before drug treatment. Collect cells treated with different drugs, centrifuge at 1000 rpm and 4°C for 5 minutes, and discard the supernatant. Resuspend the cells by adding ice PBS, centrifuge at 1000 rpm and 4°C for 5 minutes, and discard the supernatant. Take 100 μL of cell suspension, add 5 μL of Annexin V-FITC and 10 μL of PI, mix well, and incubate at room temperature for 20 minutes. After staining, add 400 μL of PBS, pass through a 300-micron cell sieve, and load into a flow tube. Use a flow cytometer for detection, and analyze the data using FlowJo software.
[0069] Experimental results
[0070] As Figure 4As shown, under the treatment of the control group, the DhpB group (5 μM), and the gemcitabine group (2.5 μM), the apoptosis condition shows that DhpB and gemcitabine can significantly increase the apoptosis rate of various lung adenocarcinoma cells, and there is a significant difference compared with the control group (P < 0.001, P < 0.05). Among them, the induction of apoptosis of DhpB on H1299 cells is the most obvious. Further set different concentrations of DhpB treatment group (2.5, 5, 10 μM), and observe its effect on cell apoptosis. The results show that DhpB can induce H1299 cells to undergo apoptosis in a dose-dependent manner, and the apoptosis rate increases significantly with the increase of concentration.
[0071] Example 4 DhpB induces cycle arrest of lung cancer cells
[0072] Experimental method
[0073] Take the H1299, H23, H1650, H1975, A549 cells in the logarithmic growth phase, inoculate in a 6-well plate, 1×10 5 6 / mL, 2 mL per well. Add DhpB with a final concentration of 5 μM and gemcitabine with a final concentration of 2.5 μM, and the same volume of DMSO (the final concentration is controlled below 0.1% (v / v)), and centrifuge the cells after treating the cells for 48 hours. Wash with ice PBS for 2 times, add 1 mL of 70% ethanol, and fix at 4°C overnight. The next day, centrifuge the cells, add 0.5 mL of staining buffer, 10 μL of PI and 10 μL of RNase A, resuspend the cells, and incubate at 37°C for 30 minutes in the dark. Filter using a 300 mesh cell screen, and set the flow cytometry parameters according to the literature method for detection.
[0074] Experimental results
[0075] As Figure 5 shown, DhpB at a concentration of 5 μM can significantly block the cell cycle of five strains of lung adenocarcinoma cells at the G2 phase (P < 0.001, P < 0.05), and the cycle arrest effect of DhpB on H1299 cells is the most obvious. Further set different concentrations of DhpB treatment group (2.5, 5, 10 μM), and the results show that DhpB can induce H1299 cells to undergo apoptosis and block the cycle at the G2 phase in a dose-dependent manner.
[0076] Example 5 Evaluation of the in vivo anti-KRAS mutant lung cancer cell proliferation activity of DhpB
[0077] Experimental method
[0078] LLC cells in logarithmic growth phase were collected and washed with ice PBS for 3 times. The cell density was adjusted to 1×10 7 After one week of tail vein modeling, C57 mice were randomly divided into 3 groups: model group, DhpB group and gemcitabine group, 10 mice in each group, free drinking water and diet. The dosages of DhpB group and gemcitabine group were 50 mg / kg and 10 mg / kg respectively, and the model group was given the same volume of normal saline. The drug was given once every two days, and the drug cycle was 2 weeks. After one month, the mice were sacrificed by cervical dislocation, and the liver and lung tissues were taken, photographed and paraffin-embedded, sectioned, HE stained and immunofluorescence double-stained with Ki67 and TUNEL to observe cell proliferation and apoptosis. 6 After one week of tail vein modeling, C57 mice were randomly divided into 3 groups: model group, DhpB group and gemcitabine group, 10 mice in each group, free drinking water and diet. The dosages of DhpB group and gemcitabine group were 50 mg / kg and 10 mg / kg respectively, and the model group was given the same volume of normal saline. The drug was given once every two days, and the drug cycle was 2 weeks. After one month, the mice were sacrificed by cervical dislocation, and the liver and lung tissues were taken, photographed and paraffin-embedded, sectioned, HE stained and immunofluorescence double-stained with Ki67 and TUNEL to observe cell proliferation and apoptosis.
[0079] Experimental results
[0080] As shown in Figure 6, the lung tumor area of DhpB group mice was significantly lower than that of model group (P < 0.001, P < 0.05). The results of Ki67 and TUNEL immunofluorescence double staining of tumor sections of different treatment groups showed that the ratio of Ki67 / DAPI in tumor sections of DhpB group and GEM group mice was significantly lower than that of model group, indicating that both drugs could effectively inhibit cell proliferation; and the ratio of TUNEL / DAPI was significantly higher than that of model group, indicating that both drugs could effectively induce cell apoptosis.
[0081] Example 6: Study on the effect of DhpB on the survival period of lung cancer model mice
[0082] Experimental method
[0083] After one week of tail vein modeling, C57 mice were randomly divided into 3 groups: model group, DhpB group and gemcitabine group, 10 mice in each group, free drinking water and diet. The dosages of DhpB group and gemcitabine group were 50 mg / kg and 10 mg / kg respectively, and the model group was given the same volume of normal saline. The drug was given once every two days, and the drug cycle was 2 weeks. After one month, the mice were sacrificed by cervical dislocation, and the liver and lung tissues were taken, photographed and paraffin-embedded, sectioned, HE stained and immunofluorescence double-stained with Ki67 and TUNEL to observe cell proliferation and apoptosis.
[0084] Experimental results
[0085] According to the Kaplan-Meier plot of mouse survival (see Figure 7), both the DhpB group and the gemcitabine group significantly improved the median pain-free survival time of model mice compared with the model group (P=0.0059), indicating that DhpB can improve the quality of life of mice.
[0086] Example 7: In vivo and in vitro validation study of DhpB's MKRN2 target
[0087] Experimental methods:
[0088] Using short hairpin RNA (shRNA) encoding MKRN2,
[0089] Target sequence-F: TGGGTGGAAGATCAGAATAAA,
[0090] H1299 cells were transduced with lentiviral vectors containing the target sequence (R: GGCACTGTGAGGTTCTTTAAT) or a non-target control. Lentiviral vectors were prepared by co-transfecting shRNA and packaging plasmids into 293T cells using Lipofectamine 6000. Transduced cells were selected with puromycin (1 μg / mL) for 3 days, and MKRN2 expression was verified by Western blotting. MKRN2 was generated through site-directed mutagenesis using the QuickMutation Plus site-directed mutagenesis kit and wild-type MKRN2 plasmid as a template. C335S Mutant plasmids. MKRN2 and its C335S mutant were re-expressed in H1299 cells with knocked-down MKRN2. Full-length human MKRN2 or MKRN2-24 ... C335S Lentiviral vectors fused with the puromycin resistance gene were transduced into cells. Lentiviral vectors were produced and transduced, and cells re-expressing the gene were selected for 3 days with puromycin (1 μg / mL). After constructing overexpression and knockdown cell lines, cell proliferation and apoptosis effects were evaluated by treatment with Dhp B (5 μM).
[0091] Experimental results:
[0092] like Figure 8As shown, knockdown of MKRN2 significantly promoted the proliferation of KRAS mutant human cell H1299, and the proliferation inhibitory effect of DhpB on the knockdown strain was significantly lower than that of the blank control group. After knockdown of MKRN2, the proliferation level of normal BEAS-2B lung adenocarcinoma cells was significantly increased, and the proliferation inhibitory effect of DhpB on the corresponding knockdown strain was significantly lower than that of the blank control group. After knockdown of MKRN2, the pro-apoptotic effect of DhpB on H1299 knockdown strain was significantly lower than that of the blank control group; after knockdown of MKRN2 in normal BEAS-2B lung adenocarcinoma cells, the pro-apoptotic effect of DhpB was also significantly reduced. Overexpression of MKRN2 WT in H1299 tumor cells can significantly inhibit the proliferation activity of the cells. After DhpB treatment, compared with the blank control Vector group, the overexpression of MKRN2 WT group significantly enhanced the proliferation inhibitory activity of DhpB, while the overexpression of MKRN2 C335S group did not show the corresponding enhancement of proliferation inhibitory activity. From the results of cell apoptosis, overexpression of MKRN2 WT significantly promoted the apoptosis of H1299 tumor cells. After DhpB treatment, the overexpression of MKRN2 WT group significantly enhanced the pro-apoptotic activity of DhpB compared with the blank control Vector group, while the overexpression of MKRN2 C335S group did not show the corresponding pro-apoptotic effect. In summary, MKRN2 is the main target of DhpB against KRAS mutant lung cancer, and the binding site is C335.
[0093] Example 8 DhpB is the molecular glue of MKRN2 and RPS7 protein in cells
[0094] Point mutation was performed on p3XFLAG-CMV-14-MKRN2 plasmid and verified. p3XFLAG-CMV-14-MKRN2 (MKRN2 sequence: NCBI Reference Sequence: NM_001271707.2) or p3XFLAG-CMV-14-MKRN2-C335S (mutation site verification see (c) in FIG. 8) plasmid was co-transfected into 293T cells, and the corresponding drug treatment (DMSO or DhpB 5 μM) was performed. After 48 hours, the culture solution was aspirated, washed with PBS, and then the inhibitor-containing lysis solution was added. After lysis, 12000 x g, 4°C centrifugation for 20 minutes, the supernatant was taken. Prepare FLAG antibody magnetic beads, and add different groups of protein lysis solution [including 3xFLAG MKRN2 WT (DMSO or DhpB), 3xFLAG MKRN2 C335S(DMSO or DhpB) group] overnight at 4°C. Magnetic stand separation and washing 3 times, finally eluted with acidic elution buffer and neutralized the Flag-tagged protein and its associated proteins. Mass spectrometry pretreatment includes DTT reduction, IAA alkylation, methanol and chloroform lysis, urea buffer enzymolysis and desalination. Samples were analyzed by LC-MS / MS on Resprosil C18 AQ column, electron energy 2.5 kV, mass spectrometry primary full scan range m / z 300-2000. Tandem mass spectrometry analysis obtained total ion chromatogram (TIC), a series of MS / MS graphs were generated by collision-induced dissociation (CID), data analysis was performed using MaxQuant, and subsequent data analysis and visualization of quantitative results were performed using Perseus software.
[0095] The results of the treatment are shown in Figure 9 As shown in FIG. 6, by LC-MS / MS analysis of the proteins pulled down by FLAG antibody Co-IP, the results showed that, compared with the empty plasmid group, after 10 mM DhpB treatment in the MKRN2 WT group, RPS7 ribosome-associated proteins were significantly enriched (P<0.05, log2fold change>2). After DhpB treatment in the MKRN2 C335S group, this protein could not be enriched. This indicates that in cancer cells, DhpB promotes the binding between MKRN2 and RPS7, acting as a molecular glue.
Claims
1. A natural lecithin derivative DhpB or a pharmaceutically acceptable salt thereof, characterized in that, The structural formula of the natural clethodimide derivative DhpB is shown below: The salt is a hydrochloride or a phosphate.
2. A method for preparing a natural schreibernan derivative DhpB or a pharmaceutically acceptable salt thereof according to claim 1, comprising the following steps: Step 1: Synthesis of phenyl selenide intermediate Under the protection of inert nitrogen, triethylamine was added to a solution of Peperomin B in dichloromethane in an ice bath. After the reaction, trimethylsilyl trifluoromethanesulfonate was added, and the mixture was stirred at 0°C for 30 minutes, followed by stirring at room temperature for another 30 minutes. A solution of benzeneselenide chloride in dichloromethane was then added to the mixture in two portions, reacting for 30 minutes each time. Finally, the reaction mixture was heated to room temperature and stirred for 1 hour. After the reaction was complete, a saturated ammonium chloride aqueous solution was added to quench the reaction. The mixture was extracted with ethyl acetate to obtain a crude oily product. Purification by rapid column chromatography yielded a pale yellow oily phenylselenide intermediate. ; Step 2, Oxidation to remove phenyl selenyl groups The phenyl selenide intermediate was dissolved in tetrahydrofuran, and then glacial acetic acid was added. The mixture was reacted at 0°C for 10 minutes, followed by the addition of 30% hydrogen peroxide. The reaction was continued at 0°C for another 40 minutes. A saturated sodium chloride solution was added to the mixture, and the mixture was extracted with ethyl acetate. Finally, the ethyl acetate extract was washed with a saturated sodium bicarbonate solution to obtain a crude crystalline product. This product was purified by rapid column chromatography to obtain yellow crystals, Dhp. ; Step 3, Synthesize DhpB 2-(methylamino)ethanol was added to a stirred methanol solution of Dhp and triethylamine. The reaction mixture was stirred at room temperature for 12 hours. After the reaction was completed, the reaction mixture was concentrated under reduced pressure to obtain a crude product. Water was added to the crude product and it was extracted with dichloromethane. The organic layer was dried with anhydrous sodium sulfate, concentrated, and purified by column chromatography to obtain the yellow compound DhpB.
3. A pharmaceutical composition, characterized in that, It includes the natural clematin derivative DhpB as described in claim 1, or a pharmaceutically acceptable salt thereof.
4. The pharmaceutical composition according to claim 3, characterized in that, The carrier of the pharmaceutical composition is an excipient, filler, binder, lubricant, disintegrant, absorption enhancer, adsorbent carrier, or surfactant; the dosage form of the pharmaceutical composition is an injection, tablet, soft capsule, pill, or granule.
5. The use of the natural lecithin derivative DhpB of claim 1 or a pharmaceutically acceptable salt thereof or the pharmaceutical composition of claim 4 in the preparation of a drug for treating KRAS-mutant lung cancer.
6. The application according to claim 5, characterized in that, The effective concentration of the natural lignan derivative DhpB against lung cancer cells in vitro is 2.7-10 μM.
7. The application according to claim 5, characterized in that, The effective dose of the natural clethodim derivative DhpB in a KRAS-mutant lung cancer model animal was 10 mg / kg.
8. The application according to claim 5, characterized in that, The drug targets MKRN2.
9. The application according to claim 5, characterized in that, The drugs include those that inhibit lung cancer cell proliferation, induce lung cancer cell apoptosis, covalently target MKRN2 protein, promote the ubiquitination of small ribosomal protein RPS7, or cause ribosomal stress in cells.
Citation Information
Patent Citations
Semisynthesis method of antineoplastic activity natural product peperomin E
CN103965177A
Alpha -methylene peperomins and halogenated derivatives thereof
US5981577A