Respiratory syncytial virus antigenic polypeptides, nucleic acids and vaccines

Abstract

The invention provides a respiratory syncytial virus antigenic polypeptide, nucleic acid and a vaccine. Compared with the respiratory syncytial virus wild type Pre-F protein, the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide has the following changes: the 104th to 144th regions of the Pre-F protein are replaced with GS linker; two groups of disulfide bonds are introduced into S155C, S290C, A149C and Y458C; the S190F and the V207L are used for realizing cavity filling; and P102A, L373R, I379V, M447V, P102A, L373R, the C terminal of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof comprises a cytoplasm tail region fragment, and the cytoplasm tail region fragment is a fragment derived from 3-10 continuous amino acid residues of a PreF protein cytoplasm tail region. According to the present invention, the pre-F immunogenicity and / or stability can be improved, and the protein expression level can be easily improved.

Description

Technical Field

[0001] The present invention relates to a respiratory syncytial virus antigenic polypeptide, nucleic acid and vaccine, and their related applications. Background Art

[0002] Respiratory syncytial virus (RSV) is a single-stranded negative-sense RNA virus that encodes 11 proteins. Based on the antigenic drift of the G protein, RSV can be divided into two subtypes, A and B. The F protein sequence of RSV is relatively conservative, but changes in splicing and fusion conformation occur during the infection of host cells.

[0003] Human respiratory syncytial virus (hRSV) can cause diseases including the upper respiratory tract, trachea, bronchi, bronchioles, alveoli, pleura and pleural cavity, as well as the nerves and muscles of breathing. RSV can be spread by respiratory droplets or infected pollutants, and can be transmitted to the lower respiratory tract through the nasopharynx or upper respiratory tract mucosa to induce severe infection (low respiratory tract infection, LRTI). RSV infection will first cause cold-like symptoms, such as runny nose, loss of appetite, cough, sneezing, fever, wheezing, infection, and these symptoms usually occur in stages.

[0004] RSV is the most common cause of bronchiolitis and pneumonia in children under 1 year old. A minority of infants infected with RSV may experience symptoms such as irritability, decreased activity, and difficulty breathing. If a more serious infection develops, it can develop into bronchiolitis, inflammation of the small airways in the lungs, pneumonia, and lung infection. Symptoms are more severe and may even lead to death in people with weakened immune systems, the elderly, and those with lung disease and heart failure. RSV-infected people may experience difficulty breathing or dehydration, and in severe cases may require additional oxygen or intubation and mechanical ventilation. If the condition continues to worsen, chronic obstructive pulmonary disease (COPD) will occur, as well as serious complications of the respiratory and other systems, including pneumonia, apnea, respiratory failure, heart failure, etc., which can develop into a serious and fatal disease within a year.

[0005] The most important reason why there has been no RSV vaccine product on the market for decades is the lack of effective antigen design. Long-term work results show that the RSV surface F glycoprotein is the most conservative among different strains and induces higher neutralizing antibody titers. In 2013, the National Institutes of Health (NIH) of the United States showed that the metastable F protein has conformational changes before and after fusion, and the most important thing is the site with the highest antibody affinity. and site V only exist in the metastable conformation before the fusion of F protein (pre-F). The NIH research team achieved the purpose of stabilizing pre-F by introducing cysteine ​​at positions 155 and 290 to form disulfide bonds. In addition, the replacement of long-chain hydrophobic amino acids at the antibody binding position can also achieve the purpose of stability. The team finally obtained the excellent pre-F antigen, Ds-CaV1, through a combination of replacements at multiple positions. In 2016, the NIH team continued to optimize the structure and sequence on the existing basis, introducing GS linker at positions 104-144 to eliminate the allosteric effects of pep27 and fusion peptides, and introducing cysteine ​​at positions 149 and 458 to achieve the stability of the F protein trimer, thereby further improving the immunogenicity of the antigen. The clinical results of protein vaccines based on these mutations show a good protection rate, but judging from the data, there is still a lot of room for improvement. The application of mRNA technology is likely to improve the immunogenicity of antigens at the technical level.

[0006] CN10847235A discloses RSV antigenic polypeptides. Based on the NIH work (GS linker + two groups of cysteine ​​+ two cavity fillings), the transmembrane region is retained, and the secretory protein is transformed into a membrane protein, which obtains better clinical results, indicating that the C-terminus of the transmembrane protein and the F protein helps to improve the immunogenicity of the antigen. In addition, the clinical results also show the high immunogenicity characteristics unique to mRNA technology.

[0007] The results of many years of research have shown that it is difficult to identify new mutation sites that can maintain pre-F, making it difficult to achieve an increase in the titer of pre-F neutralizing antibodies from an antigenic perspective. Summary of the invention

[0008] One object of the present invention is to provide a respiratory syncytial virus (RSV) antigenic polypeptide that can achieve improved pre-F immunogenicity, improved stability, and / or help improve protein expression levels.

[0009] Another object of the present invention is to provide the respiratory syncytial virus antigenic nucleic acid.

[0010] Another object of the present invention is to provide the application of the respiratory syncytial virus antigenic polypeptide.

[0011] Another object of the present invention is to provide an application of the respiratory syncytial virus antigenic nucleic acid.

[0012] Another object of the present invention is to provide a respiratory syncytial virus vaccine.

[0013] Another object of the present invention is to provide the application of the respiratory syncytial virus vaccine.

[0014] In one aspect, the present invention provides a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof, which has the following amino acid site changes compared to the wild-type Pre-F protein of respiratory syncytial virus:

[0015] The 104-144 region of the Pre-F protein was replaced with a GS linker; S155C, S290C, A149C, and Y458C introduced two sets of disulfide bonds; S190F and V207L ​​achieved cavity filling; and P102A, L373R, I379V, and M447V;

[0016] Furthermore, the C-terminus of the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment comprises a cytoplasmic tail region fragment, and the cytoplasmic tail region fragment is a fragment of 3-10 consecutive amino acid residues derived from the cytoplasmic tail region of the Pre-F protein.

[0017] According to a specific embodiment of the present invention, the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention has at least one of the following modifications compared to the respiratory syncytial virus Pre-F protein:

[0018] Cavity filling of V296F; and / or

[0019] One or more mutations among S46G, E92D, K465Q.

[0020] According to a specific embodiment of the present invention, the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention, wherein the cytoplasmic tail region fragment is a fragment of continuous 4-6 amino acid residues derived from the cytoplasmic tail region of the Pre-F protein.

[0021] According to a specific embodiment of the present invention, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention, the cytoplasmic tail region fragment is CKARS.

[0022] According to a specific embodiment of the present invention, the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide of the present invention refers to a fragment of a partial amino acid sequence derived from the respiratory syncytial virus antigenic polypeptide and capable of causing an immune response to RSV. That is, the immunogenic fragment has a truncated amino acid sequence compared to the respiratory syncytial virus antigenic polypeptide of the present invention. Preferably, the immunogenic fragment has the same mutation site as the respiratory syncytial virus antigenic polypeptide of the present invention.

[0023] According to a specific embodiment of the present invention, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention, the equivalent function includes promoting the improvement of pre-F immunogenicity, the improvement of stability and / or the improvement of pre-F protein expression level compared to wild-type pre-F.

[0024] According to a specific embodiment of the present invention, the respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof of the present invention has at least the 26th to 515th amino acid sequence or the full-length amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or a derivative amino acid sequence with equivalent function formed by replacing, deleting or adding one or several amino acids on the basis of these amino acid sequences.

[0025] In the present invention, positions 1-21, 1-22, 1-23, 1-24 or 1-25 of the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 are generally considered as signal peptides. Positions 471-510 of the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 are generally considered as transmembrane regions.

[0026] On the other hand, the present invention also provides a nucleic acid encoding the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment described in the present invention.

[0027] According to some specific embodiments of the present invention, the nucleic acid of the present invention is DNA or RNA. The RNA may be mRNA or self-replicating RNA.

[0028] According to some specific embodiments of the present invention, the sequence of the nucleic acid encoding the respiratory syncytial virus antigenic polypeptide of the present invention is shown in any one of SEQ ID No.6-SEQ ID No.17.

[0029] According to some specific embodiments of the present invention, the sequence of the nucleic acid encoding the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide is a fragment of the sequence shown in any one of SEQ ID No. 6 to SEQ ID No. 17. That is, the nucleic acid encoding the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide has a truncated nucleotide sequence compared to the nucleic acid encoding the respiratory syncytial virus antigenic polypeptide of the present invention.

[0030] On the other hand, the present invention also provides the use of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof or the nucleic acid in the preparation of a respiratory syncytial virus vaccine.

[0031] On the other hand, the present invention also provides a respiratory syncytial virus vaccine, comprising:

[0032] at least one mRNA having an open reading frame encoding a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof according to the present invention, and

[0033] A pharmaceutically acceptable carrier.

[0034] According to some specific embodiments of the present invention, the respiratory syncytial virus vaccine of the present invention has one or more of the following characteristics:

[0035] The open reading frame is codon optimized; preferably, the codon optimization is as shown in SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, SEQ ID No.15, SEQ ID No.16 or SEQ ID No.17;

[0036] The open reading frame also has a sequence encoding a signal peptide connected to the RSV antigenic polypeptide or an immunogenic fragment thereof; preferably, the amino acid sequence of the signal peptide is as shown in positions 1-21, 1-22, 1-23, 1-24 or 1-25 of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3;

[0037] The at least one mRNA comprises at least one chemical modification; preferably, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyluridine; preferably, at least 80%, at least 90% or 100% of the uracils in the open reading frame have a chemical modification;

[0038] The at least one mRNA comprises at least one 5′ end cap structure; preferably, the 5′ end cap structure is Cap2-6 (see formula I for structure):

[0039]

[0040] The at least one mRNA comprises a 5'UTR; preferably, the sequence of the 5'UTR is: GGAGATAA GAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCCACC, SEQ ID No.20;

[0041] The at least one mRNA comprises a 3'UTR; preferably, the sequence of the 3'UTR is: GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTC CCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG, SEQ ID No.21;

[0042] The at least one mRNA comprises a 3′ polyA tail; preferably, the sequence of the 3′ polyA tail is AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA, SEQ ID No. 22;

[0043] The vaccine is in the form of nanoparticles; preferably, the nanoparticles have an average diameter of 50 nm to 200 nm; preferably, the nanoparticles are lipid nanoparticles; preferably, the lipid nanoparticles contain cationic lipids, PEG-modified lipids, sterols and non-cationic lipids; preferably, the cationic lipids are ionizable cationic lipids, the non-cationic lipids are neutral lipids, and the sterols are cholesterol.

[0044] The experiments of the present invention show that the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment of the present invention and the nucleic acid encoding the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment of the present invention having the mutation site can improve the immunogenicity and / or stability of pre-F, and / or help improve the protein expression level. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Schematic diagram of the antigen structure of the present invention.

[0046] Figure 2 The quantitative results of RSV F protein expression levels with different codon optimization strategies and structural modifications in Example 1.

[0047] Figure 3 The statistical results of RSV F protein expression levels with different codon optimization strategies and structural modifications in Example 1.

[0048] Figure 4 The data are binding antibody titers 14 days after mice were immunized in Example 2.

[0049] Figure 5The data are statistical results of the antibody titer detection data of mice 14 days after immunization in Example 2.

[0050] Figure 6 The data are binding antibody titers 35 days after mice were immunized in Example 2.

[0051] Figure 7 The data are statistical results of the antibody titer detection data of mice immunized 35 days after in Example 2.

[0052] Figure 8 The data are for the neutralizing antibody titer of mice 35 days after immunization in Example 3.

[0053] Fig. 9 These are the statistical results of the neutralizing antibody titer detection data of mice 35 days after immunization in Example 3. DETAILED DESCRIPTION

[0054] In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be understood as limiting the scope of the present invention. The experimental methods without specific conditions in each embodiment are operated according to the conventional conditions in the field or the conditions recommended by the instrument manufacturer's instructions.

[0055] In order to enhance the immunogenicity of pre-F, the present invention designs a variety of RSV allosteric antigens, wherein the mutation schemes of V1, V2, and V4 are as follows:

[0056] V1: The 104-144 region of the Pre-F protein was replaced with a GS linker to reduce the structural changes caused by the conformational changes of pep27 and the fusion peptide; S155C, S290C and A149C, Y458C introduced two sets of disulfide bonds; S190F and V207L ​​achieved cavity filling; the C-terminus contained 5 intracellular amino acids of CKARS; and P102A, L373R, I379V, and M447V.

[0057] V2: In order to enhance the immunogenicity of the antigen, this group of antigens introduced a new cavity filling V296F based on the first group.

[0058] V4: In order to enhance the immunogenicity of the antigens, this group of antigens introduced S46G, E92D, and K465Q based on the first group.

[0059] The structures of the three groups of antigens V1, V2 and V4 of the present invention are shown in FIG. Figure 1 .

[0060] The amino acid and encoding nucleotide sequences of each variant and wild-type RSV F are shown in Table 1.

[0061] Table 1

[0062] name Amino acid sequence Coding nucleotide sequence V4-m4 SEQ ID No.1 SEQ ID No.6 V4-m2-1 SEQ ID No.1 SEQ ID No.7 V4-m2-2 SEQ ID No.1 SEQ ID No.8 V4-m1 SEQ ID No.1 SEQ ID No.9 V2-m9 SEQ ID No.2 SEQ ID No.10 V2-m3 SEQ ID No.2 SEQ ID No.11 V2-m10 SEQ ID No.2 SEQ ID No.12 V2-PLUS5 SEQ ID No.2 SEQ ID No.13 V1-m9 SEQ ID No.3 SEQ ID No.14 V1-m2 SEQ ID No.3 SEQ ID No.15 V1-m10 SEQ ID No.3 SEQ ID No.16 V1-PLUS5 SEQ ID No.3 SEQ ID No.17 positive SEQ ID No.4 SEQ ID No.18 WT SEQ ID No.5 SEQ ID No.19

[0063] Example 1

[0064] In this example, the expression level of RSV F glycoprotein before fusion on the cell surface was detected by double antibody sandwich ELISA using antibodies specific to RSV F glycoprotein before fusion (D25, Mota), and the effect of each RSV F variant on the expression level of RSV pre-F was investigated.

[0065] 1. mRNA transfection into cells

[0066] 293T cells (293T cells were cultured in 6-well plates, with about 2 million cells per well) were transfected with 4 μg of mRNA of different sequences (SEQ ID No. 6-SEQ ID No. 19) (each mRNA was prepared according to conventional techniques in the art). The culture was terminated after 24 hours, and the intracellular proteins were collected and the total protein was quantified.

[0067] 2. Enzyme-linked immunosorbent assay (ELISA) to measure antigen expression

[0068] ① Antibody coated ELISA plate:

[0069] Take out the packaged antibody protein (Mota) from the refrigerator, dilute it to 2 μg / mL with Coating Buffer, Research Grade Motavizumab (DVV02803), take a 96-well plate (Greiner, 655061), add 100 μL to each well, cover the ELISA plate, and coat it in a refrigerator at 2-8°C overnight.

[0070] Take out the coated 96-well plate, pour off the coating solution, remove the excess solution to ensure that there is no residue in the well. Add 1× Washing Buffer diluted with ultrapure water to wash the plate, with a volume of 300μL per well, and repeat the wash 3 times. After firmly tapping the remaining liquid on absorbent paper, add blocking solution, 300μL per well, then seal the plate with a sealing film and incubate at 37℃ for 2h.

[0071] ② Add the sample to be tested:

[0072] First dilute the protein stock solution (cell lysate) in step 1 to 1-2 μg / μL, and then conduct the antigen test experiment. Especially for samples with unknown protein expression, previous studies recommend the use of gradient dilution method for preparation, and the gradient dilution multiples of the diluted samples are set to 40, 80, 160, 320, 640, 1280, and 2560 times.

[0073] Take out the sealed 96-well plate and remove the remaining liquid after washing. Add 100μl of sample diluent to the blank well, and add 100μl of standard or sample to be tested to the remaining wells (be careful not to have bubbles, add the sample to the bottom of the ELISA plate well, try not to touch the well wall, and one plate should be loaded with samples within 10 minutes). Cover the ELISA plate with film and react at 37℃ for 2h. To ensure the validity of the experimental results, please use a new standard solution for each experiment.

[0074] ③Add detection antibody:

[0075] Take out the blocked 96-well plate, pour off the coating solution, clean up the residual liquid and wash 5 times. Dilute the detection antibody Anti-HRSV-A F / Fusion glycoprotein F0 Antibody (D25) (RVV02809) - Bioti (concentration of 0.79 mg / ml) at 1:2000 times, add the diluted antibody to the 96-well plate at a volume of 100 μL per well, seal the plate with a sealing film, and incubate at 37°C in the dark for 1 hour.

[0076] ④Add substrate solution:

[0077] Take out the 96-well plate after adding the detection antibody, pour off the coating solution, and clean the residual liquid 5 times. Dilute HRP-conjugated Streptavidin (SA00001-0) at a ratio of 1:10000, add the diluted HRP-conjugated Streptavidin to the 96-well plate at a volume of 100 μL per well, seal the plate with a sealing film, and incubate at 37°C in the dark for 30 minutes.

[0078] ⑤ Color development and detection of OD value:

[0079] Turn off the indoor light source, take out the 96-well plate after incubation with the secondary antibody, pour out the primary antibody liquid and wash 5 times. Take out the disposable sample loading tank and put it in a light-proof box, pour the TMB solution into the sample loading tank, add 100μL TMB to each well with a discharge gun, and color for 20 minutes in the dark (do not exceed 25 minutes). At this time, the positive sample will appear blue. The sample must record the liquid addition time and the waiting time for each plate to prevent experimental errors. After the color development time is up, add 100μL Stop Solution to each well with a discharge gun. At this time, the sample will first appear yellow. Measure its absorbance at 450nm. Please read the plate within two minutes after adding Stop solution to each plate, otherwise the absorbance of the blank well will increase and the absorbance of the sample well will decrease. The program setting of the microplate reader is an absorbance value of 450nm and low-speed shaking for 5s.

[0080] The results of the pre-fusion RSV F glycoprotein detection on the cell surface can be found in Figure 2 and Figure 3 .

[0081] Presented in Figure 2 and Figure 3 The results in show that different codon optimization strategies and structural modifications are cumulatively helpful to increase the expression of RSVpre-F. The antigen expression level of the mRNA in this example is 30-80 times higher than that of the WT group.

[0082] Example 2

[0083] This example provides the in vivo immunogenicity (mouse binding antibodies) of the four groups of RSV F glycoproteins (V1-m9, V2-m9, V4-m2, and V4-m4) screened in Example 1 in mice.

[0084] 1. Methods and Grouping

[0085] The in vitro synthesis of mRNA for the experiment was carried out according to the conventional operation in the art. In this embodiment, in addition to the coding sequences of V1-m9, V2-m9, V4-m2-1, and V4-m4 (SEQ ID No.14, SEQ ID No.10, SEQ ID No.7, and SEQ ID No.6), the target mRNA molecule also includes a 5'UTR (GGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCCACC, SEQ ID No.20) and a 3'UTR (GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTC CCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG, SEQ ID No.21), the 5'CAP is Cap2-6 (structure see Formula I), the 3' is added with a Poly A tail (AAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA, SEQ ID No.22), and 100% m1ψ is modified.

[0086]

[0087] Each mRNA was encapsulated in T19-5 LNP (the composition and molar ratio of T19-5 LNP were: T19 of the structural formula as Formula II, 48%; DSPC, 16%; DMG-PEG2000, 1.5%; CHOL, 34.5%), with a particle size of about 100 nm, and injected intramuscularly (IM) into 8-week-old BALB / c mice (n=10 per group). The mRNA was administered at intervals of 2 weeks, with a single injection dose of 5 μg, and serum was collected every week. The serum binding antibody titer against D14 and D28 pre-F glycoproteins was determined by ELISA.

[0088] Prefusion F-specific IgG titers were measured two weeks after the first administration (i.e., 14 days after mice were immunized) and three weeks after the second administration (i.e., 35 days after mice were immunized).

[0089] Among them, a group of single-injection immunization and double-injection freeze-dried dosage forms were arranged to test the effects of immunization times and storage methods on the immune effect.

[0090] 2. The specific experimental process is as follows:

[0091] ① Sample dilution

[0092] Blood was collected from the edge of the mouse eye, and the supernatant was collected by high-speed centrifugation, not less than 50 μL. Dilute serum (primary antibody): dilute the sample to a gradient of 4000x, 40000x, 400000x, 4000000x, 8000000x, 20000000x, 40000000x. The dilution method of serum can refer to the following steps: The dilution gradient of control serum CK is 40x, 400x, and 4000x. The operation steps of adding liquid are the same as those of serum. Note that a control should be set for each 96-well plate.

[0093] ② ELISA

[0094] Take out the pre-F protein from the refrigerator, dilute it to 2ug / mL with Coating Buffer, HRSV(A)Fusion glycoprotein F0, His Tag(RSF-V52H7), take a 96-well plate (Greiner, 655061), add 100μL to each well, cover the ELISA plate, and coat it overnight in a refrigerator at 2-8℃. Take out the coated 96-well plate, pour out the coating solution, remove the excess solution to ensure that there is no residue in the well. Wash the plate with ultrapure water diluted to 1× Washing Buffer, with a volume of 300μL per well, and repeat washing 3 times. After firmly tapping the residual liquid on absorbent paper, add blocking solution, 300μL per well, then seal the plate with a sealing film, and incubate at 37℃ for 2h.

[0095] Take out the coated 96-well plate and pour off the coating solution to ensure that there is no residue in the wells. Wash the plate with 1× Washing Buffer diluted with ultrapure water, with a volume of 300 μL per well, and repeat the wash 3 times. After removing the residual liquid, add Blockingdiluent, 300 μL per well, then seal the plate with a sealing film and incubate at 4°C for 2 hours.

[0096] Pour off the coating solution and clean up the residual liquid; add the diluted test serum sample and the control group serum sample, take each sample three times, 100μL each time, and make 3 parallel replicates. Note that a blank control and CK must be set up for each plate.

[0097] Dilute Goat pab to Ms IgG (HRP) with Dilution buffer, 1:10000 dilution (the dilution multiple needs to be diluted according to the instructions), and shake to mix. Take out the 96-well plate after incubation with the primary antibody, pour off the primary antibody liquid, and clean the residual liquid until there is no residue in the well. Then wash the plate 5 times with a plate washer to clean the residual liquid; add the diluted antibody to the 96-well plate at a volume of 100 μL per well, seal the plate with a sealing film, and incubate at room temperature in the dark for 1 hour.

[0098] Turn off the indoor light source, take out the 96-well plate after incubation with the secondary antibody, pour out the primary antibody liquid and wash 5 times. Then take out the disposable sample loading tank and put it in a light-proof box, pour the TMB solution into the sample loading tank, add 100μLTMB to each well with a discharge gun, and color for 20 minutes in the dark (do not exceed 25 minutes). At this time, the positive sample is blue. The sample must record the liquid addition time and the waiting time for each plate to prevent experimental errors. After the color development time is up, add 100μL Stop Solution to each well with a discharge gun. At this time, the sample will first turn yellow. Measure its absorbance at 450nm. Please read the plate within two minutes after adding Stop solution to each plate, otherwise the absorbance of the blank well will increase and the absorbance of the sample well will decrease. The program setting of the microplate reader is an absorbance value of 450nm and low-speed shaking for 5s.

[0099] The test results are shown in Figures 4 to 7 As shown, the V4-m4 cap1 group is a group in which the Cap2-6 cap structure is replaced with a commercial cap structure (CleanCap-Cap1 GAG); the V4-m4 SM102 group is a group using the commercial SM102 preparation; the V4-m4 freeze-dried group is a group of freeze-dried preparations stored at 4 degrees Celsius; and the V4-M4 single-injection group is a group immunized with a single injection.

[0100] in accordance with Figure 4 and Figure 5As a result, the sequence used in the present invention has a faster immune response after a single injection of immunization, and can cause an immune response in animals earlier than the control. In addition, the cap structure Cap2-6 helps the antigen sequence to exert an immune effect earlier than the commercial Cap1. The T19-5LNP formula with independent intellectual property rights used by the company is comparable to the commercial SM102. In addition, the present invention also includes a comparison of the vaccine state (freeze-dried and non-freeze-dried), and the results show that there is no statistical difference between the freeze-dried preparation stored at 4 degrees Celsius and the liquid sample stored at minus 80 degrees Celsius.

[0101] according to Figure 6 The data showed that the mRNA modified by mouse binding antibody serum showed a titer 5-24 times higher than the control (A2 strain; GenBank GI: 138251) 35 days after immunization. In addition, the cap structure Cap2-6 and T19-5 formulations and freeze-dried dosage forms showed binding antibody titers that were not inferior to those of commercial originals.

[0102] in accordance with Figure 7 The results show that three weeks after the double injection, all samples basically reached saturation. There is no statistical difference between the antigen sequences, and the single factor effect will also decrease as the number of immunizations and time increase. It is worth noting that the single injection immunization effect of the present invention is obviously inferior to the double injection.

[0103] Example 3

[0104] This example provides a neutralizing antibody test performed on samples 35 days after immunization of the mice in Example 2 to measure the level of RSV-A2 neutralizing antibodies in the sera of the immunized mice.

[0105] The main experimental operation is to inactivate the samples by warming them at 56°C for 30 minutes, and use the plaque reduction test (PRNT) to detect the anti-RSV neutralization titer in the serum.

[0106] RSV A2 strain (or RSV A2 strain with RFP fluorescent label) was diluted to about 80 plaque units (PFU) per inoculation dose, and an equal amount of progressively diluted serum was added. After 60 minutes at 37°C, 2 wells of a 24-well plate with cells that had formed a monolayer were inoculated at each dilution, 0.2 ml per well, and adsorbed at 37°C for 2 hours. The inoculation solution was poured off, and a culture medium containing 0.8% methylcellulose pre-warmed at 37°C was added, and the plate was cultured at 37°C for 72 hours. The number of plaques formed by virus infection in each well was counted by the antibody immunoplaque method (or fluorescent plaque), and the neutralizing titer of the serum that reduced the plaques by 50% was calculated.

[0107] Results Figure 8 and Fig. 9 As shown. Figure 8 and Fig. 9 It can be seen that: although there is no significant difference in binding antibodies of all samples after 35 days of mouse immunization, the neutralizing antibody levels of the three groups of antigens involved in the present invention are significantly higher, especially the two groups of antigen sequences of V4 (V4-m2-1 and V4-m4). In addition, the cap structure and preparation used in the present invention are not inferior to commercial products. It is worth noting that Figure 8 The V4-m4 binding antibody level after single-dose immunization was low, but the neutralizing antibody level was higher than the control (two injections), which also shows that this design combination has a better immune effect.

Claims

1. A respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof, which has the following amino acid site changes compared to the wild-type Pre-F protein of respiratory syncytial virus: The 104-144 region of the Pre-F protein was replaced with a GS linker; S155C, S290C, A149C, and Y458C introduced two sets of disulfide bonds; S190F and V207L ​​achieved cavity filling; and P102A, L373R, I379V, and M447V; Furthermore, the C-terminus of the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment comprises a cytoplasmic tail region fragment, and the cytoplasmic tail region fragment is a fragment of continuous 3-10 amino acid residues derived from the cytoplasmic tail region of the Pre-F protein.

2. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, which has at least one of the following modifications compared to the respiratory syncytial virus Pre-F protein: Cavity filling of V296F; and / or One or more mutations among S46G, E92D, K465Q.

3. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, wherein: The cytoplasmic tail region fragment is a fragment of 4-6 consecutive amino acid residues derived from the cytoplasmic tail region of the Pre-F protein; Preferably, the cytoplasmic tail fragment is CKARS.

4. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to any one of claims 1 to 3, which has at least the 26th to 515th amino acid sequence or the full-length amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or a derivative amino acid sequence with equivalent function formed by replacing, deleting or adding one or more amino acids on the basis of these amino acid sequences.

5. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, wherein: The equivalent functions include promoting the improvement of the immunogenicity and / or stability of pre-F and / or promoting the improvement of the expression level of pre-F protein.

6. A nucleic acid encoding the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof according to any one of claims 1 to 5.

7. The nucleic acid according to claim 6, which is DNA or RNA; Preferably, the sequence of the nucleic acid encoding the respiratory syncytial virus antigenic polypeptide is shown in any one of SEQ ID No.6-SEQ ID No.

17.

8. Use of the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to any one of claims 1 to 5 or the nucleic acid according to claim 6 or 7 in the preparation of a respiratory syncytial virus vaccine.

9. A respiratory syncytial virus vaccine comprising: at least one mRNA having an open reading frame encoding a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof according to any one of claims 1 to 5, and A pharmaceutically acceptable carrier.

10. The vaccine according to claim 9, having one or more of the following characteristics: The open reading frame is codon optimized; The open reading frame also has a sequence encoding a signal peptide linked to a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof; The at least one mRNA comprises at least one chemical modification; preferably, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyluridine; preferably, at least 80%, at least 90% or 100% of the uracils in the open reading frame have a chemical modification; The at least one mRNA comprises at least one 5′ end cap structure; The at least one mRNA comprises a 3′ polyA tail; The vaccine is in the form of nanoparticles; preferably, the nanoparticles have an average diameter of 50 nm to 200 nm; preferably, the nanoparticles are lipid nanoparticles; preferably, the lipid nanoparticles contain cationic lipids, PEG-modified lipids, sterols and non-cationic lipids; preferably, the cationic lipids are ionizable cationic lipids, the non-cationic lipids are neutral lipids, and the sterols are cholesterol.

Images