Intron for increasing expression of adeno-associated virus mediated SPINK1 gene and application of intron in treatment of in-vivo pancreatitis

Abstract

The invention provides an SPINK1 gene enhanced short segment intron. The introduction of the enhanced short-segment intron can significantly improve the expression level of an exogenous normal human SPINK1 gene mediated by an adeno-associated virus (AAV), meanwhile, it is clear that improvement of the expression quantity of SPINK1 is positively correlated with the relieving degree of pancreatitis, and a better curative effect is achieved in a severe pancreatitis model. The enhanced short segment introns achieve higher yield of genes of interest when used in limited packaging capacity AAV delivery systems. Therefore, the enhanced short segment intron can further broaden the clinical application range of gene therapy.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene engineering, and specifically refers to the introduction of a SPINK1 gene enhanced short fragment intron to promote the efficient expression of normal human SPINK1 gene mediated by adeno-associated virus. Background Art

[0002] Chronic pancreatitis (CP) is an inflammatory disease of the pancreas with multiple factors, including genetics and the environment. The prevalence rate is increasing year by year worldwide. Patients suffer from the disease for a long time, with a heavy medical burden. There is no clinical cure, and it is a major intractable disease worldwide. With the progress of genetics, it is now found that some gene mutations are closely related to the occurrence and development of CP. SPINK1 loss-of-function mutations dominate pancreatitis patients in my country. [1] , which leads to decreased expression of trypsin inhibitors and increased risk of premature activation of trypsinogen, leading to pancreatitis [2,3] .

[0003] In recent years, gene therapy has developed rapidly and has made many breakthroughs in genetic diseases. Adeno-associated virus (AAV) is the most widely used vector in clinical practice due to its advantages such as better safety in vivo application and wide range of host cells. [4] , the gene addition / enhancement mediated by it is the most direct treatment for loss-of-function mutations. It can make the exogenous gene express the normal functional copy in the target cell without changing the mutant copy of the genome itself, thereby compensating for the defective gene function. The author's team has previously confirmed that the normal human SPINK1cDNA mediated by mutant AAV8 is overexpressed in the pancreas, and a single injection can successfully reduce the severity of pancreatitis and delay the progression of fibrosis in the caerulein model, pancreatic duct ligation model, and Spink1c.194+2T>C mutant mouse model. [5] .

[0004] However, the above study has the limitation that the expression level of exogenous human SPINK1 is relatively low. After its cDNA was packaged and transduced by mutant AAV8, the pancreatic trypsin inhibitory activity and human SPINK1 protein level in the mouse pancreas only increased by 1.4 times and 1.6 times, respectively. Increasing the viral dose and repeated administration may bring higher expression effects, but it also induces immune responses in the body, and in severe cases, even serious adverse events including death may occur. Therefore, this method has high costs and risks of toxic side effects and is not the preferred solution. [6] Therefore, how to use lower and safer vector doses for gene therapy while maximizing target gene expression and therapeutic effects is a technical problem that needs to be solved urgently.

[0005] Introns are non-coding DNA sequences in eukaryotic genes, located between the coding regions of genes, alternating with exons. They are transcribed into pre-mRNA and then spliced ​​out to produce mature mRNA. In many eukaryotic organisms, normal gene expression depends on introns, which regulate gene transcription and post-transcriptional expression by affecting transcription rate, transcription stability, mRNA transport and translation efficiency. [7,8] , but the specific molecular mechanism has not yet been determined. Studies have found that introns have a positive regulatory effect on gene expression. The expression of target proteins in intron-containing constructs is significantly higher than that in intron-free constructs, which can be used as one of the strategies to enhance transgenic expression. [9-11] .

[0006] Different from the gene expression regulation mode mediated by enhancers, the ability of introns to enhance gene expression is closely related to their sequence and their position in the gene. The first intron in a gene is the focus of research. In most species (including plants and animals), it may be enriched with certain transcription factor binding sites.

[12] It is generally believed that introns located within 1 kb downstream of the transcription start site are most effective in enhancing gene expression, and their effect decreases as the distance from the promoter increases. [13,14] Secondly, introns near the terminator have also received extensive attention because of their association with mRNA 3′ end processing and transcription termination. [15,16] , but the effect on gene expression capacity is still controversial [17,18] .

[0007] The present invention focuses on the human SPINK1 gene, which has 3 transcripts, of which the longest transcript contains 3 introns. In the past, some scholars constructed an expression plasmid containing the full-length cDNA of human SPINK1 combined with a single intron of SPINK1. Cell transfection experiments showed that both the full-length intron 1 (1.8 kb) and intron 3 (3.3 kb) of SPINK1 could significantly increase the expression of SPINK1, among which the effect of SPINK1 intron 1 was better.

[19] However, due to the limitation of AAV packaging capacity (<5 kb), the intron length needs to be further shortened.

[0008] To date, no studies have explored whether inserting corresponding short introns into AAV-mediated exogenous target genes can enhance the expression of target genes, nor have studies explored whether enhancing gene expression by SPINK1 short introns can further improve the treatment of pancreatitis. Summary of the invention

[0009] In order to solve the problem of low SPINK1 expression yield in the above-mentioned existing AAV-mediated SPINK1 expression process, the present invention targets the CP key gene SPNIK1, constructs a pancreas-targeted Y-to-F mutant scAAV8 vector-mediated normal human SPINK1 gene cDNA combined with an enhanced short fragment intron sequence, and inserts it into the SPNIK1 intron for the treatment of CP disease.

[0010] In order to achieve the above object, the first aspect of the present invention provides a 100 bp short fragment intron miniintron1 sequence that can significantly increase the expression of the SPINK1 gene:

[0011] The sequence is:

[0012] gtaagtgttgcatatttttcaaatttaaataaaactgttttgacctgttgctgacttctttcatttaggacccaacttaccatatctgatttatttctag.

[0013] The spliced ​​intron fragments do not affect the splicing of introns and exons.

[0014] The second aspect of the present invention provides a human SPINK1 gene fragment inserted into the above miniintron1:

[0015] Preferably, the SPINK1 fragment is the following polynucleotide sequence of human SPINK1 gene transcript NM_003122.5 as the human SPINK1 gene fragment:

[0016] ATGAAGGTAACAGGCATCTTTCTTCTCAGTGCCTTGGCCCTGTTGAGTCTATCTGGTAACACTGGAGCTGACTCCCTGGGAAGAGAGGCCAAATGTTACAATGAACTTAATGGATGCACCAAGATATATGACCCTGTCTGTGGGACTGATGGAAATACTTATCCCAATGAATGCGTGTTATGTTTTGAAAATCGGAAACGCCAGACTTCTATCCTCATTCAAAAATCTGGGCCTTGC

[0017] Further preferably, miniintron1 is inserted into a specific position of the human SPINK1 gene, and miniintron1 is inserted between exon 1 and exon 2 of SPINK1 cDNA to form the following sequence:

[0018] ATGAAGGTAACAGGCATCTTTCTTCTCAGTGCCTTGGCCCTGTTGAGTCTATCTGgtaagtgttgcatatttttcaaatttaaataaaactgtttgacctgttgctgacttctttcatttaggacccaacttaccatatctgatttatttctagGTAACACTGGAGCT GACTCCCTGGGAAGAGAGGCCAAATGTTACAATGAACTTAATGGATGCACCAAGATATATGACCCTGTCTGTGGGACTGATGGAAATACTTATCCCAATGAATGCGTGTTATGTTTTGAAAATCGGAAACGCCAGACTTCTATCCTCATTCAAAAATCTGGGCCTTGC.

[0019] Further preferably, the above human SPINK1 and human SPINK1-miniintron1 sequences are respectively added with 3×Flag sequences to obtain the final target gene sequence.

[0020] Further preferably, the 3×Flag sequence is: GACTACAAGGATGACGATGACAAGGATTACAAAGACGACGATGATAAGGACTATAAGGATGATGACGACAAATAA

[0021] In a third aspect, the present invention provides a vector for expressing a human SPINK1 gene fragment inserted into miniintron1. The vector is a Y-to-F mutant scAAV8-mediated human SPINK1 cDNA combined with a short fragment intron1 vector (hereinafter collectively referred to as mutant scAAV8-hSPINK1-miniintron1).

[0022] Further preferably, the mutant scAAV8 vector used is a recombinant AAV virus vector produced by combining the AAV2 genome with the AAV8 capsid protein with double point mutations of Y447+Y733F. It has been previously proven that this vector has high pancreatic tissue specificity and is safe.

[20] .

[0023] Further preferably, according to the attached Figure 1 The vector construction diagram shows that the human SPINK1 gene fragment inserted into miniintron1 is inserted into the vector expression frame.

[0024] In a fourth aspect, the present invention provides a recombinant cell containing a human SPINK1 gene fragment of miniintron1.

[0025] The expression vector of the third aspect is introduced into host cells for expression, positive clones are screened, and finally recombinant cells containing the human SPINK1 gene fragment of miniintron1 are obtained.

[0026] The cell is a eukaryotic or prokaryotic cell.

[0027] When the cell is a prokaryotic cell, preferably, it is Escherichia coli, and more preferably, the cell is DH5α.

[0028] When the cell is a eukaryotic cell, preferably, it is one or more of yeast, CHO, HEK293T cells and the like.

[0029] The third aspect of the present invention provides a method for expressing the human SPINK1 gene fragment of miniintron1 in cells. The method comprises the following steps:

[0030] 1. Design and synthesize the human SPINK1-miniintron1 sequence;

[0031] 2. Insert miniintron1 between exon 1 and exon 2 of SPINK1 cDNA;

[0032] 3. Construct the target gene into a linearized expression vector;

[0033] 4. Preparation and transformation of competent cells;

[0034] 5. Preparation and transformation of competent cells, and identification of positive transformants by PCR;

[0035] 6. Send positive clones for sequencing verification and expression detection.

[0036] Preferably, in step 2, in order to facilitate the subsequent detection of human SPINK1 gene expression, a 3×Flag tag protein is carried at the 3′ end of the target gene;

[0037] Further preferably, the tag nucleic acid coding sequence of 3×Flag is: GACTACAAGGATGACGATGACAAGGATTACAAAGACGACGATGATAAGGACTATAAGGATGATGACGACAAATAA.

[0038] Preferably, in step 3, the specific operations are:

[0039] Use the seamless cloning kit to add the target gene fragment and linearized vector to the centrifuge tube at a molar ratio of 2:1 for recombination reaction.

[0040]

[0041] After mixing, incubate at 37°C for 30 minutes, then transfer to ice for 5 minutes for transformation.

[0042] Preferably, the operation of step 4 is: (1) preparation of competent cells:

[0043] Take DH5α bacteria and streak them, culture them overnight, pick up the round colonies with a sterilized pipette tip and place them in LB liquid culture medium, shake and culture at 37°C, 200 rpm for about 12 hours until the logarithmic growth phase.

[0044] The bacteria were inoculated into LB liquid culture medium (1 ml / 100 ml) in a conical flask, cultured at 37 degrees and 200 r / min with shaking for 2-3 hours until OD600 = about 0.4.

[0045] Dispense into two 50 ml centrifuge tubes, centrifuge at 4°C, 3000 g for 10 min, discard the supernatant, then add 10 ml of cold 0.1 M CaCl 2 Resuspend the cell pellet in a centrifuge tube and shake on ice for 10 min; centrifuge at 4°C, 3000 g for 10 min, discard the supernatant; add 10 ml of cold 0.1 M CaCl 2 Resuspend the cell pellet in a centrifuge tube and shake on ice for 30 min; centrifuge at 4°C, 3000 g for 10 min, discard the supernatant; add 2 ml (2 ml / 50 ml initial bacterial solution) 0.1 M CaCl 2 / 15% glycerol in a 50ml centrifuge tube and shake gently.

[0046] (2) Conversion

[0047] Prepare ampicillin-resistant solid culture medium plates; use a pipette to take 1 μl of plasmid and put it into 100 μl of competent cells, and keep it on ice for 30 minutes; heat shock at 42°C for 90 seconds, and immediately put it on ice for 1-2 minutes; add 1 ml of LB liquid culture medium to the tube, and incubate at 37°C, 200 rpm, for 30 min-1h to activate the bacteria; take 50 μl of bacterial solution and apply it to the plate, and after the bacterial solution is dry, invert it and place it in a 37°C incubator for overnight culture.

[0048] (3) Identification:

[0049] Pick the transformants grown on the plate and resuspend them in 10 μl LB culture medium. Take 1 μl as a template for colony PCR identification. Forward sequencing primer: 5'-CGCAAATGGGCGGTAGGCGTG-3'

[0050] Reverse sequencing primer: 5'-CATAGCGTAAAAGGAGCAACA-3'

[0051] The reaction system and PCR cycle conditions are as follows:

[0052]

[0053]

[0054] In a fourth aspect, the present invention provides a method for preparing a mouse model. According to the methods disclosed in the first to third aspects above, after positive clones are determined, the viral expression vector is recovered, and then the expression vector is injected into mice for observation. The specific steps are as follows:

[0055] 1. Grouping of experimental animals;

[0056] 2. Construction of severe pancreatitis model in mice with caerulein;

[0057] 3. Detection of exogenous human SPINK1 gene expression.

[0058] Preferably, in step 1, 8-week-old wild-type C57BL / 6 mice are randomly divided into:

[0059] (1) Mutant scAAV8-hSPINK1 vector infection group: The mutant scAAV8-hSPINK1 vector was administered by intraperitoneal injection.

[0060] (2) Mutant scAAV8-hSPINK1-miniintron1 vector infection group: Intraperitoneal injection of mutant scAAV8-hSPINK1-miniintron1 vector

[0061] (3) Normal saline injection group: Normal saline was injected intraperitoneally.

[0062] Preferably, in step 2:

[0063] According to previous experiments, the optimal infection titer of the mutant scAAV vector was determined to be 2×10 11 vg / animal, the expression time is better on the 5th day after injection. Therefore, each group of mice were raised normally until the 5th day after vehicle or saline injection for modeling.

[0064] After fasting for 12 h with free drinking water, the mice were weighed (in g); the stock solution of caerulein was diluted with saline to the target concentration, and 250 μg / kg caerulein was extracted using a 1 ml insulin needle and injected intraperitoneally into the mice, once every hour for 7 consecutive times; the mouse serum was collected 6 h after the last injection of caerulein, and then the mice were killed and their abdomens were dissected to remove the pancreatic tissue.

[0065] Preferably, in step 3, the specific operations are:

[0066] Steps: Take mouse pancreatic tissue in a 1.5ml EP tube, add magnetic beads and protein lysis buffer, extract pancreatic tissue protein, adjust the protein concentration of each sample by BCA method, perform Western blot, and analyze the expression of human SPINK1 protein in each sample relative to the internal reference by ImageJ according to the color development results. The results showed that the expression of human SPINK1 protein in the mutant scAAV8-hSPINK1-miniintron1 vector injection group was significantly increased by about 7 times compared with the mutant scAAV8-hSPINK1 vector group (P<0.05).

[0067] The results showed that the abdomen was dissected, fresh pancreatic tissue was taken out to observe the gross morphology and weigh the pancreatic wet weight / body weight ratio (mg / g). The results showed that the degree of pancreatic tissue edema in the mutant scAAV8-hSPINK1-miniintron1 vector injection group was significantly less than that in the mutant scAAV8-hSPINK1 vector group and the normal saline group; the difference in pancreatic wet weight / body weight ratio was statistically significant, and the mutant scAAV8-hSPINK1-miniintron1 group was significantly smaller than the mutant scAAV8-hSPINK1 group and the normal saline group. Fresh pancreatic tissue was immersed and fixed in 4% paraformaldehyde, and the H&E staining results showed that the pancreatic tissue morphology of the mutant scAAV8-hSPINK1-miniintron1 group of mice was better, the interlobular space was not significantly widened, and the edema, necrosis, and inflammatory cell infiltration of acinar cells were significantly reduced, indicating that the increase in human SPINK1 expression can further improve the severity of severe pancreatitis, that is, the SPINK1 expression is positively correlated with the degree of pancreatitis remission.

[0068] The fifth aspect of the present invention provides a use for treating human CP disease. According to the first to fourth aspects above, the vector is injected into a patient suffering from CP disease to alleviate or treat CP disease.

[0069] Compared with the prior art, the advantages of the present invention are: the introduction of the enhanced short fragment intron of the present invention can significantly improve the expression level of the exogenous normal human SPINK1 gene mediated by adeno-associated virus (AAV), and at the same time, it is clarified that the increase in SPINK1 expression is positively correlated with the degree of pancreatitis relief, and better therapeutic effects are achieved in the severe pancreatitis model. The enhanced short fragment intron achieves a higher target gene yield when used in a limited packaging capacity AAV delivery system. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 Schematic diagram of the construction of the mutant scAAV8 vector system (top), mutant scAAV8-hSPINK1 vector (middle) and mutant scAAV8-hSPINK1-miniintron1 vector (bottom) in Example 1.

[0071] Figure 2 Prediction of shear impact for the miniintron1 after optimal design.

[0072] Figure 3 The sequencing results of hSPINK1 (left) and hSPINK1-miniintron1 (right) in Example 1.

[0073] Figure 4 This is the protein expression of mutant scAAV8-hSPINK1 vector and mutant scAAV8-hSPINK1-miniintron1 vector in HEK293T cells.

[0074] Figure 5 The severe pancreatitis model of mice was established by intraperitoneal injection of caerulein in Example 2.

[0075] Figure 6 The relative expression levels of human SPINK1 protein in different mouse models in Example 2.

[0076] Figure 7 The figure shows the improvement of pancreatic morphology and weight in mice with severe pancreatitis in Example 3.

[0077] Figure 8 This is the improvement of pancreatic pathology in mice with severe pancreatitis in Example 3. DETAILED DESCRIPTION

[0078] The following describes the embodiments of the present invention through specific embodiments, and those skilled in the art can easily understand the advantages and effects of the present invention from the contents disclosed in the present invention. The present invention can also be implemented or applied through other different specific embodiments, and the details in the present invention can also be modified or changed based on different applications in accordance with the spirit of the present invention. It should be noted that the following embodiments can be combined with each other without conflict.

[0079] Example 1: Construction and identification of mutant scAAV8-hSPINK1-miniintron1 vector

[0080] According to the first aspect of the present invention, a Y-to-F mutant scAAV8-mediated vector of human SPINK1 cDNA combined with a short fragment intron1 (hereinafter collectively referred to as mutant scAAV8-hSPINK1-miniintron1) is provided.

[0081] The mutant scAAV8 vector used is a recombinant AAV virus vector produced by combining the AAV2 genome with the AAV8 capsid protein with double point mutations of Y447+Y733F. It has been previously proven that this vector has high pancreatic tissue specificity and is safe.

[20] .

[0082] 1. Construction of mutant scAAV8 vector backbone plasmid

[0083] The mutant scAAV8 vector backbone plasmid used was the pcscAAV-CMV-MCS-3×Flag-tWPA vector system, and the mutant scAAV8-hSPINK1 and mutant scAAV8-hSPINK1-miniintron1 vectors (such as Figure 1 The vector uses the broad-spectrum promoter CMV and contains an ampicillin resistance gene, which is convenient for positive plasmid screening; tWPA is a mutation-optimized WPRE element containing a polyA sequence, which can increase the available space of the vector and enhance the efficiency of transgenic expression.

[0084] 2. Construction of linearized expression vector

[0085] Using the vector system as a template, the vector was digested with restriction endonucleases NheI and BamHI. The digestion reaction system was: 2μg of plasmid, 5μg of 10× reaction buffer, 1μl of each restriction endonuclease, and double distilled water was added to 50μl, and incubated in a 37℃ water bath for more than 2h. The digestion product was subjected to agarose gel electrophoresis to detect the digestion effect, and the target vector band was cut from the gel after agarose gel electrophoresis and recovered using TaKaRa MiniBEST Agarose Gel DNA Extraction KitVer.3.0.

[0086] 3. Human SPINK1 and human SPINK1-miniintron1 sequences

[0087] Since the human SPINK1 gene and the mouse Spink1 gene are highly similar in sequence, considering the future clinical application, the human SPINK1 sequence is selected for amplification. The present invention preferably uses the following polynucleotide sequence of the human SPINK1 gene transcript NM_003122.5 as the human SPINK1 gene fragment:

[0088] ATGAAGGTAACAGGCATCTTTCTTCTCAGTGCCTTGGCCCTGTTGAGTCTATCTGGTAACACTGGAGCTGACTCCCTGGGAAGAGAGGCCAAATGTTACAATGAACTTAATGGATGCACCAAGATATATGACCCTGTCTGTGGGACTGATGGAAATACTTATCCCAATGAATGCGTGTTATGTTTTGAAAATCGGAAACGCCAGACTTCTATCCTCATTCAAAAATCTGGGCCTTGC.

[0089] Considering that the closer the intron is to the promoter, the greater the transcriptional upregulation activation, and the increasing distance from the promoter, the gradually decreasing activation ability, and previous studies have confirmed that SPINK1 intron 1 has the best effect, this patent selects SPINK1 intron 1. Due to the limited packaging capacity of AAV, short fragment optimization of SPINK1 intron 1 is required: previous studies have shown that without affecting gt-ag splicing, 75% of the intron sequence deletion does not affect the intron-mediated enhancement effect

[21] Therefore, this patent uses the first and last 50 bp of SPINK1 intron 1 to form a 100 bp miniintron 1 sequence. https: / / www.fruitfly.org / seq_tools / splice.html Predicted not to affect splicing (see Figure 2 ).

[0090] Insert miniintron1 between exon 1 and exon 2 of SPINK1 cDNA to form the following sequence:

[0091] ATGAAGGTAACAGGCATCTTTCTTCTCAGTGCCTTGGCCCTGTTGAGTCTATCTGgtaagtgttgcatatttttcaaatttaaataaaactgttttgacctgttgctgacttctttcatttaggacccaacttaccatatctgatttatttctagGTAACACTGGAGC TGACTCCCTGGGAAGAGAGGCCAAATGTTACAATGAACTTAATGGATGCACCAAGATATATGACCCTGTCTGTGGGACTGATGGAAATACTTATCCCAATGAATGCGTGTTATGTTTTGAAAATCGGAAACGCCAGACTTCTATCCTCATTCAAAAATCTGGGCCTTGC

[0092] The 3×Flag tag protein carried at the 3' end of the target gene facilitates subsequent target protein detection. The sequence is as follows:

[0093] GACTACAAGGATGACGATGACAAGGATTACAAAGACGACGATGATAAGGACTATAAGGATGATGACGACAAATAA

[0094] The above hSPINK1 and hSPINK1-miniintron1 sequences are respectively added with 3×Flag sequences to obtain the final target gene sequence.

[0095] 4. Construct the target gene into the linearized expression vector

[0096] Use the seamless cloning kit to add the target gene fragment and linearized vector to the centrifuge tube at a molar ratio of 2:1 for recombination reaction.

[0097]

[0098]

[0099] After mixing, incubate at 37°C for 30 minutes, then transfer to ice for 5 minutes for transformation.

[0100] 4. Preparation and transformation of competent cells

[0101] (1) Preparation of competent cells:

[0102] Take DH5α bacteria and streak them, culture them overnight, pick up the round colonies with a sterilized pipette tip and place them in LB liquid culture medium, shake and culture at 37°C, 200 rpm for about 12 hours until the logarithmic growth phase.

[0103] The bacteria were inoculated into LB liquid culture medium (1 ml / 100 ml) in a conical flask, cultured at 37 degrees and 200 r / min with shaking for 2-3 hours until OD600 = about 0.4.

[0104] Dispense into two 50 ml centrifuge tubes, centrifuge at 4°C, 3000 g for 10 min, discard the supernatant, then add 10 ml of cold 0.1 M CaCl 2 Resuspend the cell pellet in a centrifuge tube and shake on ice for 10 min; centrifuge at 4°C, 3000 g for 10 min, discard the supernatant; add 10 ml of cold 0.1 M CaCl 2 Resuspend the cell pellet in a centrifuge tube and shake on ice for 30 min; centrifuge at 4°C, 3000 g for 10 min, discard the supernatant; add 2 ml (2 ml / 50 ml initial bacterial solution) 0.1 M CaCl 2 / 15% glycerol in a 50ml centrifuge tube and shake gently.

[0105] (2) Conversion

[0106] Prepare ampicillin-resistant solid culture medium plates; use a pipette to take 1 μl of plasmid and put it into 100 μl of competent cells, and keep it on ice for 30 minutes; heat shock at 42°C for 90 seconds, and immediately put it on ice for 1-2 minutes; add 1 ml of LB liquid culture medium to the tube and incubate at 37°C, 200 rpm, for 30 min-1h to activate the bacteria; take 50 μl of bacterial solution and apply it to the plate, and after the bacterial solution is dry, invert it and place it in a 37°C incubator for overnight culture.

[0107] 5. Identification of positive transformants by colony PCR:

[0108] Pick the transformants grown on the plate and resuspend them in 10 μl LB culture medium. Take 1 μl as a template for colony PCR identification. Forward sequencing primer: 5'-CGCAAATGGGCGGTAGGCGTG-3'

[0109] Reverse sequencing primer: 5'-CATAGCGTAAAAGGAGCAACA-3'

[0110] The reaction system and PCR cycle conditions are as follows:

[0111]

[0112]

[0113] 6. Send positive clones for sequencing verification and expression detection:

[0114] (1) The sequencing results of hSPINK1 and hSPINK1-miniintron1 target genes are as follows Figure 3 shown.

[0115] (2) Detection of vector expression in HEK293T cells

[0116] The expression of human SPINK1 protein in the mutant scAAV8-hSPINK1 vector and the mutant scAAV8-hSPINK1-miniintron1 vector was evaluated by using the 3×Flag tag protein of the two vectors. The SPINK1 protein carrying the 3×Flag tag was predicted to be approximately 12 kDa, and the target band was detected between Marker 10-15 kDa (e.g. Figure 4 shown).

[0117] Example 2: In vivo expression detection of mutant scAAV8-hSPINK1-miniintron1 vector

[0118] 1. Experimental animal grouping:

[0119] Eight-week-old wild-type C57BL / 6 mice were randomly divided into:

[0120] (1) Mutant scAAV8-hSPINK1 vector infection group: The mutant scAAV8-hSPINK1 vector was administered by intraperitoneal injection.

[0121] (2) Mutant scAAV8-hSPINK1-miniintron1 vector infection group: Intraperitoneal injection of mutant scAAV8-hSPINK1-miniintron1 vector

[0122] (3) Normal saline injection group: Normal saline was injected intraperitoneally.

[0123] 2. Construction of severe pancreatitis model in mice with caerulein:

[0124] According to previous experiments, the optimal infection titer of the mutant scAAV vector was determined to be 2×10 11 vg / animal, the expression time is better on the 5th day after injection. Therefore, each group of mice were raised normally until the 5th day after vehicle or saline injection for modeling.

[0125] After fasting for 12 hours with free drinking water, the mice were weighed (in g); the mother solution of caerulein was diluted with saline to the target concentration, and 250 μg / kg caerulein was extracted using a 1 ml insulin needle and injected intraperitoneally into the mice, once every hour for 7 consecutive times; the mouse serum was collected 6 hours after the last injection of caerulein, and then the mice were killed and their abdomens were dissected to remove pancreatic tissue ( Figure 5 ).

[0126] 3. Detection of exogenous human SPINK1 gene expression:

[0127] The pancreatic tissue of mice was placed in a 1.5 ml EP tube, and magnetic beads and protein lysis buffer were added to extract pancreatic tissue protein. The protein concentration of each sample was adjusted by the BCA method, and Western blot was performed. The expression level of human SPINK1 protein in each sample relative to the internal reference was analyzed by ImageJ according to the color development results. The results showed that the expression level of human SPINK1 protein in the mutant scAAV8-hSPINK1-miniintron1 vector injection group was significantly increased by about 7 times compared with the mutant scAAV8-hSPINK1 vector group (P<0.05) ( Figure 6 ).

[0128] Example 3: Treatment of severe pancreatitis in mice with mutant scAAV8-hSPINK1-miniintron1 vector

[0129] The mice were euthanized, and the abdomen was dissected. Fresh pancreatic tissue was removed to observe the gross morphology and weigh the pancreatic wet weight / body weight ratio (mg / g). The results showed that the degree of pancreatic tissue edema in the mutant scAAV8-hSPINK1-miniintron1 vector injection group was significantly less than that in the mutant scAAV8-hSPINK1 vector group and the normal saline group; the difference in pancreatic wet weight / body weight ratio was statistically significant, and the mutant scAAV8-hSPINK1-miniintron1 group was significantly smaller than the mutant scAAV8-hSPINK1 group and the normal saline group ( Figure 7 ).

[0130] Fresh pancreatic tissue was fixed in 4% paraformaldehyde. Figure 8 As shown: The H&E staining results showed that the pancreatic tissue morphology of mice in the mutant scAAV8-hSPINK1-miniintron1 group was better, there was no obvious widening of the interlobular spaces, and the edema, necrosis, and inflammatory cell infiltration of acinar cells were significantly reduced, indicating that the increase in human SPINK1 expression can further improve the severity of severe pancreatitis, that is, the SPINK1 expression level is positively correlated with the degree of pancreatitis remission.

Claims

1. A human SPINK1 intron, wherein the intron is miniintron1, characterized in that: The miniintron1 nucleotide sequence is shown as SEQ ID No.

1.

2. A human SPINK1 encoding gene, characterized in that: The human SPINK1 intron of claim 1 is inserted between exon 1 and exon 2 of SPINK1 cDNA to form a new nucleotide sequence, and the coding gene sequence is shown as SEQ ID No.

2.

3. The human SPINK1 encoding gene according to claim 2, characterized in that The 3×Flag tag protein carried at the 3′ end of the gene facilitates subsequent detection of the target protein. The coding sequence of the 3×Flag tag protein is shown in SEQ ID No.

3.

4. An expression vector containing the intron or coding gene according to any one of claims 1 to 3.

5. A recombinant cell expressing the intron or coding gene according to any one of claims 1 to 3 or containing the expression vector according to claim 4.

6. A method for preparing the recombinant cell according to claim 5, characterized in that: The steps include: (1) Introducing the intron or coding gene described in any one of claims 1 to 3 into a gene expression vector; (2) The expression vector prepared in step (1) is transformed into competent cells to screen positive clones.

7. The method according to claim 6, characterized in that During the screening of positive clones, PCR verification was performed. The primers used in the PCR verification are as follows: Forward sequencing primer: 5'-CGCAAATGGGCGGTAGGCGTG-3' Reverse sequencing primer: 5′-CATAGCGTAAAAGGAGCAACA-3′.

8. A method for preparing an animal model overexpressing human SPINK1, characterized in that: The method for preparing the animal model is as follows: introducing the human SPINK1 gene described in any one of claims 2-3 or the expression vector or engineered cell described in any one of claims 4-5 into the animal model so that it can be stably expressed in the animal model.

9. Use of the intron or coding gene or vector or cell according to any one of claims 1 to 5 in the preparation of a drug for treating human chronic pancreatitis.

10. The use according to claim 9, characterized in that The method for treating human chronic pancreatitis is to inject the drug into the human body so that the human SPINK1 gene described in any one of claims 2-3 can be normally expressed in the patient's body.

Images