A heparin lyase mutant and a method for recombinant expression thereof

By mutating specific amino acid sites of heparin hydrolase from Amazonian chromobacterium and heterologously expressing it in Escherichia coli, the problem of insufficient heparin hydrolase expression was solved, achieving efficient production and improved enzyme activity, making it suitable for industrial applications.

CN119320762BActive Publication Date: 2026-04-17JIANGNAN UNIV +1
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGNAN UNIV
Filing Date
2024-11-27
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

The limited variety of bacterial heparin hydrolases in existing technologies, coupled with the lack of efficient expression methods, hinders the industrial production and application of heparin hydrolases.

Method used

High-efficiency production was achieved by mutating specific amino acid sites of heparin hydrolase derived from Amazonian chromobacterium, heterologously expressing it in Escherichia coli, adding a solubilization tag, and purifying the product using a nickel column.

Benefits of technology

It significantly enhances the activity of heparin hydrolase, has a high expression level, requires simple culture conditions, and exhibits stable enzymatic properties, making it suitable for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119320762B_ABST
    Figure CN119320762B_ABST
Patent Text Reader

Abstract

This invention relates to a heparin hydrolase mutant and its recombinant expression method, belonging to the field of enzyme engineering technology. This invention heterologously expresses a heparin hydrolase derived from *Chromobacterium amazonense* in *Escherichia coli*, and modifies the heparin hydrolase by adding a TrxA solubilizing tag and performing site-directed mutagenesis on certain amino acid sites. The mutant G37T / N145D / V281K exhibits a catalytic efficiency 1.96 times higher than the original strain, playing an important role in the application and industrial production of heparin hydrolase.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of enzyme engineering technology, and in particular to a heparin hydrolase mutant and a method for its recombinant expression. Background Technology

[0002] Heparin is a natural glycosaminoglycan, primarily found in the liver and lung tissues of animals. Heparin has anticoagulant properties, binding to thrombin and antithrombin to prevent blood clotting. It also possesses anti-inflammatory and antitumor effects, regulates the immune system, and plays important physiological roles in the body, including cell signaling, cell adhesion, and tissue repair.

[0003] Bacterial heparin hydrolases are endoglucuronidases, belonging to the glycosidic hydrolase family 79. These enzymes typically exhibit high specificity and activity, selectively hydrolyzing the β-1,4-glycosidic bond between glucuronic acid and glucosamine in the heparin molecule, thereby producing heparin fragments of specific lengths. These bacterial heparin hydrolases have broad application value. Heparin hydrolases can also be used to modify and engineer heparin, altering its biological activity and pharmacological properties by cleaving the heparin chain, thus developing heparin-based drugs with better efficacy. Overexpression of heparin hydrolases in cancer cells is associated with angiogenesis, inflammation, and increased metastatic potential, making them an important potential target for anticancer drugs.

[0004] However, the types of bacterial heparin hydrolases reported so far are limited, and there is a lack of efficient expression methods. CN108841739A discloses a recombinant strain that heterologously expresses bacterial heparin hydrolases using a Pichia pastoris expression system, but its improvement on heparin hydrolase activity is not significant, which is not conducive to industrial production. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a heparin hydrolase mutant and its recombinant expression method. Heparin hydrolase derived from *Chromobacterium amazonense* is modified and mutated, then heterologously expressed in *Escherichia coli*, and the product is purified using a nickel column. The heparin hydrolase obtained by this method exhibits significantly enhanced enzyme activity.

[0006] The first objective of this invention is to provide a heparin hydrolase mutant, wherein the heparin hydrolase having an amino acid sequence as shown in SEQ ID NO.1 is modified by any of the following:

[0007] The glycine at position 37 is mutated to threonine;

[0008] The asparagine at position 145 was mutated to glutamine;

[0009] The asparagine at position 145 was mutated to aspartic acid;

[0010] The glycine at position 37 was mutated to threonine, and the asparagine at position 145 was mutated to glutamine.

[0011] The glycine at position 37 was mutated to threonine, and the asparagine at position 145 was mutated to aspartic acid.

[0012] The glycine at position 37 was mutated to threonine, and the valine at position 281 was mutated to lysine.

[0013] The glycine at position 37 was mutated to threonine, the asparagine at position 145 was mutated to aspartic acid, and the valine at position 281 was mutated to lysine.

[0014] Furthermore, the heparin hydrolase is derived from *Creozoa yalatum*.

[0015] Furthermore, the nucleotide sequence of the heparin hydrolase is shown in SEQ ID NO.2.

[0016] A second objective of this invention is to provide a gene encoding the aforementioned heparin hydrolase mutant.

[0017] A third objective of this invention is to provide a recombinant expression vector containing the aforementioned genes.

[0018] A fourth objective of the present invention is to provide a host cell comprising the above-described heparin hydrolase mutant, the above-described gene, or the above-described recombinant expression vector.

[0019] The fifth objective of this invention is to provide a recombinant engineered bacterium expressing heparin hydrolase, using Escherichia coli as the starting strain, expressing the above-mentioned heparin hydrolase mutant, and adding a solubilization tag to the N-terminus of the heparin hydrolase mutant.

[0020] Furthermore, the solubilizing tag is a TrxA tag or a histidine tag.

[0021] A sixth objective of the present invention is to provide a microbial preparation comprising the above-mentioned recombinant engineered bacteria.

[0022] A seventh objective of the present invention is to provide a heparin hydrolase expressed from the above-mentioned recombinant engineered bacteria or the above-mentioned microbial preparation.

[0023] Furthermore, the heparin hydrolase uses heparin sodium, chondroitin sulfate A, hyaluronic acid, or heparin precursor as a substrate.

[0024] Preferably, the heparin hydrolase uses heparin sodium as a substrate.

[0025] Preferably, the optimal temperature for the heparin hydrolase is 45°C, and the optimal pH value is 5.0.

[0026] The beneficial effects of this invention are:

[0027] This invention involves mutating certain sites of heparin hydrolase derived from *Chromium tumefaciens* and adding a solubilization tag, then heterologously expressing the resulting mutant in *E. coli*. Using an induced fermentation method, the recombinant bacteria are added to a substrate-containing system to produce heparin hydrolase. The product is then purified using a nickel column. This method enables rapid production of heparin hydrolase with high expression levels, simple culture conditions, and yields a high-expression, stable enzymatic product with significantly enhanced enzyme activity. Attached Figure Description

[0028] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...

[0029] Figure 1 This is a map of the recombinant plasmid expressing heparin hydrolase in Escherichia coli in Example 1 of the present invention;

[0030] Figure 2 The results of measuring the enzyme activity of heparin hydrolase with different substrates in Example 2 of the present invention;

[0031] Figure 3 The results of SDS-PAGE electrophoresis of the purified heparin hydrolase in Example 3 of this invention;

[0032] Figure 4 The results of the enzymatic property determination of the heparin hydrolase product of Example 4 of the present invention;

[0033] Figure 5 The enzyme activity of the heparin hydrolase mutant in Example 5 of this invention. Detailed Implementation

[0034] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0035] The culture media involved in the examples are as follows:

[0036] LB medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L;

[0037] TB medium: tryptone 12 g / L, yeast extract 24 g / L, glycerol 10 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L.

[0038] Example 1: Construction of recombinant Escherichia coli producing heparin hydrolase

[0039] Using pET-28a as a vector, the heparin hydrolase gene (nucleotide sequence shown in SEQ ID NO.2) from *Chromobacterium amazonense* was cloned. The upstream primer introduced a BamHI restriction site; the downstream primer introduced a HindIII restriction site; the Hep gene... Ca Plasmid pET-28a was linearized with primers and then ligated into E. coli BL21(DE3) for amplification. Plasmids with correct sequencing were selected and then transferred into E. coli BL21(DE3) for expression, resulting in recombinant E. coli BL21DE3 / PET28-CaHEP containing the recombinant heparin hydrolase gene.

[0040] The upstream primer was 5'-GCCGCTGCTGTGATGATGATGAT-3', and the downstream primer was 5'-ATGAAAAAAACTGAGCCGCTTCATG-3'.

[0041] A TrxA lysis tag (nucleotide sequence shown in SEQ ID NO.3) was attached to the N-terminus of this gene. The plasmid map is shown below. Figure 1 As shown.

[0042] Example 2: Horizontal production of heparin hydrolase in shake flasks

[0043] Recombinant *Escherichia coli* BL21DE3 / PET28-CaHEP containing the recombinant heparin hydrolase gene was used as the production strain. Single colonies were inoculated into LB medium and cultured overnight at 37°C and 220 rpm to obtain seed culture. The seed culture was then inoculated into 50 mL of TB medium at a rate of 1% by weight, and OD was collected. 600 When the value reached 0.6, 0.1 M IPTG was added to the culture medium, and the induction temperature was 25℃ for 20 h. 500 μL of substrate heparin sodium, chondroitin sulfate A (CSA), hyaluronic acid, and heparin precursor were added to 500 μL of fermentation broth, and the reaction was carried out at 37℃ for 30 min. After terminating the reaction, 500 μL of DNS was added and mixed well, and the mixture was boiled in a water bath for 10 min. The absorbance of each numbered tube was measured at 540 nm. The heparin hydrolase activity was defined as the amount of enzyme required per hour to hydrolyze heparin to produce 1 μg of glucose equivalent reducing sugar at 37℃ and pH 5.0; one enzyme activity unit (IU) is defined as the amount of enzyme required to hydrolyze heparin to produce 1 μg of glucose equivalent reducing sugar per hour. Figure 2 ).

[0044] Example 3: Purification and preparation of recombinant heparin hydrolase

[0045] The purification of recombinant heparin hydrolase was performed as follows: A 5 mL Ni column was used, and the column was equilibrated to 10 column volumes with phosphate buffer (50 mmol / L, pH 7.4). The fermentation supernatant was collected by centrifugation at 4°C, and 20 mL was loaded onto the column. Imidazole gradient elution was used, with the imidazole prepared using the aforementioned phosphate buffer at concentrations of 10 mmol / L, 30 mmol / L, and 200 mmol / L. The final eluted protein was the target protein. The eluted target protein was desalted and deimidazole-free, and stored at 4°C. The purified enzyme activity was 110 U / L. Figure 3 As shown in the SDS-PAGE, lane 1 represents the band of purified heparin hydrolase.

[0046] Example 4: Enzyme Property Determination

[0047] The optimal pH for heparin hydrolase activity was determined using a series of buffer solutions with pH values ​​(2.0-10.0): KCl-HCl buffer (20 mM, pH = 2.0-3.0), glycine buffer (20 mM, pH = 3.0-4.0), citrate buffer (20 mM, pH = 4.0-5.0), citrate-phosphate buffer (20 mM, pH = 5.0-6.0), Tris-HCl buffer (20 mM, pH = 6.0-8.0), and Gly-NaOH buffer (20 mM, pH = 8.0-10.0). The optimal pH was found to be 5.0. The effect of different temperatures on heparin hydrolase activity was determined using a temperature range of 20-80℃, with the optimal reaction temperature found to be 45℃. Figure 4 ).

[0048] Example 5: Obtaining mutants with enhanced enzyme activity

[0049] To enhance the activity of heparin hydrolase, saturation mutations were performed at the G37, N145, and V281 sites. Using a recombinant plasmid carrying the unmutated heparin hydrolase gene (constructed in the example) as a template, PCR amplification was performed. The primers used are shown in Table 1. The PCR amplification product was introduced into competent *E. coli* BL21(DE3) cells, incubated on ice for 30 min, heat-shocked at 42°C for 90 s, then added to LB medium and incubated at 37°C for 40 min. The cells were then plated on kanamycin-containing LB plates and incubated at 37°C for 8–12 h. Colonies were selected for sequencing verification to obtain correct transformants. The methods for culturing transformants and obtaining purified mutant enzymes are shown in Examples 1–3. The obtained purified mutant enzymes were placed in citrate-phosphate buffer (20 mM pH 5.0) and reacted at 37°C for 1 h. Enzyme activity was measured, and mutants with significantly enhanced activity, G37T / N145D / V281K, were screened.

[0050] Table 1 Primer List

[0051] Primer name Sequence (5'-3') G37X-F AGGAGGAGGCNNKAACTCGG G37T-F AGGAGGAGGCACAAACTCGG G37X-R CCTCCTCCTCCGCACGCCGCC N145X-F GTACGGGATCNNKTTGGCAGG N145D-F GTACGGGATCGACTTGGCAGG N145Q-F GTACGGGATCCAGTTGGCAGG N145X-R GATCCCGTACAGGGCCTTCC V281X-F TATCTTACAATCGNNKACGCAGTCAG V281K-F TATCTTACAATCGAAGACGCAGTCAG V281X-R CGATTGTAAGATAGTAGTAAGATGTGGGTC

[0052] like Figure 5 As shown, the enzyme activity of the mutant G37T / N145D / V281K was increased by 1.96 times compared with the original strain.

[0053] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A heparin lyase mutant, characterized in that, The heparin hydrolase mutant is modified in any one of the following ways to modify the amino acid sequence of the heparin hydrolase shown in SEQ ID NO.1: The glycine at position 37 is mutated to threonine; The glycine at position 37 was mutated to threonine, and the asparagine at position 145 was mutated to glutamine. The glycine at position 37 was mutated to threonine, and the asparagine at position 145 was mutated to aspartic acid. The glycine at position 37 was mutated to threonine, and the valine at position 281 was mutated to lysine. The glycine at position 37 was mutated to threonine, the asparagine at position 145 was mutated to aspartic acid, and the valine at position 281 was mutated to lysine.

2. The heparin lyase mutant of claim 1, wherein: The nucleotide sequence of the heparin hydrolase is shown in SEQ ID NO.

2.

3. A gene encoding a mutant of the heparin hydrolase of claim 1.

4. A recombinant expression vector comprising the gene of claim 3.

5. A host cell comprising the heparin hydrolase mutant of claim 1 or 2, the gene of claim 3, or the recombinant expression vector of claim 4.

6. A recombinant engineering bacteria expressing heparin lyase, characterized in that: Using Escherichia coli as the starting strain, the heparin hydrolase mutant as described in claim 1 is expressed, and a solubilization tag is added to the N-terminus of the heparin hydrolase mutant.

7. The recombineering bacteria of claim 6, wherein: The solubilizing tag is either a TrxA tag or a histidine tag.

8. A microbial preparation comprising the recombinant engineered bacteria of claim 6 or 7.

9. A heparin hydrolase, characterized in that: It is expressed from the recombinant engineered bacteria of claim 6 or the microbial preparation of claim 8.

10. The heparin hydrolase according to claim 9, characterized in that: The heparin hydrolase uses heparin sodium, chondroitin sulfate A, hyaluronic acid, or heparin precursor as substrates.

Citation Information

Patent Citations

  • Method for constructing recombinant bacteria capable of efficiently secreting and expressing bacterial heparin hydrolase

    CN108841739A

  • Heparin lyase mutant and recombinant expression method thereof

    CN111471669A

  • Escherichia coli compositions and methods thereof

    CN116615439A