Method for quickly fermenting bamboo shoots with low salt

Abstract

The invention discloses a low-salt rapid bamboo shoot fermentation method, which adopts an inoculated fermentation mode, uses lactobacillus plantarum and lactobacillus brevis as leavening agents, and uses fresh bamboo shoots as raw materials. The preparation method comprises the following steps: selecting fresh bamboo shoots with high tenderness, peeling off bamboo shoot shells, cutting off bases, cleaning, and cutting into bamboo shoot slices with uniform sizes; cooking in boiling water for 5 minutes, fishing out, and airing to remove moisture; preparing water with the salt concentration of 2% and the glucose concentration of 2%, boiling the water, and airing the water for later use to obtain a fermentation feed liquid; adding the air-dried fresh bamboo shoot slices and the prepared material liquid into a bag which is scalded by boiling water and cooled according to a solid-to-liquid ratio of 1: 4, and then adding a lactic acid bacteria leavening agent into the fermentation bag for sealed fermentation; and placing the fermentation bag in an environment with a temperature of 30 DEG C for fermentation for 5 days. The prepared fermented bamboo shoots are short in fermentation period, low in nitrite content, mellow and normal in sourness, rich in flavor and high in sensory quality and food safety, and can better meet industrial and consumer requirements.

Description

Technical Field

[0001] The invention relates to the technical field of microbial fermentation, and in particular to a method for rapid low-salt fermentation of bamboo shoots. Background Art

[0002] Bamboo shoots are the general term for young shoots of plants in the subfamily Bambusoideae of the Poaceae family. my country is a major producer of bamboo shoots, and bamboo shoot resources are very abundant, with an annual output of up to 2.17 million tons. Bamboo shoots are rich in nutritional value, rich in protein, amino acids, fat, sugars, calcium, phosphorus, iron, carotene and various vitamins. In addition, they have certain prebiotic effects and help prevent and treat various diseases such as hyperlipidemia, hypertension, coronary heart disease, obesity, diabetes, intestinal cancer and hemorrhoids. There are many ways to eat fresh bamboo shoots, but their harvesting and storage periods are short. Due to the increase in cellulose and lignin, they usually begin to age gradually 6 hours after harvesting, thus affecting the flavor, taste and nutritional value. Therefore, fresh bamboo shoots can be further processed and stored. Common processing methods include drying, fermentation, pickling and sterilization after canning. Among them, fermentation can improve its nutritional value and give the product a unique flavor, so it is deeply loved by consumers.

[0003] Fermented bamboo shoots are a traditional fermented food in my country. They are made from fresh bamboo shoots and soaked under suitable conditions. The microorganisms involved in bamboo shoot fermentation mainly include lactic acid bacteria, yeast, etc. Lactobacillus plantarum, Lactobacillus brevis, Leuconostoc mesenteroides, etc. are the dominant bacterial genera in the fermentation process, contributing the most to the formation of its taste and flavor. At present, the fermentation method commonly used for bamboo shoots is still natural fermentation, which has problems such as long fermentation cycle, difficult to control product quality, and low food safety. In addition, in the fermentation system, although the addition of salt can play a role in seasoning and inhibit the growth of miscellaneous bacteria, and improve the food safety of fermented products, excessive salt content will affect food safety. Summary of the invention

[0004] The purpose of the present invention is to address the defects of the prior art and provide a low-salt rapid fermentation preparation method using fresh bamboo shoots as raw materials. The fermented bamboo shoots prepared by the method have a short fermentation cycle, low nitrite content, mellow sour taste, beautiful flavor, high sensory quality, do not contain various additives, and are highly safe for consumption.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] In a first aspect of the present invention, a Lactobacillus brevis GST0002 (Lactobacillus brevis) is provided, characterized in that: the Lactobacillus brevis GST0002 was deposited in the China Collection of Microorganisms on October 24, 2024, the deposit address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC NO: M 20242317.

[0007] The second aspect of the present invention provides a fermentation agent containing the Lactobacillus brevis GST0002 described in the first aspect.

[0008] Furthermore, the fermentation bacteria agent also contains Lactobacillus plantarum, and the Lactobacillus plantarum includes Lactobacillus plantarum GST0001, which is preserved in the China Collection Center for Microorganisms with a preservation number of CCTCCNO: M 20242316.

[0009] Furthermore, in the fermentation bacteria agent, the ratio of the number of live bacteria of Lactobacillus brevis GST0002 to that of Lactobacillus plantarum GST0001 is 1:1.

[0010] A third aspect of the present invention provides a method for rapid low-salt fermentation of bamboo shoots, characterized in that fermentation is carried out using the fermentation agent described in any one of the second aspects.

[0011] Furthermore, the method comprises the following steps:

[0012] (1) Select fresh bamboo shoots with high tenderness, peel off the bamboo shoot shells, cut off the base, wash and cut into bamboo shoot slices of uniform size;

[0013] (2) Boil the bamboo shoots in boiling water for 5 min, then remove and air dry;

[0014] (3) preparing a fermentation liquid containing salt and glucose;

[0015] (4) adding the dried fresh bamboo shoots and the prepared liquid to a bag that has been blanched in boiling water and cooled at a solid-liquid ratio of 1:4, and then adding the fermentation agent to the fermentation bag for sealed fermentation;

[0016] (5) Place the fermentation bag at 30°C for 5 days.

[0017] Furthermore, the added amount of the fermentation bacteria agent is 2% of the weight of the bamboo shoots.

[0018] Furthermore, the salt concentration in the slurry is 2%, the glucose concentration is 2%, and the slurry is cooled after being boiled before use.

[0019] A fourth aspect of the present invention provides a fermented bamboo shoot obtained by the method described in any one of the third aspects.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] 1. The Lactobacillus brevis GST0002 provided in the present invention has good acid production performance and nitrite degradation ability. The fermentation agent prepared by using the Lactobacillus brevis can be used for bamboo shoot fermentation, which can improve the edible safety of fermented bamboo shoots.

[0022] 2. The low-salt, fast-fermented bamboo shoot preparation method using fresh bamboo shoots as raw materials provided in the present invention has a short fermentation cycle, low nitrite content, mellow sour taste, rich and full flavor, high sensory quality and edible safety, and can better meet the needs of industry and consumers.

[0023] 3. Adding sugar to the fermentation system can promote the growth of microorganisms, the formation of flavor substances and the maturity of fermented bamboo shoots. The addition of salt can not only play a role in seasoning, but also inhibit the growth of bacteria during the fermentation process and improve the edible safety of fermented products. Blanching fresh bamboo shoots can largely remove the astringency and harmful substances such as oxalic acid in bamboo shoots and improve their taste. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a colony morphology characteristic diagram of Lactobacillus brevis GST0002;

[0025] Figure 2 This is a cell microscopic image of Lactobacillus brevis GST0002;

[0026] Figure 3 This is a comparison chart of the effects of adding different fermentation bacteria agents on the pH changes of fermented bamboo shoots in Example 3 and the comparative example;

[0027] Figure 4 This is a comparison chart of the effects of adding different fermentation bacteria agents on the changes in the nitrite content of fermented bamboo shoots in Example 3 and the comparative example;

[0028] Figure 5 The figure is a comparison chart of the types and contents of the total volatile substances in bamboo shoots fermented in different ways for 5 days in Example 3 and the comparative example;

[0029] Figure 6 The figure is a comparison chart of the types and contents of characteristic volatile substances in bamboo shoots fermented in different ways for 5 days in Example 3 and the comparative example. DETAILED DESCRIPTION

[0030] In order to deepen the understanding of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings. The following embodiments are only used to explain the present invention and do not constitute a limitation on the protection scope of the present invention.

[0031] The % appearing in the following embodiments, unless otherwise specified, all represent wt%, and the proportions are all mass ratios; the raw materials used, unless otherwise specified, are all commercially available products. The Lactobacillus brevis GST0002 involved in the following embodiments was deposited in the China Collection of Microorganisms Collection Center on October 24, 2024, with a preservation address of Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and a preservation number of CCTCC NO: M 20242317; the Lactobacillus plantarum GST0001 involved in the following embodiments was deposited in the China Collection of Microorganisms Collection Center on October 24, 2024, with a preservation number of CCTCC NO: M 20242316.

[0032] The MRS culture medium formula involved in the following examples is as follows:

[0033] MRS solid culture medium: 10g tryptone, 10g beef extract, 5g yeast powder, 20g glucose, 2g diammonium citrate, 5g anhydrous sodium acetate, 0.1g magnesium sulfate heptahydrate, 0.05g manganese sulfate tetrahydrate, 2g dipotassium hydrogen phosphate, 1mL Tween-80, dissolved in 1L distilled water, add 20g agar powder to the solid, sterilize at 121℃ for 20min and set aside.

[0034] MRS liquid culture medium: 10 g tryptone, 10 g beef extract, 5 g yeast powder, 20 g glucose, 2 g diammonium citrate, 5 g anhydrous sodium acetate, 0.1 g magnesium sulfate heptahydrate, 0.05 g manganese sulfate tetrahydrate, 2 g dipotassium hydrogen phosphate, 1 mL Tween-80, dissolved in 1 L distilled water, autoclaved at 121 ° C for 20 min and set aside.

[0035] Example 1

[0036] Screening of acid-producing strains

[0037] (1) Enrichment, separation and purification of strains

[0038] Take 5 mL of homemade naturally fermented bamboo shoots fermentation liquid and add it to 50 mL of MRS liquid medium to enrich the strain. Take 1 mL of the enriched fermentation liquid and add it to 9 mL of sterile saline. Repeat this operation to dilute the bacterial suspension to 10 -6 , take 100 μL of bacterial suspension and drop it onto MRS solid medium and spread it evenly. Select several single colonies as primary screening strains, and streak the primary screening strains on the plate to achieve separation and purification.

[0039] (2) Strain rescreening

[0040] The strains initially screened were added to MRS liquid culture medium and liquid culture medium containing 125 μg / mL sodium nitrite at an inoculation rate of 5%, respectively, and placed in a 37° C. incubator for 24 hours for rescreening of the strains.

[0041] pH detection: measured with a pH meter.

[0042] Nitrite content detection: Determined by the national standard naphthylethylenediamine hydrochloride method.

[0043] (3) Strain preservation

[0044] Select the purified single colony and place it in 5 mL MRS liquid culture medium, place it in a 37°C incubator at 200 r / min for 20 h, pipette 0.5 mL of bacterial solution into a bacteria preservation tube, add 0.5 mL of 50% sterile glycerol solution, resuspend it, and store it at -80°C.

[0045] (4) PCR amplification of 16S rDNA

[0046] Pipette 1 mL of the bacterial solution after shaking and mixing, discard the supernatant after centrifugation, add 1 mL of sterile water and shake and mix, discard the supernatant after centrifugation, add 1 mL of sterile water and shake and mix, and use it as a PCR template.

[0047] 1) PCR system: 25 μL in total, including 12.5 μL of PCR Mix; 1.0 μL of amplification primer 27F (GCATATCAATAAGCGGAGGAAAAG) with a nucleotide sequence as shown in SEQ ID NO.1 and 1.0 μL of amplification primer 1492R (GGTCCGTGTTTCAAGACGG) with a nucleotide sequence as shown in SEQ ID NO.2, both at 10 μmol / L; 2.0 μL of DNA template; and 8.5 μL of ultrapure water.

[0048] 2) PCR conditions: ① Pre-denaturation temperature: 94°C; ② Denaturation: 94°C, 5 min; ③ Annealing: 55°C, 30 s;

[0049] ④ Extension: 72℃, 90s; ②-④ cycle 30 times; ⑤ Final extension: 72℃, 10min; ⑥ Hold: 4℃, ∞.

[0050] (5) 16S rDNA sequence analysis and identification

[0051] The samples that successfully completed PCR were sent to Jiangsu Saisuofei Company for testing. According to the sequence results fed back by them, as shown in SEQID NO.3, BLAST comparison was performed in combination with the NCBI strain sequence database, and the strain with the highest matching degree was selected to record the results.

[0052] The acid-producing strains in the homemade fermented bamboo shoots were isolated and purified, and a total of 4 strains with better acid-producing performance were selected for re-screening and molecular biological identification. The results are shown in Tables 1 and 2.

[0053] Table 1 Acid production and nitrite degradation of each primary screened strain

[0054] Strain name GST0002 1-1 1-2 1-3 pH 4.45 4.00 4.48 4.62 Nitrite degradation rate 92.28％ 89.46％ 48.30％ 32.36％

[0055] Table 2 Molecular biological identification results of each strain

[0056]

[0057]

[0058] Based on the acid production, nitrite degradation ability and molecular biological identification results of each strain, strain GST0002 was selected for subsequent fermentation experiments.

[0059] The colony characteristics of this strain are: the colonies are milky white, round, raised, with neat edges and smooth surface. Figure 1 The microscopic examination results of the bacteria are shown in Figure 2 As shown, the bacteria were observed to be short and thin rods under the oil microscope, and the Gram staining result was purple, which was a Gram-positive bacteria.

[0060] Example 2

[0061] Preparation of lactic acid bacteria fermentation agent

[0062] The selected Lactobacillus brevis GST0002 was activated in MRS liquid medium for 2-3 generations, and then inoculated into MRS liquid medium at a 2% inoculum, and cultured at 37°C in a shaker at 200 r / min for 24 h. Then 6 mL of the cultured bacterial solution was taken, centrifuged at 4000 rpm for 3 min, the supernatant was discarded, and sterile saline was added to resuspend twice to adjust the bacterial density to 10 8 cfu / mL, and the fermentation agent containing Lactobacillus brevis GST0002 was obtained.

[0063] The fermentation agent containing Lactobacillus plantarum GST0001 was prepared in the same manner as described above.

[0064] The above two fermentation bacteria can be used alone or in combination.

[0065] Example 3

[0066] The method for fermenting bamboo shoots using the fermentation agent in Example 2 includes Example 3.1, Example 3.2, and Example 3.3.

[0067] Example 3.1

[0068] (1) Select fresh bamboo shoots with high tenderness, peel off the bamboo shoot shells, cut off the base, wash and cut into bamboo shoot slices of uniform size;

[0069] (2) Boil the bamboo shoots in boiling water for 5 min, then remove and air dry;

[0070] (3) preparing a fermentation liquid containing salt and glucose, wherein the salt concentration in the liquid is 2% and the glucose concentration is 2%, and the liquid is boiled and then cooled before use;

[0071] (4) adding the dried fresh bamboo shoots and the prepared liquid to a bag or jar that has been scalded with boiling water and cooled at a solid-liquid ratio of 1:4, and then adding a fermentation agent containing Lactobacillus plantarum GST0001 in an amount of 2% of the weight of the bamboo shoots to carry out sealed fermentation;

[0072] (5) Place the bag or jar used as the fermentation container at 30°C and ferment for 5 days.

[0073] Example 3.2:

[0074] (1) Select fresh bamboo shoots with high tenderness, peel off the bamboo shoot shells, cut off the base, wash and cut into bamboo shoot slices of uniform size;

[0075] (2) Boil the bamboo shoots in boiling water for 5 min, then remove and air dry;

[0076] (3) preparing a fermentation liquid containing salt and glucose, wherein the salt concentration in the liquid is 2% and the glucose concentration is 2%, and the liquid is boiled and then cooled before use;

[0077] (4) adding the dried fresh bamboo shoots and the prepared liquid to a bag or jar that has been scalded with boiling water and cooled at a solid-liquid ratio of 1:4, and then adding a fermentation agent containing Lactobacillus brevis GST0002 in an amount of 2% of the weight of the bamboo shoots to carry out sealed fermentation;

[0078] (5) Place the bag or jar used as the fermentation container at 30°C and ferment for 5 days.

[0079] Example 3.3:

[0080] (1) Select fresh bamboo shoots with high tenderness, peel off the bamboo shoot shells, cut off the base, wash and cut into bamboo shoot slices of uniform size;

[0081] (2) Boil the bamboo shoots in boiling water for 5 min, then remove and air dry;

[0082] (3) preparing a fermentation liquid containing salt and glucose, wherein the salt concentration in the liquid is 2% and the glucose concentration is 2%, and the liquid is boiled and then cooled before use;

[0083] (4) adding the dried fresh bamboo shoots and the prepared liquid to a bag or jar that has been scalded with boiling water and cooled at a solid-liquid ratio of 1:4, and then adding a mixed fermentation agent containing Lactobacillus plantarum GST0001 and Lactobacillus brevis GST0002 in an amount of 2% of the weight of the bamboo shoots for sealed fermentation, with the addition ratio of the two being 1:1;

[0084] (5) Place the bag or jar used as the fermentation container at 30°C and ferment for 5 days.

[0085] Comparative Example 1:

[0086] (1) Select fresh bamboo shoots with high tenderness, peel off the bamboo shoot shells, cut off the base, wash and cut into bamboo shoot slices of uniform size;

[0087] (2) Boil the bamboo shoots in boiling water for 5 min, then remove and air dry;

[0088] (3) preparing a fermentation liquid containing salt and glucose, wherein the salt concentration in the liquid is 2% and the glucose concentration is 2%, and the liquid is boiled and then cooled before use;

[0089] (4) adding the dried fresh bamboo shoots and the prepared liquid to a bag or jar that has been scalded with boiling water and cooled at a solid-liquid ratio of 1:4;

[0090] (5) Place the bag or jar used as the fermentation container at 30°C and ferment for 5 days.

[0091] Comparative Example 2:

[0092] (1) Select fresh bamboo shoots with high tenderness, peel off the bamboo shoot shells, cut off the base, wash and cut into bamboo shoot slices of uniform size;

[0093] (2) Boil the bamboo shoots in boiling water for 5 min, then remove and air dry;

[0094] (3) adding the dried fresh bamboo shoots and the boiled and cooled water into a bag or jar that has been scalded and cooled with boiling water at a solid-liquid ratio of 1:4;

[0095] (4) Place the bag or jar used as the fermentation container at a temperature of 30°C and ferment for 5 days.

[0096] During the fermentation of bamboo shoots in Example 3 and each group of comparative examples, the pH and nitrite content were monitored every day, and the pH was measured three times in parallel. The pH was measured using a pH meter, and the nitrite content was measured using the hydrochloric acid naphthylethylenediamine method in the national standard GB5009.33-2016. At the same time, the types and contents of organic acids and volatile flavor substances in each fermented bamboo shoot after 5 days of fermentation were also measured, and finally a sensory evaluation was performed. The results are as follows:

[0097] Comparison of pH changes of bamboo shoots fermented in different ways in each group Figure 3As shown, it can be seen that in the overall fermentation process, the pH of each group inoculated with the fermentation agent in Example 3 decreases much faster than that of each group in the comparative example that is not inoculated with the fermentation agent. After the first day of fermentation, the pH of each group in Example 3 has dropped to below 4.0, among which the pH value of the fermented bamboo shoots in Example 3.3 with mixed lactic acid bacteria inoculation always remains the lowest during the overall fermentation process, the pH of the fermented bamboo shoots in Comparative Example 1 decreases slower than that in the example but faster than that in Comparative Example 2, while the pH of Comparative Example 2 decreases slowly, and is still 4.89 after 5 days of fermentation, thereby proving that the inoculation of lactic acid bacteria and the addition of auxiliary materials (salt and sugar) in the fermentation system are both helpful for the fermentation and acidification of bamboo shoots, accelerating the fermentation process and shortening the fermentation cycle.

[0098] Changes in nitrite content in bamboo shoots fermented by different methods Figure 4 As shown, it can be seen that the nitrite content of bamboo shoots fermented by different methods fluctuates around 1.75 mg / kg, and the differences between the groups are not significant, indicating that different fermentation methods have little effect on the nitrite content in the fermentation process of fermented bamboo shoots.

[0099] The HPLC method was used to determine the changes in the contents of 6 kinds of organic acids in bamboo shoots fermented in different ways, as shown in Table 3 below. It can be seen that the highest content in each group of fermented bamboo shoots is lactic acid, which is also the reason why lactic acid bacteria play their role in the fermentation system. Among them, Example 3.1 has the highest content, which can reach 3.5162mg / kg, followed by Example 3.2, with a content of 2.8365mg / kg, and the content of Example 3.3 is 2.6882mg / kg. The lactic acid content of the mixed fermentation of two lactic acid bacteria has decreased, which may be converted into ester substances with certain alcohol substances. The lactic acid content in Comparative Examples 1 and 2 is less than 2mg / kg, so that the sour taste of fermented bamboo shoots is not full and rich enough. In addition, it is worth noting that there is no production of tartaric acid in Example 3.2, and its citric acid content is higher than that of the remaining groups, which makes its sour taste different from other groups. And the production of acetic acid was detected in Comparative Example 2, which is also the reason for its corruption and produces a sour smell. The combined effect of each organic acid constitutes the sour taste characteristics of different fermented bamboo shoots.

[0100] Table 3 Types and contents of organic acids in different fermented bamboo shoots

[0101]

[0102] The composition and content of volatile flavor substances in different fermented bamboo shoots after 5 days of fermentation were determined by HS-SPME-GC-MS method. Figure 5 It can be seen that the contents of volatile flavor substances in the fermented bamboo shoots are esters, alcohols, aldehydes, ketones, hydrocarbons, and acids from high to low, among which the total amount of volatile flavor substances in Example 3.3 is the largest, far higher than that of the other groups.

[0103] like Figure 6 As shown, it is also found that the main characteristic flavor substances in the fermented bamboo shoots are ethyl acetate, isoamyl acetate, 1-octen-3-ol, phenylethyl alcohol, nonanal, trans-2-octenal, 1-octen-3-ketone, glacial acetic acid, etc. Ethyl acetate and isoamyl acetate were not detected in Comparative Example 2, but the content was higher in the remaining groups, giving the fermentation system a strong fruity aroma. Secondly, alcohols and aldehydes also enrich the flavor of the fermentation system. It is worth noting that the presence of glacial acetic acid was not detected in Example 3.1, which may be due to the inoculation of plant lactobacillus GST0001 fermentation agent, which makes the fermentation system mainly based on homolactic fermentation, thereby causing the overall content of flavor substances in Example 3.1 to be lower than other embodiments. In addition, it is also found that there is butyric acid in Comparative Example 2, with a content of 5.13mg / kg, which has a sour and smelly smell of corruption, which deteriorates the flavor of the fermented bamboo shoots.

[0104] The fermented bamboo shoots after 5 days of fermentation were subjected to sensory evaluation in terms of color, texture, smell, taste and overall acceptance, and the results are shown in Table 4. It can be seen that the color of Comparative Example 2 is dark, the texture is soft, there is a serious smell of corruption, and the taste is also poor. The sensory index scores of each group in Example 3 are higher, especially Example 3.3, indicating that the combined use of Lactobacillus plantarum and Lactobacillus brevis can promote the fermentation process of bamboo shoots, improve the edible quality of fermented bamboo shoots, and meet consumer demand.

[0105] Table 4 Sensory evaluation results of different fermented bamboo shoots

[0106] Group Color texture odor taste Overall acceptance Example 3.1 7.60±0.49 7.80±0.75 7.40±1.02 7.20±0.75 7.20±0.75 Example 3.2 7.60±1.02 8.00±0.63 8.00±0.63 7.60±0.80 7.40±1.02 Example 3.3 9.00±0.63 8.40±0.49 8.60±0.49 8.40±0.80 8.60±1.02 Comparative Example 1 7.20±0.75 7.80±0.40 7.60±0.49 7.20±0.75 7.40±0.80 Comparative Example 2 6.40±0.49 7.00±0.89 5.00±1.26 5.40±0.49 4.00±0.89

[0107] Note: The numbers in the table are the average scores and standard deviations of sensory evaluation

[0108] The above specific implementation methods are only for illustrating the technical concept and structural features of the present invention, and the purpose is to enable relevant persons familiar with this technology to implement it. However, the above content does not limit the protection scope of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should fall within the protection scope of the present invention.

Claims

1. A Lactobacillus brevis GST0002, characterized in that: The Lactobacillus brevis GST0002 was deposited in the China Collection of Microorganisms on October 24, 2024, with the deposit address being Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number being CCTCC NO: M 20242317.

2. A fermentation agent containing the Lactobacillus brevis GST0002 according to claim 1.

3. The fermentation agent according to claim 2, characterized in that: The fermentation bacteria agent also contains plant lactobacillus, which includes plant lactobacillus (Lactobacillus plantarum) GST0001, which is preserved in the China Collection of Microorganisms Collection Center with a preservation number of CCTCC NO: M 20242316.

4. The fermentation agent according to claim 3, characterized in that: In the fermentation bacteria agent, the ratio of the number of live bacteria of Lactobacillus brevis GST0002 to that of Lactobacillus plantarum GST0001 is 1:

1.

5. A method for rapid fermentation of bamboo shoots with low salt content, characterized in that: Fermentation is carried out using the fermentation agent described in any one of claims 2 to 4.

6. The method for rapid low-salt fermentation of bamboo shoots according to claim 5, characterized in that: The steps include: (1) Select fresh bamboo shoots with high tenderness, peel off the bamboo shoot shells, cut off the base, wash and cut into bamboo shoot slices of uniform size; (2) Boil the bamboo shoots in boiling water for 5 min, then remove and air dry; (3) preparing a fermentation liquid containing salt and glucose; (4) adding the dried fresh bamboo shoots and the prepared liquid to a bag that has been blanched in boiling water and cooled at a solid-liquid ratio of 1:4, and then adding the fermentation agent to the fermentation bag for sealed fermentation; (5) Place the fermentation bag at 30°C for 5 days.

7. The method for rapid low-salt fermentation of bamboo shoots according to claim 6, characterized in that: The added amount of the fermentation bacteria agent is 2% of the weight of the bamboo shoots.

8. The method for rapid low-salt fermentation of bamboo shoots according to claim 6, characterized in that: The salt concentration in the feed liquid is 2%, the glucose concentration is 2%, and the feed liquid is cooled after being boiled before use.

9. Fermented bamboo shoots obtained by the method according to any one of claims 5 to 8.

Images