Rye stripe rust resistant gene and application thereof

Abstract

The invention provides a stripe rust resistant gene and application thereof. The stripe rust resistant gene is over-expressed in a material Yannong 19 with high stripe rust susceptibility, and a transgenic positive plant shows near immunity.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering and relates to a rye SECCE1Rv1G0003760 stripe rust resistance gene and application thereof. Background Art

[0002] Wheat (Triticum aestivum L.) is one of China's important food crops, and maintaining and improving its yield is an important guarantee for national food security. Wheat stripe rust is a common disease in wheat production. It is a leaf disease caused by Puccinia striiformis Westend.f.sp.Tritici. The most obvious feature of stripe rust is the production of obvious yellow or orange spores on the leaves, which are generally arranged in rows along the veins. 88% of the world's wheat production areas are susceptible to stripe rust. Every year, stripe rust causes a reduction of 5 million tons of wheat production, and the economic value of the loss is as high as 1 billion US dollars (see reference: Colin, R, Wellings. Global status of stripe rust: a review of history and current threats. Euphytica. 2011, 179: 129-141). China is one of the largest stripe rust epidemic areas in the world. Since the founding of the People's Republic of China, there have been four major epidemics, which occurred in 1950, 1964, 1990 and 2002, respectively, causing a yield loss of about 13 billion kilograms (see reference: Wan A, Zhao Z, Chen X, et al. Wheat stripe rust epidemic and virulence of Puccinia striiformis f.sp.tritici in China in 2002. Plant Disease, 2004, 88: 896-904). Therefore, the breeding of wheat varieties resistant to stripe rust and the mining and utilization of disease-resistant genes are of great significance to ensure national food security.

[0003] Modern breeding aimed at high yield has greatly weakened the genetic diversity of crops. The loss of genetic diversity not only limits the further improvement of yield and quality, but also makes it difficult for crops to cope with global climate change and the spread of pests and diseases. Wheat's closely related species contain many excellent genes and are important genetic resources for the genetic improvement of common wheat. Therefore, introducing beneficial genes from closely related species of wheat into common cultivated wheat is one of the important and effective ways to improve wheat varieties.

[0004] Rye (Secale cereale L.) is an annual or biennial herbaceous crop of the genus Secale in the Poaceae family and one of the wild relatives of wheat. Rye is a diploid species with RR chromosome set. Rye has excellent traits that are lacking in common cultivated wheat and is an important wild germplasm resource for genetic improvement of common wheat. Triticale is a new species artificially synthesized by sexual hybridization between species of the genus Triticum and genus Secale and doubling of the chromosome number of hybrids. It combines the high yield and high quality of wheat with the disease resistance, cold resistance and high lysine content of rye, has huge hybrid growth advantages, and can be used as feed, winemaking, bioenergy and food applications. Triticale, which is a hybrid of diploid rye and wheat of different ploidy, mainly has two types: hexaploid (AABBRR) and octoploid (AABBDDRR). The two triticale parents L20191212 and 4100 used in this article are both hexaploid triticale. Currently, there is no literature report on the research content of stripe rust resistance gene sequence and molecular markers in triticale L20191212. Summary of the invention

[0005] The present invention uses stripe rust physiological race CYR32-34 for inoculation and identification, and finds that two triticale parents L20191212 and 4100 are nearly immune and highly susceptible, respectively. The two triticale parents are hybridized to obtain F1, and the F2 population is obtained after self-pollination. 389 individual plants in the F2 population are inoculated and identified, and it is found that 301 of them are resistant and 88 are highly susceptible. 40 extremely resistant and 40 extremely susceptible materials are selected from the F2 population to form a resistance pool and a susceptible pool, respectively, and total RNA is extracted from leaves for sequencing. BSR (Bulksegregant RNA sequencing) analysis finds that the stripe rust resistance gene is located on the rye 1R chromosome. 14 co-dominant Indel markers are developed on the 1R chromosome using the resequencing data of the two parents, and the F2 composed of 389 individual plants is used for gene positioning, and the stripe rust resistance gene is further localized in the 10Mb interval (corresponding to the Lo7 reference genome 1R: 6.5-16.5Mb). Then, all genes in the interval were analyzed, and it was found that there was an R gene cluster in the interval, including five typical CC-NBS-LRR type R genes (SECCE1Rv1G0003730-SECCE1Rv1G0003770). Combining the transcriptome data of the resistance pool and the sense pool, it was found that two genes (SECCE1Rv1G0003760 and SECCE1Rv1G0003770) were specifically expressed in the resistance pool, but lowly expressed or not expressed in the sense pool, so SECCE1Rv1G0003760 and SECCE1Rv1G0003770 were identified as candidate genes. Using the rye reference genome sequence (https: / / ftp.ebi.ac.uk / ensemblgenomes / pub / release-56 / plants / fasta / secale_cere ale / dna / ), the SECCE1Rv1G0003760 and SECCE1Rv1G0003770 sequences in L20191212 were cloned. To verify the functions of SECCE1Rv1G0003760 and SECCE1Rv1G0003770, genetic transformation of stripe rust-susceptible wheat was carried out using overexpression vectors of SECCE1Rv1G0003760 and SECCE1Rv1G0003770. The transgenic results showed that overexpression of SECCE1Rv1G0003760 could improve wheat resistance to stripe rust. At the same time, a specific molecular marker 1R3760-1 was developed. This result showed that SECCE1Rv1G0003760 is a stripe rust resistance gene.

[0006] Specifically, the present invention provides the following technical solutions:

[0007] On the one hand, the present invention provides a stripe rust resistance gene, characterized in that the nucleotide sequence of the stripe rust resistance gene is as shown in SEQ ID NO:2 or has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleotide sequence shown in SEQ ID NO:2.

[0008] In another aspect, the present invention provides an expression vector, characterized in that the expression vector comprises the stripe rust resistance gene as described above.

[0009] In another aspect, the present invention provides a host cell, characterized in that the host cell comprises the stripe rust resistance gene or expression vector as described above.

[0010] On the other hand, the present invention provides a method for detecting the presence or absence of a stripe rust resistance gene in a test plant, characterized in that the method comprises detecting the presence of the stripe rust resistance gene or its specific molecular marker according to claim 1, preferably the sequence of the specific molecular marker is as shown in SEQ ID NO:3, preferably using primers shown in SEQ ID NO:4 and SEQ ID NO:5 to detect whether the sequence of SEQ ID NO:3 exists.

[0011] In another aspect, the present invention provides a method for improving the stripe rust resistance of a plant, the method comprising introducing the stripe rust resistance gene or expression vector or host cell as described above into the plant or the cell of the plant.

[0012] In another aspect, the present invention provides a method for breeding a plant resistant to stripe rust, the method comprising introducing the stripe rust resistance gene or expression vector or host cell as described above into the plant or a cell of the plant.

[0013] In another aspect, the present invention provides the use of the stripe rust resistance gene or expression vector or host cell described above in improving the stripe rust resistance of plants or cultivating stripe rust resistant plants.

[0014] On the other hand, the present invention provides a method for obtaining a plant cell or plant carrying a stripe rust resistance gene, characterized in that the method comprises introducing the stripe rust resistance gene or expression vector or host cell as described above into the plant cell or the plant.

[0015] On the other hand, the present invention provides a molecular marker for detecting the presence or absence of a stripe rust resistance gene in a plant to be tested, characterized in that the nucleotide sequence of the molecular marker is shown in SEQ ID NO:3.

[0016] In some embodiments, the plant is wheat or rye.

[0017] In some embodiments, the stripe rust is caused by race CYR32, CYR33, and / or CYR34.

[0018] definition

[0019] GISH: Genomic in situ hybridization, which is developed on the basis of fluorescence in situ hybridization. This technology uses total genomic DNA from one species as a labeled probe, blocks with total genomic DNA from another species at an appropriate concentration, and performs in situ hybridization on the target chromosome. Between the blocking DNA and the labeled DNA probe, the blocking DNA preferentially hybridizes with or non-specific sequences, and the remaining specific sequences are mainly hybridized by the labeled probe, and finally the chromosome sets, chromosomes or chromosome fragments of different sources are detected.

[0020] Inoculation identification: Healthy triticale seedlings are cultivated in a greenhouse, and inoculated by artificially spreading stripe rust spores. After moisturizing and light cultivation, the wheat plants are made diseased to identify the material's stripe rust resistance.

[0021] Nearly immune and highly susceptible: According to the degree of resistance of wheat varieties to stripe rust, the disease resistance of wheat varieties can be divided into six levels: immune, highly resistant, resistant, moderately resistant, moderately susceptible and highly susceptible. Immune means that no visible spore piles are produced on the leaves. Nearly immune means that small dead spots appear on the leaves and no spore piles are produced. Highly susceptible means that the spore piles on the leaves are large and numerous, and the surrounding areas do not turn green.

[0022] Extreme disease resistance and extreme disease susceptibility: The study of disease resistance inheritance mainly uses Mendelian analysis, which is to cross disease-resistant and disease-susceptible plants and analyze the segregation of disease resistance in the offspring. In the F2 segregation population, the most disease-resistant material is the extremely disease-resistant material, and the most susceptible material is the extremely susceptible material.

[0023] BSR: Bulked Segregant RNA-Seq, a quick method to locate the target trait gene using a mixed pool of extreme trait individuals. In the segregated population, select the offspring RNA of extreme traits and mix them in equal amounts. Sequencing is performed on the mixed "Gene Pool" and parents respectively. The frequency (Allele Frequency, AF) of the sequencing data of different libraries at polymorphic sites (SNP) is calculated and associated with the target phenotype, thereby achieving the target trait-related gene location or the development of linked molecular markers.

[0024] Codominant marker: A genetic marker that can detect both dominant and recessive alleles and distinguish between homozygous and heterozygous genotypes.

[0025] Indel marker: Insertion-deletion (InDel) refers to the insertion or deletion of nucleotide fragments of different sizes in the sequence of the same site in the genome between closely related species or different individuals of the same species, that is, one or more bases are inserted or deleted at a certain site on a sequence compared to another homologous sequence. InDel polymorphic molecular markers are markers designed based on the sequences on both sides of the insertion / deletion site for PCR amplification. In essence, they are still length polymorphic markers and can be typed using a convenient electrophoresis platform.

[0026] Ubiqutin promoter: As a constitutive promoter, the ubiquitin (UBQ or Ubi) gene promoter shows significantly higher gene expression levels in most tissues and many types of cells of plants. It has particularly high activity in monocotyledonous plants (such as corn) and is often used to drive overexpression of a gene.

[0027] Specific molecular markers: Specific molecular markers are developed based on functional single nucleotide polymorphisms (SNPs) or insertion and deletion (InDels) sites in gene sequences. They have the advantages of high selection efficiency, co-dominance, co-segregation with target genes, and no influence from genetic background.

[0028] Genome resequencing: A method of sequencing the genomes of different individuals of a species with a known genome sequence. It is used to analyze the differences between genomes of different individuals, such as discovering single nucleotide polymorphism sites, insertion and deletion sites, structural variation sites, and copy number variation sites.

[0029] 1BL / 1RS translocation line: refers to the wheat-rye translocation chromosome formed by translocating the short arm of rye chromosome 1R to the long arm of wheat chromosome 1B. Since the short arm of 1R carries genes for resistance to wheat leaf rust, stem rust, stripe rust and powdery mildew, germplasm containing 1BL / 1RS has been widely used in wheat breeding around the world. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1This is the identification of stripe rust resistance of hexaploid triticale L20191212 and GISH identification of chromosome composition. Figure a is the stripe rust identification of hexaploid triticale L20191212 and 4100. Mingxian 169 (Mingxian 169) was used as a susceptible control. A mixture of three physiological races CYR32, CYR33, and CYR34 was inoculated at the one-leaf and one-heart stage. The phenotype was statistically analyzed 14 days after inoculation. The results showed that L20191212 was nearly immune to stripe rust, and 4100 was highly susceptible to stripe rust. Figures b and c are GISH analyses of triticale L20191212 and 4100, respectively, using the rye genome as a probe (green). The GISH results show that L20191212 and 4100 are both hexaploid triticale.

[0031] Figure 2 The results of stripe rust identification of hexaploid triticale L20191212 and 4100 F2. F2 plants were inoculated with a mixture of three physiological races CYR32, CYR33, and CYR34 at the one-leaf-one-heart stage, and the phenotypes were statistically analyzed 14 days after inoculation. 1, Mingxian 169; 2, L20191212; 3, 4100; 4-6, F2 disease-resistant plants. 7-9, F2 disease-susceptible plants. The results showed that disease resistance segregation occurred in the F2 population, and the F2 disease-resistant plants were significantly different from the F2 disease-susceptible plants.

[0032] Figure 3 The results of the comparison of transcriptome data between the resistant pool and the sensitive pool are shown. It was found that two genes (SECCE1Rv1G0003760 and SECCE1Rv1G0003770) were specifically expressed in the resistant pool, but were lowly expressed or not expressed in the sensitive pool.

[0033] Figure 4These are the amplification results of the SECCE1Rv1G0003760-specific molecular marker 1R3760-1 in triticale and common wheat. The first row is the amplification result of 1R3760-1, and the second row is the amplification result of the internal reference gene Tubilin primer. From left to right are Marker, 6 common wheat varieties (Yannong 19, Chinese Spring, Fielder, Shannong 19, Shannong 20 and Shannong 122), 3 1BL / 1RS translocation lines (Aikang 58, Kenong 199 and Nongda 399), and 18 hexaploid triticale varieties (4100, Rozovskaya-7, L20191212, PI 542533, PI 542560, PI 552974, PI 559373, PI 590946, PI 610226, CIXT33, PI 511870, PI 587384, PI542563, PI 610224, PI 610227, PI 628658, PI 610225, CIXT101). Tubilin primer amplification results show that the DNA used in the present invention is of reliable quality, and 1R3760-1 amplification results show that SECCE1Rv1G0003760 was not detected in 6 common wheats, SECCE1Rv1G0003760 was detected in 3 1BL / 1RS translocation lines, SECCE1Rv1G0003760 was detected in 8 triticale, and the gene was not detected in 10 triticale. This result shows that SECCE1Rv1G0003760 does not exist in common wheat, but exists in 1BL / 1RS translocation lines and triticale.

[0034] Figure 5 The results of resistance to stripe rust of transgenic positive plants are shown. A mixture of three physiological races, CYR32, CYR33, and CYR34, was inoculated at the one-leaf-one-heart stage, and the phenotype was statistically analyzed 14 days after inoculation. The inoculation results showed that the SECCE1Rv1G0003760 transgenic positive material was nearly immune to stripe rust, while the SECCE1Rv1G0003770 transgenic positive material was highly susceptible to stripe rust, proving that SECCE1Rv1G0003760 is a stripe rust resistance gene, while SECCE1Rv1G0003770 is not a stripe rust resistance gene. DETAILED DESCRIPTION

[0035] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings.

[0036] Example 1 Identification of rye stripe rust resistance genes

[0037] The inventors used stripe rust physiological races CYR32, CYR33 and CYR34 for mixed inoculation (the inoculation method refers to the spray (sprinkling) powder method in section 3.3 of the national standard NY / T 1443.1-2007 on the reproduction and preservation of wheat stripe rust. In actual operation, the leaves are covered with a mixture of white talcum powder and spores, and the inoculation effect is judged by the incidence of the susceptible control material) identification (inoculation at the stripe rust identification platform of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) and found that two triticale parents L20191212 (provided by Professor Li Xingfeng of Shandong Agricultural University) and 4100 (provided by Professor Ni Zhongfu of China Agricultural University) showed near immunity and high sensitivity to the three mixed physiological races CYR32, CYR33 and CYR34, respectively. In order to clone the stripe rust resistance gene in L20191212, the two triticale parents were hybridized to obtain F1, and the F2 population was obtained after self-pollination. 389 plants in the F2 population were inoculated and identified, and 301 of them were resistant and 88 were highly susceptible. 40 extremely resistant and 40 extremely susceptible materials were selected from the F2 population to form the resistance pool and the susceptible pool, respectively. Total RNA was extracted from leaves for transcriptome sequencing (transcriptome sequencing was performed at Annoroad Gene Technology Co., Ltd.). BSR (Bulk segregant RNA sequencing) analysis revealed that the stripe rust resistance gene was located on rye chromosome 1R. Using the genome resequencing data of the two parents with a ten-fold sequencing depth, 14 co-dominant Indel markers were developed on chromosome 1R. The F2 composed of 389 plants (the F2 offspring obtained after the hybridization of the two parents, which is the population used for gene positioning, with a disease resistance:susceptibility ratio of 3:1) was used for fine positioning, and the stripe rust resistance gene was further located in the 10Mb interval (corresponding to the Lo7 reference genome 1R: 6.5-16.5Mb). Subsequently, all genes in the interval were analyzed and it was found that there was an R gene cluster in the interval, which contained five typical CC-NBS-LRR type R genes (SECCE1Rv1G0003730-SECCE1Rv1G0003770). Combining the transcriptome data of the anti- and sensitive pools, it was found that two genes (SECCE1Rv1G0003760 and SECCE1Rv1G0003770) were specifically expressed in the anti-pool, but were lowly expressed or not expressed in the sensitive pool ( Figure 3 ), so SECCE1Rv1G0003760 and SECCE1Rv1G0003770 were identified as candidate genes. Using the rye reference genome sequence (https: / / ftp.ebi.ac.uk / ensemblgenomes / pub / release-56 / plants / fasta / secale_cere ale / dna / ), the SECCE1Rv1G0003760 and SECCE1Rv1G0003770 sequences in L20191212 were cloned.

[0038] Table 1 shows the statistical results of stripe rust identification in L20191212 and 4100F2 populations. A total of 389 strains were inoculated, 301 strains were resistant, and 88 strains were highly susceptible, which basically met the 3:1 separation ratio.

[0039]

[0040] Example 2 Detection of rye stripe rust resistance gene

[0041] The genomic DNA of the plant materials to be tested was amplified by PCR using the molecular marker 1R3760-1 primer. The materials that could amplify 1772bp were all those containing SECCE1Rv1G0003760.

[0042] 1R3760-1 Primer F: 5′-GAATCCAGGGTGGGATCGTG-3′ (SEQ ID NO: 4);

[0043] 1R3760-1 Primer R: 5'-TGCCAGTAAAGGTGGTCTCA-3' (SEQ ID NO: 5).

[0044] The F primer is located in the promoter region of the gene, and the R primer is located at the front end of the CDS region.

[0045] Table 2 PCR system

[0046]

[0047] PCR reaction program: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 1 minute, run 35 cycles; finally 72℃ extension for 10 minutes. PCR amplification products can be stored at 4℃.

[0048] PCR product electrophoresis detection system: 1.2% agarose gel electrophoresis, voltage: 120 V, time: 25 minutes, buffer: 1×TAE.

[0049] Example 3 Functional identification of rye stripe rust resistance genes

[0050] The overexpression vectors of SECCE1Rv1G0003760 and SECCE1Rv1G0003770 were constructed using the Ubiqutin promoter. First, the wheat transgenic vector pWMB110 (provided by Mr. Ye Xingguo from the Institute of Crop Science, Chinese Academy of Agricultural Sciences) was linearized using restriction endonucleases kpnI and SacI, and the CDS of SECCE1Rv1G0003760 and SECCE1Rv1G0003770 were amplified using primers with recombination adapters. The above PCR products and linearized vectors were recovered using the Tiangen Universal DNA Purification and Recovery Kit, and the linearized vector was connected to the amplified gene fragment using the Tiangen EasyGeno Recombination Cloning Kit. The wheat variety Yannong 19, which is highly susceptible to stripe rust, was genetically transformed (the transformation method refers to Chinese patent ZL201710422896.6). The SECCE1Rv1G0003760 transgenic positive plants showed improved stripe rust resistance compared with the control, indicating that the SECCE1Rv1G0003760 gene from rye can confer stripe rust resistance to wheat.

[0051] Table 3 pWMB110 vector linearization system

[0052] drug Volume (μl) factory Specification CutSmart Buffer 5 NEW ENGLAND 1.25ml i 1 NEW ENGLAND 0.4ml SacI 1 NEW ENGLAND 0.1ml pWMB110 plasmid 10 250ng / ul <![CDATA[ddH2O]]> 33 Total 50

[0053] Incubate at 37°C for 3 hours.

[0054] Amplification of the gene CDS using recombination primers was as described above, and the primers used were as follows:

[0055] 3760-110-F:GGTCGACTCTAGAGGATCCCCGGGTACCGAATGGATATTGTCACGGGTGC(SEQ IDNO:6)

[0056] 3760-110-R:TGAACGATCGGGGAAAATTCGAGCTCTCAGATCTCCTCGTCCTCGC(SEQ ID NO:7)

[0057] 3770-110-F:GGTCGACTCTAGAGGATCCCCGGGTACCGAATGGATATTGTCACGGGTGC(SEQ IDNO:8)

[0058] 3770-110-R:TGAACGATCGGGGAAATTCGAGCTCTCAGTTCTCCT CACACAAAT(SEQ ID NO:9)

[0059] The PCR products and linearized vectors were purified and recovered according to the Tiangen Universal DNA Purification and Recovery Kit (TIANGEN Catalog No.: DP214-03).

[0060] The gene fragment was connected to the linearized pWMB110 vector using a recombination method, and the specific steps were carried out according to the Tiangen EasyGeno recombination cloning kit (TIANGEN catalog number: VI201-02).

[0061] Table 4 Statistical results of stripe rust inoculation of transgenic plants

[0062]

[0063] The disease-resistant triticale parent L20191212 was nearly immune to stripe rust, while the susceptible parent 4100 was highly susceptible to stripe rust. The transgenic receptor material Yannong 19 and the SECCE1Rv1G0003770 transgenic material were both highly susceptible to stripe rust, while the SECCE1Rv1G0003760 transgenic positive material was nearly immune to stripe rust, indicating that SECCE1Rv1G0003760 is a stripe rust resistance gene.

[0064] sequence

[0065] SEQ ID NO: 1 CDS sequence of SecCE1Rv1G0003760, a reference genome gene of rye Lo7 (2889 bp):

[0066] ATGGATATTGTCACGGGTGCCATTGCCAAGCTGATCCCCAAGCTGGGAGAACTGCTTGTAGGGGAGTACAAGCTGCACAAGGGCGTCAGGAAAAATATCGAGGACCTCCTGAAAGAGCTCAACACCATGAACGCTGCGCTCATCAAGATTGGTGAGGTGCCGCCGGACCAGCTCGACAGCCAAGACAAGCTTTGGGGCGATGAGGTCAGAGAGCTCTCCTACGTCATTGAGGATGTGGTGGACAAGTTCCTCGTACGGGTCCATGGCATTGAGCCCGACGACAACACCAACGGATTCAAGGGGCTCGTCAAGAGGACCACCAAGTTGTTGAAGAAGGTCGTGGATAAGCATGGGATAGCTCACGCGATCAAGGACATCAAGAAGGAACTCCATGAGGTGGCTGCTAGGCGTGACAGGAACAAGTTCGATGGTATTGCTTCTACTCCTACTGAAGCAATCGA

[0067] TCCTCGTCTTCATGCTCTGTACATAGAAGCCGCAGAGCTAGTTGGCAT

[0068] CTATGGGAAGAGGGATCAGGCACTCATGAGTTTGCTCTCCTTGGAGG

[0069] GCGATGATGCCTCTACCAAGAAACTGAAGAAGGTCTCCATTGTTGGA

[0070] TTTGGAGGGTTGGGCAAGACCACTCTTGCCAGAGCAGTATACGAGA

[0071] AGATTAAAGGTGATTTTGGTTGCCACGCATTTGTTCCTGTCGGGCAG

[0072] AACCCTGATATCAAGAAGGTTTTCAGGGATATCCTCATTGACCTCCGA

[0073] AAATCAAACTCAGATCCTAGCAACTCTAACTCAGATCTTGTGATACT

[0074] GGATGCAACACAGCTTATCGACAAGCTTCGTGAATTCCTTGAGAACA

[0075] AGAGGTACCTCGTAATAATTGATGATATATGGGATGAAAAATTGTGGA

[0076] GATACATCAACCTTGCTTTCTCTATCAATAACAATCTAGGAAGTCGGC

[0077] TAATCACCACAACCCGAGATTTCGATGTCTCCAAATCATGCTGCTCAT

[0078] CAGCTGATGATTCAATTTATCATATGAAACCTCTTTGTACCAATGACT

[0079] CCAGAAGGCTCTTCTATAAAAGAGTATTTGCCGACGCTAGTGGATGT

[0080] CCAAGTGAATTTGAACAAGTGTCTAAAGATATATTGAAGAAATGTGG

[0081] CGGGGTACCACTAGCCATCATTACTATTGCAAGTGCTTTGGCTAGTGG

[0082] CCAGCAAGTGAAACCAAAGCATGAGTGGGATATTCTACTCCAGTCCC

[0083] TTGGCTCCGGAGTAACAAAAGATAATAGTTTGGCTGAGATGCGGAGA

[0084] ATACTATCTTTCAGCTATTATAATCTACCGTCTCATCTGAAAACTTGTC

[0085] TACTTTACCTATGTATATATCCAGAAGATAGCACCATTGGTAGAGATAG

[0086] ACTGATATGGAAGTGGGTGGCCGAAGGATTTGTCCACCATGGAGATC

[0087] AAGGGACCAGCCTGTTTTTGGTCGGATTAAACTACTTCAACCAGCTC

[0088] ATTAATAGAAGTATGATCCAGCCTATATATGATATGCAGGGCCAGGTAT

[0089] ATGCTTGCCGTGTACATGATATGGTTCTGGACCTTATCTTGCAACTTGT

[0090] CACATGAAGCAAAGTTTGTTAATCTATTGGATGCCACTGGGAATAGC

[0091] ACATCTTCACAAAGTAATGTTCGTCGTTTGTCCCTTCAGAATAAAAAT

[0092] GAAGATCATCAAGCCAAGCCTCTCACAAATATCATGAGTATGTCACG

[0093] AGTGAGGTCCATTACTATCTTTCCACCTGCTGTTAGTATCATGCCAAG

[0094] TCTGTCAATGTTTGAAGTTCTGAGTGTACTTGATCTGTCGAACTGTGA

[0095] TTTGGGACAAAGTAGCAGCCTGCAGCTTAACCTAAAGGGTGTTGTAC

[0096] ATTTAATCCACCTAAGGTACCTTGGTCTAGCAGGCACTCAAATTAGTG

[0097] AACTCCCGACTGAGATAGGAAACCTGCAGTTTTTGGAGGTGTTGGAT

[0098] CTTGGAGATAATTATGAGCTAGATGAATTGCCTTCCACTCTTTTCAAA

[0099] TTGAGAAGATTAATCTACCTAAATGTTTATCTCTTTAAGGTGGTTCCA

[0100] ACTCCTGGTGTGTTGCAGAATCTGACATGCATAGAAGTGTTGAGGGG

[0101] GATCTTGGTCTCTCTGAACATTATTGCACAAGAGCTTGGCAACCTGG

[0102] CAAGGCTGAGGGAGCTTTCGATTCGCTTCAAGGATGGTAGTTTGGAT

[0103] TTGTATGAAGGTTTCGTGAATTCTCTGTGCAACCTACATCACATAGAA

[0104] TGCCTAAGTATTGGTTGGAATTCTGAAAAAACGTCTTTTGAACTGAT

[0105] GGATCTCTTGGGAGAACGCTGGGTGCCTCCTGTACATCTCCGCGAAT

[0106] TTGTGTCTAGGATGCCCAGCCAACTCTCTGCACTGCGAGGGTGGACA

[0107] AAGAGAGACCCCTCGCATCTCTCCAACCTCTCCAAGTTAATCCTCTC

[0108] GTCAGTGAAGGAAGTGCAGCAGGAGGACGTGGAAATCATTGGGGG

[0109] GTTGCTGTCCCTTCGCCGTCTCTGGATAAAGAGCACCCACCAAACAC

[0110] AGCGGCTGCTAGTCATCCCTACAGATGGGTTCCGCTGTATGGTAGAAT

[0111] TTTACTTGAATTGTGGGTTAGCAGCGCAGATAATGTTTGAACCAGGA

[0112] GCTTTGCCGAGGGCGGAAGAAGTTACGTTCAGCCTGGGCGTGCGGG

[0113] TGGCAAAAGAGGATGGAAACTGTGGCTTCGAATTGGGCGTGCAGGG

[0114] GAACCTGCTCTCCCTTCGGCGGCAGGTCTGGGTTAGGATGTATTGTG

[0115] GTGGAGTGAGGGTTGGGGAGGCAAAGAAAGCGGAGGCTGCGGTGA

[0116] GGCACGCACTCGAAGCCCATCCCAATCATCCCAGGATTTATATTGATA

[0117] TGTGCCCGCGTATAGCAGAAGATGCTCATGATGACGATTTGTGCGAG

[0118] GACGAGGAGATCTGA

[0119] SEQ ID NO:2 CDS sequence (2889bp) of SECCE1Rv1G0003760 in hexaploid triticale L20191212:

[0120] ATGGATATTGTCACGGGTGCCATTGCCAAGCTGATCCCCAAGCTGGGAGAACTGCTTGTAGGGGAGTACAAGCTGCACAAGGGCGTCAGGAAAAATATCGAGGACCTCCTGAAAGAGCTCAACACCATGAACGCTGCGCTCATCAAGATTGGTGAGGTGCCGCCGGACCAGCTCGACAGCCAAGACAAGCTTTGGGGCGATGAGGTCAGAGAGCTCTCCTACGTCATTGAGGATGTGGTGGACAAGTTCCTCGTACGGGTCCATGGCATTGAGCC

[0121] CGACGACAACACCAACGGATTCAAGGGGCTCGTCAAGAGGACCACC

[0122] AAGTTGTTGAAGAAGGTCGTGGATAAGCATGGGATAGCTCACGCGAT

[0123] CAAGGACATCAAGAAGGAACTCCATGAGGTGGCTGCTAGGCGTGAC

[0124] AGGAACAAGTTCGATGGTATTGCTTCTACTCCTACTGAAGCAATCGA

[0125] TCCTCGTCTTCATGCTCTGTACATAGAAGCCGCAGAGCTAGTTGGCAT

[0126] CTATGGGAAGAGGGATCAGGCACTCATGAGTTTGCTCTCCTTGGAGG

[0127] GCGATGATGCCTCTACCAAGAAACTGAAGAAGGTCTCCATTGTTGGA

[0128] TTTGGAGGGTTGGGCAAGACCACTCTTGCCAGAGCAGTATACGAGA

[0129] AGATTAAAGGTGATTTTGGTTGCCACGCATTTGTTCCTGTCGGGCAG

[0130] AACCCTGATATCAAGAAGGTTTTCAGGGATATCCTCATTGACCTCCGA

[0131] AAATCAAACTCAGATCCTAGCAACTCTAACTCAGATCTTGTGATACT

[0132] GGATGCAACACAGCTTATCGACAAGCTTCGTGAATTCCTTGAGAACA

[0133] AGAGGTACCTCGTAATAATTGATGATATATGGGATGAAAAATTGTGGA

[0134] GATACATCAACCTTGCTTTCTCTATCAATAACAATCTAGGAAGTCGGC

[0135] TAATCACCACAACCCGAGATTTCGATGTCTCCAAATCATGCTGCTCAT

[0136] CAGCTGATGATTCAATTTATCATATGAAACCTCTTTGTACCAATGACT

[0137] CCAGAAGGCTCTTCTATAAAAGAGTATTTGCCGACGCTAGTGGATGT

[0138] CCAAGTGAATTTGAACAAGTGTCTAAAGATATATTGAAGAATGTGG

[0139] CGGGGTACCACTAGCCATCATTACTATTGCAAGTGCTTTGGCTAGTGG

[0140] CCAGCAAGTGAAACCAAAGCATGAGTGGGATATTCTACTCCAGTCCC

[0141] TTGGCTCCGGAGTAACAAAAGATAATAGTTTGGCTGAGATGCGGAGA

[0142] ATACTATCTTTCAGCTATTATAATCTACCGTCTCATCTGAAAACTTGTC

[0143] TACTTTACCTATGTATATATCCAGAAGATAGCACCATTGGTAGAGATAG

[0144] ACTGATATGGAAGTGGGTGGCCGAAGGATTTGTCCACCATGGAGATC

[0145] AAGGGACCAGCCTGTTTTTGGTCGGATTAAACTACTTCAACCAGCTC

[0146] ATTAATAGAAGTATGATCCAGCCTATATATGATATGCAGGGCCAGGTAT

[0147] ATGCTTGCCGTGTACATGATATGGTTCTGGACCTTATCTTGCAACTTGT

[0148] CACATGAAGCAAAGTTTGTTAATCTATTGGATGCCACTGGGAATAGC

[0149] ACATCTTCACAAAGTAATGTTCGTCGTTTGTCCCTTCAGAATAAAAAT

[0150] GAAGATCATCAAGCCAAGCCTCTCACAAATATCATGAGTATGTCACG

[0151] AGTGAGGTCCATTACTATCTTTCCACCTGCTGTTAGTATCATGCCAAG

[0152] TCTGTCAATGTTTGAAGTTCTGAGTGTACTTGATCTGTCGAACTGTGA

[0153] TTTGGGACAAAGTAGCAGCCTGCAGCTTAACCTAAAGGGTGTTGTAC

[0154] ATTTAATCCACCTAAGGTACCTTGGTCTAGCAGGCACTCAAATTAGTG

[0155] AACTCCCGACTGAGATAGGAAACCTGCAGTTTTTGGAGGTGTTGGAT

[0156] CTTGGAGATAATTATGAGCTAGATGAATTGCCTTCCACTCTTTTCAAA

[0157] TTGAGAAGATTAATCTACCTAAATGTTTATCTCTTTAAGGTGGTTCCA

[0158] ACTCCTGGTGTGTTGCAGAATCTGACATGCATAGAAGTGTTGAGGGG

[0159] GATCTTGGTCTCTCTGAACATTATTGCACAAGAGCTTGGCAACCTGG

[0160] CAAGGCTGAGGGAGCTTTCGATTCGCTTCAAGGATGGTAGTTTGGAT

[0161] TTGTAGGAAGGTTCGTGAATTCTCTGTGCAACCTACATCACATAGAA

[0162] TGCCTAAGTATTGGTTGGAATTCTGAAAAAACGTCTTTTGAACTGAT

[0163] GGATCTCTTGGGAGAACGCTGGGTGCCTCCTGTACATCTCCGCGAAT

[0164] TTGTGTCTAGGATGCCCAGCCAACTCTCTGCACTGCGAGGGTGGACA

[0165] AAGAGAGACCCCTCGCATCTCTCCAACCTCTCCAAGTTAATCCTCTC

[0166] GTCAGTGAAGGAAGTGCAGCAGGAGGACGTGGAAATCATTGGGGG

[0167] GTTGCTGTCCCTTCGCCGTCTCTGGATAAAGAGCACCCACCAAACAC

[0168] AGCGGCTGCTAGTCATCCCTACAGATGGGTTCCGCTGTATGGTAGAAT

[0169] TTTACTTGAATTGTGGGTTAGCAGCGCAGATAATGTTTGAACCAGGA

[0170] GCTTTGCCGAGGGCGGAAGAAGTTACGTTCAGCCTGGGCGTGCGGG

[0171] TGGCAAAAGAGGATGGAAACTGTGGCTTCGAATTGGGCGTGCAGGG

[0172] GAACCTGCTCTCCCTTCGGCGGCAGGTCTGGGTTAGGATGTATTGTG

[0173] GTGGAGTGAGGGTTGGGGAGGCAAAGAAAGCGGAGGCTGCGGTGA

[0174] GGCACGCACTCGAAGCCCATCCCAATCATCCCAGGATTTATATTGATA

[0175] TGTGCCCGCGTATAGCAGAAGATGCTCATGATGACGATTTGTGCGAG

[0176] GACGAGGAGATCTGA

[0177] SEQ ID NO:3 1R3760-1 amplification sequence:

[0178] GAATCCAGGGTGGGATCGTGGGGCTCTGTATCTATCTAGTTTAGAGTACTATTGTACTTCCTCTGCTCCTCGTCTCCGCTTCCTCTCAGTCTCCTCCATTGATTTGCGTTGGTTGAACAGAGAGCACGATGCATCGAAGGC

[0179] ACTGACCCGACTAGCGGCCTGGTAAAAATTTCCCTCCCATCTTTCTTG

[0180] CTATTCTCTTCTTATTAATCTGCTGATTTGCTAGATTGTAAGTTCTTATT

[0181] ACTTATTCTTCCAGATCGAGTGAAGCAACCTCCGCTGCCGTGTTGTC

[0182] CCCTACGACGCAGTTGTGTCCTGCTCTTCTGGTGAAGCATCAACGGT

[0183] GATGGCCATCCGGTGTTGATGCCGCCGCTGTGTGCTGCTCTGCCGTG

[0184] AAGTATCAAAGGTGGGTTTGGATGGATATCGCAGTTTGGATTGGCAA

[0185] CTCAGTTCTAGAGCTCGTTGAAATTAAAGCGTCACACTGTTTGGATT

[0186] GGATTACAGCTACAGCTCCCCATATTCATCTATTTTGTAGGTTTCCGGT

[0187] TATTATTCAGAGCAACACGCTCACGGATCTGGCCTCTGGTGCCCAGC

[0188] CGCCACTTCCGCTTTGTTGTCCCCACAGCGCGACCATCCGACGAAGA

[0189] CGCCGCCGTTGTGTTCTGCTCTACTGTGAAGCACCAAAGGTGGGCTT

[0190] GGTCCAGATCCCTACATTCATCGATTTGGCTTGGCAACTCTGTTCTAG

[0191] AGCTTGGATTGTGTTACAGATCCCTACATTCATCGATTTGCAGGTTTC

[0192] CAGCTGATTGATCCAGAGGGCTCTCATGGATATTGTCACGGGTGCCA

[0193] TTGCCAAGCTGATCCCCAAGCTGGGAGAACTGCTTGTAGGGGAGTA

[0194] CAAGCTGCACAAGGGCGTCAGGAAAAATATCGAGGACCTCCTGAAA

[0195] GAGCTCAACACCATGAACGCTGCGCTCATCAAGATTGGTGAGGTGC

[0196] CGCCGGACCAGCTCGACAGCCAAGACAAGCTTTGGGGCGATGAGGT

[0197] CAGAGAGCTCTCCTACGTCATTGAGGATGTGGTGGACAAGTTCCTCG

[0198] TACGGGTCCATGGCATTGAGCCCGACGACAACACCAACGGATTCAA

[0199] GGGGCTCGTCAAGAGGACCACCAAGTTGTTGAAGAAGGTCGTGGAT

[0200] AAGCATGGGATAGCTCACGCGATCAAGGACATCAAGAAGGAACTCC

[0201] ATGAGGTGGCTGCTAGGCGTGACAGGAACAAGTTCGATGGTATTGCT

[0202] TCTACTCCTACTGAAGCAATCGATCCTCGTCTTCATGCTCTGTACATA

[0203] GAAGCCGCAGAGCTAGTTGGCATCTATGGGAAGAGGGATCAGGCAC

[0204] TCATGAGTTTGCTCTCCTTGGAGGGCGATGATGCCTCTACCAAGAAA

[0205] CTGAAGAAGGTCTCCATTGTTGGATTTGGAGGGTTGGGCAAGACCA

[0206] CTCTTGCCAGAGCAGTATACGAGAAGATTAAAGGTGATTTTGGTTGC

[0207] CACGCATTTGTTCCTGTCGGGCAGAACCCTGATATCAAGAAGGTTTT

[0208] CAGGGATATCCTCATTGACCTCCGAAAATCAAACTCAGATCCTAGCA

[0209] ACTCTAACTCAGATCTTGTGATACTGGATGCAACACAGCTTATCGAC

[0210] AAGCTTCGTGAATTCCTTGAGAACAAGAGGTATGCATCACTTACAGC

[0211] AAAATTGTGCACTATTATGACATGATTATTTCATATGCTAGTTGTACAA

[0212] GTAATACCGAAAGTGTCTAAACATATTGTAGCGGGAGGGTTCAGAAT

[0213] AATTTTTCCATTGAGACCACCTTTACTGGCA

[0214] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A stripe rust resistance gene, characterized in that: The nucleotide sequence of the stripe rust resistance gene is as shown in SEQ ID NO:2 or has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity with the nucleotide sequence shown in SEQ ID NO:

2.

2. An expression vector, characterized in that The expression vector comprises the stripe rust resistance gene according to claim 1.

3. A host cell, characterized in that The host cell comprises the stripe rust resistance gene according to claim 1 or the expression vector according to claim 2.

4. A method for detecting the presence or absence of a stripe rust resistance gene in a test plant, characterized in that: The method comprises detecting the presence of the stripe rust resistance gene or its specific molecular marker according to claim 1, preferably the sequence of the specific molecular marker is as shown in SEQ ID NO:3, preferably using primers shown in SEQ ID NO:4 and SEQ ID NO:5 to detect whether the sequence of SEQ ID NO:3 exists.

5. A method for improving a plant's resistance to stripe rust or cultivating a plant resistant to stripe rust, the method comprising introducing the stripe rust resistance gene according to claim 1 or the expression vector according to claim 2 into the plant or a cell of the plant.

6. A method for obtaining a plant cell or plant carrying a stripe rust resistance gene, characterized in that: The method comprises introducing the stripe rust resistance gene according to claim 1 or the expression vector according to claim 2 into the plant cell or the plant.

7. Use of the stripe rust resistance gene according to claim 1, the expression vector according to claim 2, or the host cell according to claim 3 in improving the stripe rust resistance of plants or cultivating stripe rust resistant plants.

8. A molecular marker for detecting the presence or absence of a stripe rust resistance gene in a plant to be tested, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

3.

9. The method according to any one of claims 4, 5 or 6, the use according to claim 7 or the molecular marker according to claim 8, characterized in that: The plant is wheat or rye.

10. The stripe rust resistance gene according to claim 1, or the method according to any one of claims 4, 5 or 6, or the use according to claim 7, or the molecular marker according to claim 8, characterized in that: The stripe rust is caused by physiological races CYR32, CYR33 and / or CYR34.

Images