NCgl0762 gene mutant and application thereof in preparation of L-lysine

Abstract

The invention discloses an NCgl0762 gene mutant and an application of the NCgl0762 gene mutant in preparation of L-lysine. The invention provides an NCgl0762 protein mutant. The NCgl0762 protein mutant comprises any one of the following proteins: a protein obtained by replacing L at the 21st site of an NCgl0762 protein as shown in SEQ ID No.2 with other amino acids; or a protein which is derived from bacteria, has more than 95% of identity with the protein and is related to the production of L-amino acid by the bacteria; or a protein which is obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein and is related to production of L-amino acid by bacteria; or a fusion protein obtained by connecting a label to the N end and / or C end of the protein. The invention proves that NCgl0762C61A is subjected to point mutation in the coding region of the NCgl0762 gene in corynebacterium glutamicum, so that the yield of L-lysine can be obviously increased. The invention has important significance on the yield of L-lysine.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS: This application claims priority to the Chinese patent application (application number 202410254359.5) filed on March 6, 2024, the entire contents of which are incorporated herein by reference. Technical Field

[0002] The present invention relates to the field of biotechnology, and specifically to NCgl0762 Gene mutant and its application in preparing L-lysine. Background Art

[0003] Due to its characteristics as an essential amino acid, L-Lysine has become the world's second largest amino acid production variety, of which about 90% of the products are used as feed additives. With the continuous development of society, its demand has also increased year by year. Traditional lysine production strains are obtained by random mutation screening. In recent years, with the development of modern biotechnology and the gradual clarification of biological metabolic processes, people have been able to use genetic recombination technology to improve lysine production by modifying the lysine metabolic pathway. For example, overexpressing key genes involved in L-lysine synthesis in microbial strains to increase their activity; or deleting genes that do not need to be expressed in microbial strains (byproducts or toxins that affect cell growth, etc.). However, as the global demand for L-lysine increases year by year, a lot of research is still needed to find useful genes for mutation screening and improve their expression activity, so as to effectively increase L-lysine production capacity.

[0004] NCgl0762 The product encoded by the gene has not yet been studied and is a hypothetical protein. NCgl0762 Report on mutation of C to A at position 61 of the gene. Summary of the invention

[0005] The object of the present invention is to provide NCgl0762 Gene mutant and its application in preparing L-lysine.

[0006] In a first aspect, the present invention claims protection for NCgl0762 protein mutants.

[0007] The NCgl0762 protein mutant claimed in the present invention comprises (or is) any one of the following: (A1) Protein obtained by replacing the 21st amino acid residue of NCgl0762 protein from L to other amino acids; (A2) a protein derived from bacteria and having more than 95% identity with the protein defined in (A1) and related to the production of L-amino acids (such as L-lysine) by bacteria; (A3) a protein derived from (A1) or (A2) that is related to the production of L-amino acids (such as L-lysine) by bacteria, obtained by substituting and / or deleting and / or adding one or more amino acid residues to the protein defined in (A1) or (A2); (A4) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1) to (A3).

[0008] Wherein, the amino acid sequence of the NCgl0762 protein comprises SEQ ID No.2.

[0009] In the present invention, the Chinese and English names, three-letter abbreviations and single-letter symbols of each amino acid are shown in Table 1: Table 1. Chinese and English names, three-letter abbreviations and single-letter symbols of amino acids

[0010] The term "identity" as used herein refers to sequence similarity to a natural amino acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0011] The 95% or greater identity may specifically be 96% or greater identity, or 97% or greater identity, or 98% or greater identity, or 99% or greater identity.

[0012] Furthermore, the NCgl0762 protein mutant is a protein obtained by replacing the 21st amino acid residue of the NCgl0762 protein from L to I. That is, the NCgl0762 protein mutant is the protein shown in SEQ ID No.4.

[0013] In a second aspect, the present invention claims biological material.

[0014] The biological material claimed in the present invention includes (or is) any of the following: (I) a nucleic acid molecule encoding the NCgl0762 protein mutant described in the first aspect above; (II) an expression cassette containing the nucleic acid molecule described in (I); (III) a recombinant vector containing the nucleic acid molecule described in (I) or a recombinant vector containing the expression cassette described in (II); (IV) a recombinant microorganism containing the nucleic acid molecule described in (I), a recombinant microorganism containing the expression cassette described in (II), or a recombinant microorganism containing the recombinant vector described in (III); (V) a recombinant host cell containing the nucleic acid molecule of (I) or a recombinant host cell containing the expression cassette of (II) or a recombinant host cell containing the recombinant vector of (III).

[0015] Furthermore, the nucleic acid molecule comprises (or is) any one of the following: (B1) DNA molecule shown in SEQ ID No. 3; (B2) a DNA molecule that hybridizes with the DNA molecule defined in (B1) under stringent conditions and encodes the NCgl0762 protein mutant; (B3) A DNA molecule having more than 80% identity with any of the DNA sequences defined in (B1) to (B2) and encoding the NCgl0762 protein mutant.

[0016] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0017] The 80% or more identity may specifically be 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity.

[0018] The stringent conditions may be hybridization and membrane washing in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS at 65°C.

[0019] Furthermore, the vector may be a plasmid, a cosmid, a phage or a viral vector.

[0020] Further, the expression cassette is composed of a promoter, the nucleic acid molecule whose expression is driven by the promoter, and a transcription termination sequence; the promoter is functionally connected to the nucleic acid molecule, and the nucleic acid molecule is connected to the transcription termination sequence. Further, the expression cassette may also include an enhancer.

[0021] Furthermore, the recombinant microorganism is a recombinant microorganism containing the expression cassette or the recombinant vector.

[0022] The microorganism may be yeast, bacteria, algae or fungi. Among them, the bacteria may be Corynebacterium glutamicum ( Corynebacterium glutamicum )、Brevibacterium lactofermentum、Brevibacterium flavum( brevibacterium flavum)、Corynebacterium pekinensis( Corynebacterium pekinense ), Brevibacterium ammoniaphagen, Corynebacterium scutellariae, or Pantoea ammoniaca ( Pantoea ). Further, the bacterium is Corynebacterium glutamicum. Further, the Corynebacterium glutamicum is Corynebacterium glutamicum ( Corynebacterium glutamicum ) ATCC13032 or Corynebacterium glutamicum ( Corynebacterium glutamicum )YP097158.

[0023] In the present invention, the recombinant microorganism is a recombinant bacterium.

[0024] Furthermore, the recombinant bacteria are recombinant bacteria.

[0025] Furthermore, the recombinant bacteria may be a gene in the genome of the recipient bacteria that has the highest identity with the gene encoding the NCgl0762 protein described in the first aspect above (e.g. NCgl0762 The gene) is replaced by the nucleic acid molecule described in the second aspect above. NCgl0762 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0026] Specifically, the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the NCgl0762 protein described in the first aspect above (such as NCgl0762 The replacement of the nucleic acid molecule with the nucleic acid molecule described in the second aspect above can be achieved by mutating position 61 of SEQ ID No. 1 in the genome of the recipient bacteria from C to A (other nucleotide sequences remain unchanged).

[0027] In a specific embodiment of the present invention, the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the NCgl0762 protein described in the first aspect above (e.g. NCgl0762 The nucleic acid molecule described in the second aspect above is replaced by the recombinant vector pK18-NCgl0762 in the embodiment introduced into the recipient bacteria. C61A The recombinant vector pK18-NCgl0762 C61A To transfer the pK18mobsacB vector Xba I and / BamH The small fragment between the I recognition sites was replaced with the DNA fragment shown in SEQ ID No.5, and the other sequences of the pK18mobsacB vector were kept unchanged to obtain the recombinant vector. Recombinant vector pK18-NCgl0762 C61A Containing the mutant gene shown in SEQ ID No.3 (the 568th to 792nd positions of SEQ ID No.5 are SEQ ID No.3) NCgl0762C61A .

[0028] Furthermore, the recombinant bacterium may also be obtained by introducing the nucleic acid molecule described in the second aspect above or the expression cassette or recombinant vector described in the third aspect above into a recipient bacterium.

[0029] In a third aspect, the present invention claims protection for any of the following applications: (C1) Use of the NCgl0762 protein mutant described in the first aspect or the biomaterial described in the second aspect in the production of L-amino acids; (C2) Use of the NCgl0762 protein mutant described in the first aspect or the biomaterial described in the second aspect in improving bacterial L-amino acid production; (C3) Use of the NCgl0762 protein mutant described in the first aspect or the biomaterial described in the second aspect in constructing an engineered strain producing L-amino acids.

[0030] In a fourth aspect, the present invention claims protection for any of the following methods: Method I: A method for increasing bacterial L-amino acid production, comprising the following steps: increasing the expression and / or activity of the NCgl0762 protein mutant described in the first aspect above in a recipient bacterium to achieve an increase in the bacterial L-amino acid production.

[0031] Method II: A method for constructing an L-amino acid producing engineered strain, comprising the following steps: increasing the expression and / or activity of the NCgl0762 protein mutant described in the first aspect above in a recipient bacterium to obtain the L-amino acid producing engineered strain.

[0032] Furthermore, increasing the expression and / or activity of the NCgl0762 protein mutant in the recipient bacteria may be achieved by any of the following methods: (D1) the gene in the genome of the recipient bacterium with the highest identity to the gene encoding the NCgl0762 protein described in the first aspect above (the wild-type gene, such as NCgl0762 gene)) is replaced with the nucleic acid molecule (mutated gene) described in the second aspect above; (D2) Introducing the nucleic acid molecule described in the second aspect above or the expression cassette or recombinant vector described in the third aspect above into the recipient bacterium.

[0033] Furthermore, in (D1), the gene encoding the NCgl0762 protein (i.e. NCgl0762 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0034] Specifically, in (D1), the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the NCgl0762 protein described in the first aspect above (e.g. NCgl0762 The replacement of the nucleic acid molecule with the nucleic acid molecule described in the second aspect above can be achieved by mutating position 61 of SEQ ID No. 1 in the genome of the recipient bacteria from C to A (other nucleotide sequences remain unchanged).

[0035] In a specific embodiment of the present invention, the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the NCgl0762 protein described in the first aspect above (e.g. NCgl0762 The nucleic acid molecule described in the second aspect above is replaced by the recombinant vector pK18-NCgl0762 in the embodiment introduced into the recipient bacteria. C61A achieved.

[0036] Furthermore, in the method, the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the NCgl0762 protein described in the first aspect above (such as NCgl0762 After the gene) is replaced with the nucleic acid molecule described in the second aspect above, the method further comprises the step of fermenting the obtained recombinant bacteria. The L-amino acid (such as L-lysine) can be obtained from the fermentation product.

[0037] The fermentation culture can be carried out by a person skilled in the art using methods in the prior art, or by optimizing and improving the fermentation method through routine experiments. The fermentation culture can be carried out in a suitable culture medium under fermentation conditions known in the art. The culture medium may contain: a carbon source, a nitrogen source, trace elements and combinations thereof. During the culture, the pH of the culture can be adjusted (e.g., the pH is controlled to be 7.0). During the culture, the temperature of the culture can be 30 to 40° C. (e.g., 30° C.). During the culture, the rotation speed is controlled (e.g., the rotation speed is controlled to be 220 rpm). During the culture, the fermentation time can be controlled (e.g., the fermentation time is controlled to be 48 h).

[0038] In a specific embodiment of the present invention, the formula of the culture medium used in the fermentation culture is shown in Table 3, and the balance is water. When the fermentation culture is carried out, the fermentation control process is shown in Table 4. In the above aspects, the bacterium is a bacterium having the ability to produce L-amino acid (such as L-lysine).

[0039] "Bacteria capable of producing L-amino acids (such as L-lysine)" means that the bacteria have the following abilities: the ability to produce and accumulate L-amino acids (such as L-lysine) in the bacteria using external substances (such as culture medium), and further the ability to secrete L-amino acids (such as L-lysine) into the culture system. Thus, L-amino acids (such as L-lysine) can be collected when the bacteria are cultured in the culture medium.

[0040] The bacteria may be wild-type bacteria collected naturally or modified bacteria.

[0041] "Modified bacteria" refers to modified bacteria obtained by artificially mutating and / or inducing mutations in naturally collected wild-type bacteria.

[0042] Specifically, the bacterium may be Corynebacterium glutamicum. In a specific embodiment of the present invention, the Corynebacterium glutamicum is Corynebacterium glutamicum ( Corynebacterium glutamicum ) ATCC13032 or Corynebacterium glutamicum ( Corynebacterium glutamicum )YP097158.

[0043] Accordingly, the recombinant microorganism (recombinant bacteria) claimed in the third aspect above is specifically the recombinant bacteria NCgl0762-1 or the recombinant bacteria YPL-NCgl0762-1.

[0044] The recombinant bacteria NCgl0762-1 and Corynebacterium glutamicum ( Corynebacterium glutamicum )ATCC13032 is only different in that: the recombinant bacterium NCgl0762-1 is a recombinant bacterium of Corynebacterium glutamicum ( Corynebacterium glutamicum ) ATCC13032 genome NCgl0762 Gene (SEQ ID No.1) is replaced by the mutated gene NCgl0762 C61A A strain is obtained by mutating the 61st position of SEQ ID No.1 from C to A and keeping other sequences unchanged.

[0045] The recombinant bacteria YPL-NCgl0762-1 and the Corynebacterium glutamicum ( Corynebacterium glutamicum )YP097158 is different in that: the recombinant bacteria YPL-NCgl0762-1 is the Corynebacterium glutamicum ( Corynebacterium glutamicum )YP097158 genome NCgl0762 Gene (SEQ ID No.1) is replaced by the mutated gene NCgl0762 C61AA strain is obtained by mutating the 61st position of SEQ ID No.1 from C to A and keeping other sequences unchanged.

[0046] In the above aspects, the L-amino acid is L-lysine.

[0047] In a fifth aspect, the present invention claims protection for a recombinant Corynebacterium glutamicum.

[0048] The recombinant Corynebacterium glutamicum claimed in the present invention includes (or is) a recombinant Corynebacterium glutamicum obtained by enhancing the activity of a protein having an amino acid sequence comprising SEQ ID No. 2 in Corynebacterium glutamicum.

[0049] In the sixth aspect, the present invention claims protection for the use of the NCgl0762 protein mutant described in the first aspect above, the biological material described in the second aspect above, or the recombinant Corynebacterium glutamicum described in the fifth aspect above in the preparation of food, cosmetics, medicine or feed containing L-lysine.

[0050] The NCgl0762 protein mutant of the present invention can be used to produce a variety of products, including but not limited to lysine in the examples, and the products produced can also be glutamic acid, valine, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine, citrulline, etc. When various products are produced, the coding gene of the NCgl0762 protein mutant of the present invention is placed in the synthesis pathway of the target product, and the gene in the synthesis pathway is expressed to achieve the production of the target product.

[0051] Experiments have shown that in Corynebacterium glutamicum NCgl0762 Point mutation NCgl0762 in the gene coding region C61A (i.e., the NCgl0762 The wild-type sequence of the gene coding region is replaced by the mutant sequence shown in SEQ ID No. 3), which can significantly increase the yield of L-lysine (p<0.01). The present invention has important significance for the yield of L-lysine.

[0052] Deposit description Classification name: Corynebacterium glutamicum ( Corynebacterium glutamicum ); Reference biological material: YP097158; Depository: General Microbiology Center, China Microbiological Culture Collection Administration; Abbreviation of depository institution: CGMCC; Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; Deposit date: August 16, 2016; The registration number of the Collection Center is: CGMCC No.12856. DETAILED DESCRIPTION

[0053] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0054] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0055] The Corynebacterium glutamicum ( Corynebacterium glutamicum )ATCC13032 is the ATCC number 13032 Corynebacterium glutamicum ( Corynebacterium glutamicum ). Hereinafter referred to as Corynebacterium glutamicum ATCC13032.

[0056] The Corynebacterium glutamicum ( Corynebacterium glutamicum )YP097158 was deposited in the General Microbiological Center of China Microorganism Culture Collection Administration on August 16, 2016, with the deposit number CGMCC No. 12856. Hereinafter referred to as Corynebacterium glutamicum YP097158.

[0057] Example 1: Construction of a NCgl0762 Recombinant vector of gene coding region Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of amplification NCgl0762 The primers for the gene coding region were used to replace the wild-type gene in Corynebacterium glutamicum YP097158 (sequencing confirmed that the wild-type gene was retained on the chromosome of this strain). NCgl0762 gene coding region) and wild-type Corynebacterium glutamicum strain ATCC13032 NCgl0762 A point mutation was introduced into the gene coding region (SEQ ID No. 1), wherein the point mutation NCgl0762 The 61st cytosine (C) in the nucleotide sequence of the gene (SEQ ID No.1) is mutated to adenine (A), and the DNA molecule shown in SEQ ID No.3 is obtained (the mutated NCgl0762Gene, named NCgl0762 C61A ).

[0058] The DNA molecule shown in SEQ ID No.1 encodes a protein with an amino acid sequence of SEQ ID No.2 (the name of the protein is NCgl0762). The DNA molecule shown in SEQ ID No.3 encodes a mutant protein with an amino acid sequence of SEQ ID No.4 (the name of the mutant protein is NCgl0762). L21I ). The mutant protein NCgl0762 L21I The isoleucine (I) at position 21 in the amino acid sequence (SEQ ID No. 4) was mutated from leucine (L).

[0059] The recombinant vector was constructed using NEBuilder assembly technology. The primers were designed as follows (synthesized by Shanghai Invitrogen). The bases in bold font are the mutation positions: P1: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GGTCAGTCAGCAACTAACTACG-3′; P2: 5'-CATACACTATGCACATCGTGAGATGGACTATCGCAAC-3'; P3: 5'-TGTGCATAGTGTATGAGCTAATAAAGCTTAGACCTCTC-3'; P4: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCTTTCAAGGGTACCTACATAG-3′; Note: The underlined parts of P1 and P4 are the sequences contained in the pK18mobsacB vector.

[0060] Construction method: Using Corynebacterium glutamicum ATCC13032 as template, PCR amplification was performed with primers P1 and P2, P3 and P4, respectively, to obtain two mutated bases, with sizes of 637 bp and 634 bp respectively (the sequence on the pK18mobsacB vector in the primers was not counted). NCgl0762 The DNA fragment of the gene coding region was named NCgl0762Up by primer pair P1 / P2, and NCgl0762 Down by primer pair P3 / P4.

[0061] PCR amplification system: 5×HiFi with Mg 2+Buffer 10μL, dNTP Mixture (10 mM) 1.5μL, upstream and downstream primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0062] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 60°C for 15 s; extension at 72°C for 30 s; 30 cycles), over-extension at 72°C for 5 min.

[0063] The two DNA fragments (NCgl0762Up and NCgl0762 Down) were separated and purified by agarose gel electrophoresis and then digested with Xba I / BamH I) The purified pK18mobsacB plasmid (BioVector NTCC Type Culture Collection Center, the plasmid contains a kanamycin resistance marker) was connected with NEBuilder enzyme (NEB product) at 50 ℃ for 30 min, and the ligation product was transformed into E. coli DH5α competent cells (TaKaRa product), spread on 2-YT agar plates containing kanamycin (50 mg / L), and cultured in a 37 ℃ incubator overnight. After a single colony grew on the plate, a single colony was picked and identified by PCR with primers P1 / P4. The one that could amplify a fragment of 1256 bp (SEQ ID No. 5, the sequence on the pK18mobsacB vector in the primers was not counted) was the positive recombinant vector pK18-NCgl0762 C61A The recombinant vector contains a kanamycin resistance marker. The correct recombinant vector pK18-NCgl0762 was identified. C61A The recombinant vector pK18-NCgl0762 containing the correct point mutation (C61A) was sent to a sequencing company for sequencing and identification. C61A Save for later use.

[0064] This recombinant vector pK18-NCgl0762 C61A Contains a mutation site (C61A) and will be used in Corynebacterium glutamicum YP097158 NCgl0762 The 61st cytosine (C) in the gene coding region mutated to adenine (A).

[0065] Recombinant vector pK18-NCgl0762 C61A Description of the structure: pK18mobsacB vector Xba I and / BamHThe fragment (small fragment) between the I recognition sites was replaced with the DNA fragment shown in SEQ ID No. 5 in the sequence list, and the other sequences of the pK18mobsacB vector were kept unchanged to obtain the recombinant vector. Recombinant vector pK18-NCgl0762 C61A Containing the mutant gene shown in SEQ ID No.3 (the 568th to 792nd positions of SEQ ID No.5 are SEQ ID No.3) NCgl0762 C61A .

[0066] Example 2 Construction of a gene containing NCgl0762 C61A Engineered strains The allelic replacement plasmid (pK18-NCgl0762) constructed in Example 1 was C61A ) were transformed into Corynebacterium glutamicum YP097158 cells by electroporation (sequencing confirmed that the wild-type NCgl0762 Gene coding region) and wild-type Corynebacterium glutamicum strain ATCC13032 were cultured on agar plates containing kanamycin (50 mg / L) (formula see Table 2, solvent is water) in a 30°C incubator for 40 hours until multiple single colonies were observed on the plate. Single colonies were picked from the agar plates, resuspended with sterile water, and spread on a medium containing 15% sucrose (the medium is the medium in Table 2 with 150 g / L sucrose added), placed in a 30°C incubator for 40 hours, until a large number of single colonies were observed on the plate. These single colonies were picked and streaked on agar plates containing kanamycin and those without kanamycin, respectively. The culture was carried out in an incubator at 30°C for 18 hours, and the strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin (i.e., the positive strains that underwent homologous recombination with the genome) were selected, and PCR amplification was further performed using primers P5 / P6 to obtain a 573 bp (SEQ ID No. 6, wherein positions 322-546 are SEQ ID No. 3) amplified fragments, which were sequenced and the sequencing results were compared with the genome of wild-type Corynebacterium glutamicum ATCC13032. NCgl0762 The monoclonal colony in which cytosine (C) at gene 61 mutated to adenine (A) was the positive strain.

[0067] P5: 5'-AGGCTGATGTTGCTCGTGAAG-3'; P6: 5'-CCAAAGTCTTGATTCGTCGTTC-3'.

[0068] The positive strains obtained by using Corynebacterium glutamicum YP097158 as the starting bacteria were named as the recombinant bacteria YPL-NCgl0762-1, and the positive strains obtained by using the wild-type Corynebacterium glutamicum strain ATCC13032 as the starting bacteria were named as NCgl0762-1.

[0069] Both the recombinant bacteria YPL-NCgl0762-1 and the recombinant bacteria NCgl0762-1 contain the mutated gene shown in SEQ ID No.3 NCgl0762 C61A , and can express the mutant protein NCgl0762 shown in SEQ ID No.4 L21I .

[0070] The difference between the recombinant strain YPL-NCgl0762-1 and the Corynebacterium glutamicum YP097158 is that the recombinant strain YPL-NCgl0762-1 is a NCgl0762 The gene (SEQ ID No.1) was replaced by NCgl0762 C61A The strain was obtained by amplifying the gene (SEQ ID No. 3) and keeping other sequences unchanged.

[0071] The difference between the recombinant bacterium NCgl0762-1 and the wild-type Corynebacterium glutamicum ATCC13032 is that the recombinant bacterium NCgl0762-1 is a wild-type Corynebacterium glutamicum ATCC13032 genome NCgl0762 Gene (SEQ ID No. 1) was replaced by NCgl0762 C61A The strain was obtained by amplifying the gene (SEQ ID No. 3) and keeping other sequences unchanged.

[0072] Table 2. Corynebacterium glutamicum agar medium formula

[0073] Example 3 L-Lysine fermentation experiment The recombinant bacteria YPL-NCgl0762-1 and NCgl0762-1 constructed in Example 2, as well as the original strain of Corynebacterium glutamicum YP097158 and the wild-type Corynebacterium glutamicum ATCC13032 were subjected to shake flask fermentation experiments. The fermentation medium and fermentation conditions are shown in Tables 3 and 4. After the fermentation, the L-lysine production was detected by SBA-biosensor analyzer. Each strain was repeated three times. The L-lysine production data were analyzed by one-way analysis of variance. The experimental results showed that P<0.05 (*) indicated a significant difference, and P<0.01 (**) indicated a very significant difference.

[0074] Table 3. Fermentation medium formula (solvent is water)

[0075] Table 4. Fermentation control conditions

[0076] The results are shown in Table 5. It can be seen that: in Corynebacterium glutamicum ( Corynebacterium glutamicum ) NCgl0762 After site-directed mutagenesis (C61A) was performed in the gene coding region to change its sequence, the result was helpful to increase the production of L-lysine.

[0077] Table 5. L-lysine production and significance analysis of NCgl0762 engineering strain

[0078] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A NCgl0762 protein mutant, characterized in that: The NCgl0762 protein mutant comprises any of the following: (A1) Protein obtained by replacing the 21st amino acid residue of NCgl0762 protein from L to other amino acids; (A2) a protein derived from bacteria and having more than 95% identity with the protein defined in (A1) and related to the production of L-amino acids by bacteria; (A3) a protein derived from (A1) or (A2) related to the production of L-amino acids by bacteria, obtained by substituting and / or deleting and / or adding one or more amino acid residues to the protein defined in (A1) or (A2); (A4) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1) to (A3).

2. The NCgl0762 protein mutant according to claim 1, characterized in that: The NCgl0762 protein mutant is a protein obtained by replacing the 21st amino acid residue of the NCgl0762 protein from L to I.

3. Biomaterial, characterized in that The biological material includes any of the following: (I) a nucleic acid molecule encoding the NCgl0762 protein mutant according to claim 1 or 2; (II) an expression cassette containing the nucleic acid molecule described in (I); (III) a recombinant vector containing the nucleic acid molecule described in (I) or a recombinant vector containing the expression cassette described in (II); (IV) a recombinant microorganism containing the nucleic acid molecule described in (I), a recombinant microorganism containing the expression cassette described in (II), or a recombinant microorganism containing the recombinant vector described in (III); (V) a recombinant host cell containing the nucleic acid molecule of (I) or a recombinant host cell containing the expression cassette of (II) or a recombinant host cell containing the recombinant vector of (III).

4. The biomaterial according to claim 3, characterized in that: The nucleic acid molecule comprises any of the following: (B1) DNA molecule shown in SEQ ID No. 3; (B2) a DNA molecule that hybridizes with the DNA molecule defined in (B1) under stringent conditions and encodes the NCgl0762 protein mutant; (B3) A DNA molecule having more than 80% identity with any of the DNA sequences defined in (B1) to (B2) and encoding the NCgl0762 protein mutant.

5. Any of the following applications: (C1) Use of the NCgl0762 protein mutant according to claim 1 or 2 or the biomaterial according to claim 3 or 4 in the production of L-amino acids; (C2) Use of the NCgl0762 protein mutant according to claim 1 or 2 or the biomaterial according to claim 3 or 4 in increasing bacterial L-amino acid production; (C3) Use of the NCgl0762 protein mutant described in claim 1 or 2 or the biomaterial described in claim 3 or 4 in constructing an engineered strain producing L-amino acids.

6. Either of the following methods: Method I: A method for increasing bacterial L-amino acid production, comprising the following steps: increasing the expression and / or activity of the NCgl0762 protein mutant of claim 1 in a recipient bacterium to achieve an increase in the bacterial L-amino acid production; Method II: A method for constructing an L-amino acid producing engineered strain, comprising the following steps: increasing the expression and / or activity of the NCgl0762 protein mutant of claim 1 in a recipient bacterium to obtain the L-amino acid producing engineered strain.

7. The method according to claim 8, characterized in that: Improving the expression and / or activity of the NCgl0762 protein mutant in the recipient bacteria comprises any of the following methods: (D1) replacing the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the NCgl0762 protein in claim 1 with the nucleic acid molecule described in (I) of claim 3 or 4; (D2) Introducing the nucleic acid molecule described in (I) of claim 3 or 4, the expression cassette described in (II) of claim 3 or 4, or the recombinant vector described in (III) of claim 3 or 4 into the recipient bacterium.

8. The use according to claim 5 or the method according to claim 6 or 7, characterized in that: The bacteria are Corynebacterium bacteria; Further, the bacteria is Corynebacterium glutamicum; and / or The L-amino acid is L-lysine.

9. A recombinant Corynebacterium glutamicum, characterized in that: The recombinant Corynebacterium glutamicum includes the recombinant Corynebacterium glutamicum obtained by enhancing the activity of a protein having an amino acid sequence including SEQ ID No. 2 in Corynebacterium glutamicum.

10. Use of the NCgl0762 protein mutant according to claim 1 or 2, the biological material according to claim 3 or 4, or the recombinant Corynebacterium glutamicum according to claim 9 in the preparation of food, cosmetics, medicine or feed containing L-lysine.

Images