Genetically engineered algae capable of resisting aquatic pathogenic bacteria as well as construction method and application of genetically engineered algae

Abstract

The invention discloses a genetically engineered algae capable of resisting aquatic pathogenic bacteria as well as a construction method and application thereof, and is characterized in that the genetically engineered algae is phaeodactylum tricornutum into which cell wall energizing plasmids pPha-T1-J48054-eGFP-Linker-Q4 or pPha-T1-J48054-eGFP-Linker-Q6 are introduced, and the preparation method of the genetically engineered algae comprises the following steps: taking genome DNA of the phaeodactylum tricornutum as a template; the method comprises the following steps: constructing a directional expression plasmid pPha-T1-J48054-eGFP by amplifying a Phatr3J48054 coding sequence, inserting Q4 and Q6 coding sequences into the downstream of the eGFP of a directional expression vector, constructing a cell wall energizing plasmid, electrically transforming the cell wall energizing plasmid into phaeodactylum tricornutum, coating an f / 2 plate culture medium with transformed phaeodactylum tricornutum cells for culturing, screening positive algae strains, and screening the positive algae strains. The feed additive has the advantage of inhibiting or killing aquatic pathogenic bacteria.

Description

Technical Field

[0001] The invention belongs to the technical field of plant breeding, and in particular relates to a genetically engineered algae resistant to aquatic pathogens, a construction method and an application thereof. Background Art

[0002] With the rapid development and increasing intensification of aquaculture, microorganisms in aquaculture water have multiplied, causing frequent outbreaks of various aquatic diseases. Among them, bacterial diseases such as Vibrio parahaemolyticus ( Vibrio parahaemolyticus )、Vibrio alginolyticus( Vibrio alginolyticus )、Aeromonas hydrophila( Aeromonas hydrophila ) are particularly common and serious. These diseases not only reduce the quality and output of aquatic products, causing huge economic losses every year, but also pose a potential threat to human health.

[0003] For a long time, the aquaculture industry has mainly used antibiotics to prevent and treat bacterial diseases. However, the long-term excessive use of antibiotics has led to a rapid increase in bacterial resistance, the widespread spread of drug-resistant genes, and drug residues in aquatic products. Therefore, exploring and developing new disease prevention and control methods has become the key to promoting the sustainable development and transformation and upgrading of the aquaculture industry.

[0004] Antimicrobial peptides are a class of small molecule peptides of natural or synthetic origin that have broad-spectrum antimicrobial activity and can effectively kill bacteria, fungi and viruses. Due to their rapid bactericidal effect and low risk of inducing drug resistance, antimicrobial peptides have shown great application potential in protecting aquatic animals from pathogens, improving breeding efficiency and ensuring the safety of aquatic products. Therefore, antimicrobial peptides are widely regarded as a promising alternative to antibiotics in the aquaculture industry. However, the effectiveness of antimicrobial peptides in killing aquatic pathogens depends on their concentration in the water body. Due to the high production cost of antimicrobial peptides, it is difficult to promote the direct addition of large amounts of antimicrobial peptides to the water body in actual aquaculture. Therefore, developing a low-cost and efficient application method to give full play to the anti-aquatic pathogen properties of antimicrobial peptides is of great significance for promoting the healthy development of the aquaculture industry.

[0005] In aquaculture systems, microalgae can reach very high cell densities and coexist with various pathogens in the same ecological niche, and have close and frequent interactions with pathogens. When pathogens multiply in aquaculture systems, it not only harms the quantity and quality of aquatic products, but also reduces the survival rate of microalgae. At present, there are few reports on the market about microalgae with the ability to inhibit or kill pathogens and their construction methods. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a genetically engineered algae resistant to aquatic pathogens and having the ability to inhibit or kill aquatic pathogens, as well as a construction method and application thereof.

[0007] The technical solution adopted by the present invention to solve the above technical problems is: a genetically engineered algae resistant to aquatic pathogens, wherein the genetically engineered algae is a triangular shaped brown algae into which a cell wall enabling plasmid pPha-T1-J48054-eGFP-Linker-Q4 or pPha-T1-J48054-eGFP-Linker-Q6 is introduced, and the antimicrobial peptide Q4 or the antimicrobial peptide Q6 is directionally expressed in the cell wall of the triangular shaped brown algae, and the nucleotide sequence of the cell wall enabling plasmid pPha-T1-J48054-eGFP-Linker-Q4 is shown in SEQ ID NO: 1, and the nucleotide sequence of the cell wall enabling plasmid pPha-T1-J48054-eGFP-Linker-Q6 is shown in SEQ ID NO: 2.

[0008] The present invention also provides a method for constructing the above-mentioned genetically engineered algae resistant to aquatic pathogens, comprising the following steps: Step 1, using the genomic DNA of Phaeodactylum tricornutum as a template, amplify the Phatr3_J48054 coding sequence, and insert it into the upstream of eGFP of the basic expression vector pPha-T1-eGFP to construct the directional expression plasmid pPha-T1-J48054-eGFP; Step 2, artificially synthesize the codon-optimized Q4 and Q6 coding sequences, and insert them into the downstream of eGFP in the directional expression vector to construct the cell wall-enabling plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6; Step 3. The cell wall enabling plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 are respectively electro-transformed into P. tricornutum, and the transformed P. tricornutum cells are spread on f / 2 plate culture medium for culture, and positive algae strains are screened to obtain genetically engineered algae introduced with the cell wall enabling plasmid pPha-T1-J48054-eGFP-Linker-Q4 and genetically engineered algae introduced with the cell wall enabling plasmid pPha-T1-J48054-eGFP-Linker-Q6, respectively.

[0009] Furthermore, step 1 is as follows: (1) According to the coding sequence of Phatr3_J48054, forward and reverse amplification primers containing KpnI restriction site were designed, and PCR amplification was performed using DNA of Phaeodactylum tricornutum as template to obtain the amplification product of the coding sequence of Phatr3_J48054, wherein the nucleotide sequence of the forward amplification primer of the coding sequence of Phatr3_J48054 is shown in SEQ ID NO:4: 5'-gactaattcgagctcggtaccATGAAGCTCACTAATCCATCCGTC-3', and the nucleotide sequence of the reverse amplification primer of the coding sequence of Phatr3_J48054 is shown in SEQ ID NO:5: 5'-tctagaggatccccgggtacc CTCTAAATTCCAAAAGGACGTATCC-3'; (2) The pPha-T1-eGFP plasmid was digested with KpnI restriction endonuclease, and the amplified product of the Phatr3_J48054 coding sequence was ligated with the digested pPha-T1-eGFP to construct the directional expression plasmid pPha-T1-J48054-eGFP.

[0010] Furthermore, step 2 is as follows: (1) Artificially design and synthesize Q4 double-stranded nucleotides based on the Q4 coding sequence and the flexible linker coding sequence; artificially design and synthesize Q6 double-stranded nucleotides based on the Q6 coding sequence and the flexible linker coding sequence; (2) Based on the Q4 coding sequence and HindⅢ restriction site, Q4 forward and reverse amplification primers were designed, and PCR amplification was performed using Q4 double-stranded nucleotides as a template to obtain a Q4 nucleotide amplification fragment; based on the Q6 coding sequence and HindⅢ restriction site, Q6 forward and reverse amplification primers were designed, and PCR amplification was performed using Q6 double-stranded nucleotides as a template to obtain a Q6 nucleotide amplification fragment; (3) Construction of cell wall-enabling plasmid: pPha-T1-J48054-eGFP was digested with HindⅢ restriction endonuclease, and the Q4 nucleotide amplification fragment and the Q6 nucleotide amplification fragment were ligated to the digested pPha-T1-J48054-eGFP to construct the corresponding cell wall-enabling plasmid pPha-T1-J48054-eGFP-Linker-Q4 and cell wall-enabling plasmid pPha-T1-J48054-eGFP-Linker-Q6.

[0011] Furthermore, the nucleotide sequence of the sense chain of the Q4 double-stranded nucleotide synthesized in step (1) is as shown in SEQ ID NO: 8; GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG, and the antisense chain is the reverse complementary sequence of its sense chain; the nucleotide sequence of the sense chain of the Q6 double-stranded nucleotide synthesized is as shown in SEQ ID NO: 11; GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG, and the antisense chain is the reverse complementary sequence of its sense chain.

[0012] Furthermore, the nucleotide sequence of the Q4 forward amplification primer in step (2) is as shown in SEQ ID NO: 12: 5'-ggtggcggcggttccaagcttGGCGCTAACGCCGCTAAGA-3' and the nucleotide sequence of the Q4 reverse amplification primer is as shown in SEQ ID NO: 13: 5'-gatagcacgcttctgaagcttTTACCAGAGGTAGTTGATG-3'; the nucleotide sequence of the Q6 forward amplification primer is as shown in SEQ ID NO: 14: 5'-ggtggcggcggttccaagcttGGCATCAAGATTGCGAAGA-3' and the nucleotide sequence of the Q6 reverse amplification primer is as shown in SEQ ID NO: 15: 5'-gatagcacgcttctgaagcttTTACCAGTAGATCTTCGCG-3'.

[0013] Furthermore, step 3 is as follows: (1) Transformation of P. tricornutum: The cell wall-enabling plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 were transformed into competent cells respectively. After incubation, the cells were spread onto LB solid culture medium. When visible colonies were formed, the colonies were picked up and transferred to LB liquid culture medium for shaking culture. The transformed competent cells were collected, and the corresponding cell wall-enabling plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 were extracted and transformed into P. tricornutum respectively by electroporation. (2) Screening of positive transformants: The transformed P. tricornutum cells were spread on a solid f / 2 plate medium containing bleomycin and placed under a light intensity of 50-70 µmol photons m -2 s -1 , culture under the conditions of temperature of 20-24°C, screen the positive transformation columns, and obtain the genetically engineered algae resistant to aquatic pathogens.

[0014] The present invention also provides the use of the genetically engineered algae resistant to aquatic pathogens in the preparation of Vibrio alginolyticus inhibitors.

[0015] The present invention also provides the use of the genetically engineered algae resistant to aquatic pathogens in the preparation of Vibrio parahaemolyticus inhibitors.

[0016] Compared with the prior art, the advantages of the present invention are as follows: the present invention discloses a genetically engineered algae resistant to aquatic pathogens, a construction method and an application thereof, and uses a cell wall protein as a positioning tag, and expresses it in microalgae together with an antimicrobial peptide having the activity of inhibiting aquatic pathogens, so that the antimicrobial peptide can be positioned in the cell wall of the microalgae, thereby giving the microalgae the ability to inhibit or kill aquatic pathogens. The genetically engineered algae constructed by this method not only fully utilizes the ecological function of the microalgae, but also gives it disease resistance, providing an innovative and efficient disease prevention and control solution for the aquaculture industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is the agarose gel electrophoresis diagram of the coding sequence of Phatr3_J48054, wherein lane 1: 2000 bp Marker, lanes 2, 3: Phatr3_J48054 amplified fragment; Figure 2 The results of screening positive transformants of Phaeodactylum tricornutum by using the plate method with the help of antibiotics; Figure 3 To compare the abundance of Phatr3_J48054 transcripts in wild-type strains, basic plasmid pPha-T1-eGFP transformants, pPha-T1-J48054-eGFP-Linker-Q4 transformants, and pPha-T1-J48054-eGFP-Linker-Q4 transformants based on real-time quantitative PCR; Figure 4 To compare and analyze the eGFP signals in the wild-type strain, pPha-T1-eGFP transformant, pPha-T1-J48054-eGFP-Linker-Q4 transformant, and pPha-T1-J48054-eGFP-Linker-Q6 transformant based on laser confocal microscopy; Figure 5 This is the inhibition zone experiment of crude protein of different strains of Phaeodactylum triangularis against Vibrio alginolyticus and Vibrio parahaemolyticus; Figure 6 The bacterial density of Vibrio alginolyticus and Vibrio parahaemolyticus was analyzed during the co-culture of algae and bacteria with the sterilized wild strain of P. tricornutum, the pPha-T1-J48054-eGFP-Linker-Q4 transformant strain, and the pPha-T1-J48054-eGFP-Linker-Q6 transformant strain. DETAILED DESCRIPTION

[0018] The present invention is further described in detail below with reference to the accompanying drawings.

[0019] Microalgae: Phaeochromis triangularis; basic plasmid: pPha-T1-eGFP; amplification kit: 2×Phanta FlashMaster Mix (Dye Plus) (Vazyme, P520-01); competent cells: DH5α; ligation kit: ClonExpress® II One Step Cloning Kit (Vazyme, C112-02); DNA extraction: 2×CTAB (Coolaber, SL2071); plasmid extraction kit: FastPure Plasmid Mini Kit (Vazyme, DC201-01), etc. The culture medium used was f / 2 culture medium prepared according to the literature (Guillard RRL, Ryther JH. Studies of marine planktonic diatoms: I. Cyclotella nana Hustedt, and Detonula confervacea (Cleve) Gran [J]. Canadian Journal of Microbiology, 1962, 8 (2): 229–239). The microalgae culture equipment was: Zhichu ZQZY-88CGES full-temperature shaking incubator; the microalgae culture conditions were: light intensity 60 µmol photons m -2 s -1 , temperature 22°C, shaker speed 90 rpm.

[0020] Various genetic transformation systems of different microalgae, different cell wall proteins and related positioning tags or peptides, and different antimicrobial peptides can all be used to construct the microalgae germplasm resistant to aquatic pathogens of this patent. This specific embodiment only lists the construction of anti-pathogen microalgae germplasm using triangular ophiopogon as research material, using electroporation method, using pPha-T1-eGFP as basic plasmid, using Phatr3_J48054 as positioning tag, and using antimicrobial peptides Q4 and Q6 as empowering objects, and obtaining genetically engineered triangular ophiopogon introduced with cell wall empowering plasmid pPha-T1-J48054-eGFP-Linker-Q4 and genetically engineered triangular ophiopogon introduced with cell wall empowering plasmid pPha-T1-J48054-eGFP-Linker-Q6, respectively, wherein the nucleotide sequence of cell wall empowering plasmid pPha-T1-J48054-eGFP-Linker-Q4 is shown in SEQ ID NO: 1, and the nucleotide sequence of cell wall empowering plasmid pPha-T1-J48054-eGFP-Linker-Q6 is shown in SEQ ID NO: 2.

[0021] Specific embodiment 1: constructing the directional expression plasmid pPha-T1-J48054-eGFP, comprising the following steps: Step 1. Extraction of genomic DNA from P. triangularis: Collect the cells in the logarithmic phase (cell density of 5×10 6 cells / mL) of Phaeochromis triangularis algae liquid, and genomic DNA was extracted; Step 2, PCR amplification: According to the Ensembl Protists database, the open reading frame sequence of Phatr3_J48054 was searched to obtain the nucleotide sequence of Phatr3_J48054 as shown in SEQ ID NO:3, and forward and reverse amplification primers containing KpnI restriction site were designed according to the coding sequence of Phatr3_J48054, wherein the nucleotide sequence of the forward amplification primer of the coding sequence of Phatr3_J48054 is shown in SEQ ID NO:4: 5'-gactaattcgagctcggtaccATGAAGCTCACTAATCCATCCGTC-3', and the nucleotide sequence of the reverse amplification primer of the coding sequence of Phatr3_J48054 is shown in SEQ ID NO:5: 5'-tctagaggatccccgggtacc CTCTAAATTCCAAAAGGACGTATCC-3'; The PCR amplification system was as follows: 0.5 μL of P. tricornutum DNA, 10 μL of 2×Phanta Flash Master Mix, 0.5 μL of each of the forward and reverse amplification primers for the Phatr3_J48054 coding sequence, and 8.5 μL of ddHO. 2 O; The PCR amplification program was as follows: 94°C for 5 min; 94°C for 30 sec, 65°C for 30 sec, 72°C for 1 min, 35 cycles, and stored at 4°C; Step 3, PCR amplification product identification: After amplification, the PCR products were separated and verified by agarose gel electrophoresis. Figure 1 As shown, lane 1 is a DNA Marker, and lanes 2 and 3 are amplified Phatr3_J48054 coding sequences. The length of the amplified fragment is consistent with the theoretical length, and then gel excision recovery and sequencing are performed.

[0022] Step 4, construction of directional expression vector: Use KpnI restriction endonuclease to digest the pPha-T1-eGFP plasmid, connect the Phatr3_J48054 coding sequence amplification product obtained in step 3 with the digested pPha-T1-eGFP, react at 37°C for 30 min, and construct the directional expression plasmid pPha-T1-J48054-eGFP.

[0023] Specific example 2: Construction of cell wall enabling plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6.

[0024] Step 1, synthesizing double-stranded nucleotides encoding Q4 and Q6: The amino acid sequence of the antimicrobial peptide Q4 is shown in SEQ ID NO:6: GANAAKKFATIAKKFINYLW. Codon optimization is performed based on the amino acid sequence of the antimicrobial peptide Q4 to obtain a nucleotide sequence encoding Q4 as shown in SEQ ID NO:7: 5'-GGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG-3'. Based on the Q4 coding sequence and the flexible linker ((G 4 S) 2 ) The coding sequence was artificially designed and the Q4 double-stranded nucleotide was synthesized, wherein the nucleotide sequence of the Q4 sense strand was as shown in SEQ ID NO: 8; 5'-GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG-3'; the Q4 antisense strand was the reverse complementary sequence of the sense strand; The amino acid sequence of the antimicrobial peptide Q6 is shown in SEQ ID NO:9: GIKIAKKAITIAKKIAKIYW. Codon optimization was performed based on the amino acid sequence of the antimicrobial peptide Q6 to obtain a nucleotide sequence encoding Q6 as shown in SEQ ID NO:10: 5'-GGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG-3'. Based on the Q6 coding sequence and the flexible linker ((G 4 S) 2 ) The coding sequence was artificially designed and the Q6 double-stranded nucleotide was synthesized, wherein the nucleotide sequence of the Q6 sense chain was as shown in SEQ ID NO: 11; 5'-GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG-3'; the Q6 antisense chain was the reverse complementary sequence of the sense chain.

[0025] Step 2, amplify Q4 and Q6 coding sequences: based on the Q4 coding sequence and HindⅢ restriction site, design Q4 forward and reverse amplification primers, the nucleotide sequence of Q4 forward amplification primer is shown in SEQ ID NO: 12: 5'-ggtggcggcggttccaagcttGGCGCTAACGCCGCTAAGA-3' and the nucleotide sequence of Q4 reverse amplification primer is shown in SEQ ID NO: 13: 5'-gatagcacgcttctgaagcttTTACCAGAGGTAGTTGATG-3'; PCR amplification is performed using Q4 double-stranded nucleotides as a template; The PCR amplification system was as follows: 0.5 μL double-stranded nucleotides, 10 μL 2× PrimeSTAR Max Premix, 0.5 μL each of the forward and reverse amplification primers for the Q4 coding sequence, and 8.5 μL ddHO. 2 O; The PCR program was as follows: 94°C for 5 min; 94°C for 30 sec, 65°C for 30 sec, 72°C for 1 min, for 35 cycles, and stored at 4°C.

[0026] At the same time, based on the Q6 coding sequence and HindⅢ restriction site, Q6 forward and reverse amplification primers were designed. The nucleotide sequence of the Q6 forward amplification primer is shown in SEQ ID NO: 14: 5'-ggtggcggcggttccaagcttGGCATCAAGATTGCGAAGA-3' and the nucleotide sequence of the Q6 reverse amplification primer is shown in SEQ ID NO: 15: 5'-gatagcacgcttctgaagcttTTACCAGTAGATCTTCGCG-3'; PCR amplification was performed using Q6 double-stranded nucleotide as a template; the PCR amplification system was: 0.5 μL double-stranded nucleotide, 10 μL 2×PrimeSTAR Max Premix, 0.5 μL each of the Q6 coding sequence forward and reverse amplification primers, and 8.5 μL ddH 2 O; PCR procedure is the same as above.

[0027] Step 3. Construction of cell wall-enabling plasmid: pPha-T1-J48054-eGFP was digested with HindⅢ restriction endonuclease, and the Q4 nucleotide amplification fragment and the Q6 nucleotide amplification fragment obtained in step 2 were ligated with the digested pPha-T1-J48054-eGFP to construct the corresponding cell wall-enabling plasmid pPha-T1-J48054-eGFP-Linker-Q4 and cell wall-enabling plasmid pPha-T1-J48054-eGFP-Linker-Q6.

[0028] Specific example 3: constructing genetically engineered algae resistant to aquatic pathogens, the steps are as follows: Step 1, cell wall empowering plasmid transformation: the cell wall empowering plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 were transformed into competent cells respectively, and after incubation, they were spread on LB solid culture medium. When visible colonies were formed, the colonies were picked into LB liquid culture medium, and placed in a constant temperature shaking incubator at 37°C to culture the transformed competent cells. The transformed competent cells were collected, and the corresponding cell wall empowering plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 were extracted, and transformed into Phaeodactylum tricornutum by electrotransformation method respectively. The electrotransformation parameters were: 500 V, 25 μF, 400 Ω; Step 2, screening of positive transformants: The transformed P. tricornutum cells were spread on f / 2 plate medium containing 1.0% agar and a bleomycin concentration of 75 μg / mL, and placed under a light intensity of 60 μmol photons m -2 s-1 , cultured at 22°C. After about 3 weeks, the successfully transformed strains formed algal colonies on the f / 2 plate. Figure 2 As shown; pick visible algae colonies and culture them in liquid f / 2 medium with a bleomycin concentration of 75 μg / mL for 1 week to obtain the algal liquid of P. triangularis, and extract the algal liquid DNA as an identification template; Step 3, identification of positive transformants: design identification primers based on the eGFP coding sequence, wherein the nucleotide sequence of the forward identification primer is as shown in SEQ ID NO: 16: 5'-GACGACGGCAACTACAAGAC-3', and the nucleotide sequence of the reverse identification primer is as shown in SEQ ID NO: 17: 5'-CGAACTCCAGCAGGACCAT-3'; The PCR amplification system was as follows: 0.5 μL of Phanta triangularis DNA, 10 μL of 2×Phanta Flash Master Mix, 0.5 μL of each of the forward and reverse identification primers designed based on the eGFP coding sequence, and 8.5 μL of ddH 2 O; The PCR amplification program was: 94℃ 5 min; 94℃ 30 sec, 58℃ 30 sec, 72℃ 1 min, 35 cycles, stored at 4℃, and the PCR products were separated by agarose gel electrophoresis and sequenced. Sanger sequencing results showed that the amplified fragment originated from the eGFP coding region of the enabling plasmid, indicating that the enabling plasmid had been successfully transformed into P. tricornutum.

[0029] Specific example 4: Verification of positive transformants of Phaeodactylum triangularis.

[0030] 1. Verification of transcription level: Total RNA of each strain of P. triangularis was extracted and reverse transcribed to obtain cDNA. The transcription of Phatr3_J48054 in wild strains and positive transformed strains was compared and analyzed by real-time quantitative PCR using cDNA as a template. Among them, the wild strain and pPha-T1-eGFP basic plasmid transformed strain were negative control 1 and negative control 2, respectively.

[0031] Based on the Phatr3_J48054 sequence, the forward and reverse primers for real-time quantitative PCR were designed, wherein the nucleotide sequence of the forward primer for real-time quantitative PCR is shown in SEQ ID NO: 18: 5'-ATCCGTCTGGTCGCTCTTG-3'; the nucleotide sequence of the reverse primer for real-time quantitative PCR is shown in SEQ ID NO: 19: 5'-TTGGGATTCCCGTTGTCTC-3'; Real-time quantitative PCR system: 0.5 μL of Phaeodactylum triangularis cDNA, 10 μL of 2×PhantaQuantiNovaSYBRGreen PCR Master Mix, 0.5 μL of each of the forward and reverse primers for real-time quantitative PCR, 8.5 μL of ddH 2 O; The real-time quantitative PCR program was as follows: 94°C for 5 min; 94°C for 15 sec, 60°C for 30 sec, for 40 cycles.

[0032] like Figure 3 As shown, the relative transcript abundance of Phatr3_J48054 in the strains transformed with the cell wall-enabling plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 was several times higher than that in the wild-type strain (negative control 1) and the strain transformed with the pPha-T1-eGFP basic plasmid (negative control 2), indicating that the target fragment in the cell wall-enabling plasmid could be successfully transcribed in the transformed strains.

[0033] 2. Protein level verification: Each strain of P. triangularis was cultured to the logarithmic growth phase (cell density was about 5×10 6 cells / mL), and the position and intensity of the eGFP signal of each strain of P. triangularis were detected and compared under the conditions of excitation and emission wavelengths of 488 nm and 507 nm, respectively, by means of a laser confocal microscope. Among them, the wild strain and the pPha-T1-eGFP basic plasmid transformed strain were negative control 1 and negative control 2, respectively.

[0034] like Figure 4 As shown, the green fluorescence signal of the P. triangularis strains transformed with the cell wall-enabling plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 was accurately localized to the cell wall; no eGFP signal was observed in the cells of the wild strain (negative control 1); the eGFP signal of the strain transformed with the basic plasmid pPha-T1-eGFP (negative control 2) was localized in the cytoplasm. This indicates that the target fragment in the cell wall-enabling plasmid can be successfully expressed in the transformed strain.

[0035] In summary, after identification of transcription and protein expression levels, it can be determined that the Q4 and Q6 enabling factors carried by the positive transformants can be correctly transcribed, translated, and accurately located in the cell wall of P. tricornutum.

[0036] Specific Example 5: Verification of antibacterial effect based on positive transformants of Phaeodactylum triangularis.

[0037] The antibacterial effect of cell wall-empowered plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 transformants was verified based on crude protein extracts and algae-bacteria co-culture.

[0038] 1. Verification of antibacterial effect based on crude protein Step 1. Cultivate P. triangularis: Inoculate the wild strain of P. triangularis (negative control), pPha-T1-J48054-eGFP-Linker-Q4 positive transformant, and pPha-T1-J48054-eGFP-Linker-Q6 positive transformant into liquid f / 2 culture medium at the same starting density (cell density is about 1×10 6 cells / mL) and cultured in a constant temperature and light shaker until the stationary phase (cell density was about 1.5×10 7 cells / mL); the culture condition was a light intensity of 60 µmol photons m -2 s -1 , temperature 22℃, rotation speed 90 rpm. Subsequently, algal cells were collected by centrifugation and crude protein was extracted.

[0039] Step 2, verification of inhibition zone: add crude protein of each strain (equal amount) onto 2216E solid plate coated with Vibrio alginolyticus and Vibrio parahaemolyticus, and culture the bacteria in a constant temperature incubator at 22°C for 72 hours; during this period, observe the antibacterial effect of crude protein of each strain, with crude protein extracted from wild strain as negative control and 2216E solid plate with 50 mg / mL kanamycin added as positive control.

[0040] The results are as follows Figure 5 As shown, compared with the wild strain (negative control), the crude protein of P. tricornutum transformed with pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 can form an obvious inhibition zone, and the diameter of the inhibition zone is comparable to the inhibition zone of 50 mg / mL kanamycin (positive control); this proves that both the pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 transformants showed significant inhibitory effects on Vibrio alginolyticus and Vibrio parahaemolyticus.

[0041] 2. Verification of antibacterial effect based on algae-bacteria co-culture Step 1. Algae-bacteria co-culture: The sterile wild strain of P. tricornutum (negative control), pPha-T1-J48054-eGFP-Linker-Q4 positive transformant, and pPha-T1-J48054-eGFP-Linker-Q6 positive transformant were cultured to the exponential phase (cell density was about 5×10 6 cells / mL), and added equal amounts of Vibrio alginolyticus solution to each strain of P. triangularis (the density of the Vibrio alginolyticus solution was OD 600 = 0.5, the volume ratio of algae solution to bacterial solution is 100:1) and Vibrio parahaemolyticus solution (the density of Vibrio parahaemolyticus solution is OD 600 =0.5, the volume ratio of algae liquid to bacterial liquid was 100:1); then, they were placed in a constant temperature and light shaker for co-culture for 5 days. The algae and bacteria co-culture conditions were 22°C, 60 µmol photons m -2 s -1 , the shaking speed was 90 rpm.

[0042] Step 2, bacterial density determination: During the co-culture period, the cell density of Vibrio alginolyticus and Vibrio parahaemolyticus in each strain was detected by the dilution plate count method based on 2216E solid plates, and the antibacterial effect of Q4-positive transformants and Q6-positive transformants in the culture system was evaluated.

[0043] The results are as follows Figure 6 As shown, under the algae-bacteria co-culture system, the cell density of Vibrio alginolyticus and Vibrio parahaemolyticus in the pPha-T1-J48054-eGFP-Linker-Q4 positive transformant and the pPha-T1-J48054-eGFP-Linker-Q6 positive transformant was much lower than that of the wild strain P. tricornutum (negative control), indicating that the improved P. tricornutum germplasm of the present invention exhibits an ideal effect of inhibiting aquatic pathogens in water bodies.

[0044] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by a person skilled in the art within the spirit and scope of the present invention shall also fall within the protection scope of the present invention.

Claims

1. A genetically engineered algae resistant to aquatic pathogens, characterized in that: The genetically engineered algae is a triangular shaped brown algae into which a cell wall enabling plasmid pPha-T1-J48054-eGFP-Linker-Q4 or pPha-T1-J48054-eGFP-Linker-Q6 is introduced, and the antimicrobial peptide Q4 or the antimicrobial peptide Q6 is directionally expressed in the cell wall of the triangular shaped brown algae. The nucleotide sequence of the cell wall enabling plasmid pPha-T1-J48054-eGFP-Linker-Q4 is shown in SEQ ID NO: 1, and the nucleotide sequence of the cell wall enabling plasmid pPha-T1-J48054-eGFP-Linker-Q6 is shown in SEQ ID NO:

2.

2. A method for constructing genetically engineered algae resistant to aquatic pathogens according to claim 1, characterized in that The following steps are involved: Step 1, using the genomic DNA of Phaeodactylum tricornutum as a template, amplify the Phatr3_J48054 coding sequence, and insert it into the upstream of eGFP of the basic expression vector pPha-T1-eGFP to construct the directional expression plasmid pPha-T1-J48054-eGFP; Step 2, artificially synthesize the codon-optimized Q4 and Q6 coding sequences, and insert them into the downstream of eGFP in the directional expression vector to construct the cell wall-enabling plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6; Step 3. The cell wall enabling plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 are respectively electro-transformed into P. tricornutum, and the transformed P. tricornutum cells are spread on f / 2 plate culture medium for culture, and positive algae strains are screened to obtain genetically engineered algae introduced with the cell wall enabling plasmid pPha-T1-J48054-eGFP-Linker-Q4 and genetically engineered algae introduced with the cell wall enabling plasmid pPha-T1-J48054-eGFP-Linker-Q6, respectively.

3. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 2, characterized in that Step 1 is as follows: (1) According to the coding sequence of Phatr3_J48054, forward and reverse amplification primers containing KpnI restriction site were designed, and PCR amplification was performed using DNA of Phaeodactylum tricornutum as template to obtain the amplification product of the coding sequence of Phatr3_J48054, wherein the nucleotide sequence of the forward amplification primer of the coding sequence of Phatr3_J48054 is shown in SEQ ID NO:4: 5'-gactaattcgagctcggtaccATGAAGCTCACTAATCCATCCGTC-3', and the nucleotide sequence of the reverse amplification primer of the coding sequence of Phatr3_J48054 is shown in SEQ ID NO:5: 5'-tctagaggatccccgggtaccCTCTAAATTCCAAAAGGACGTATCC-3'; (2) The pPha-T1-eGFP plasmid was digested with KpnI restriction endonuclease, and the amplified product of the Phatr3_J48054 coding sequence was ligated with the digested pPha-T1-eGFP to construct the directional expression plasmid pPha-T1-J48054-eGFP.

4. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 2, characterized in that Step 2 is as follows: (1) Artificially design and synthesize Q4 double-stranded nucleotides based on the Q4 coding sequence and the flexible linker coding sequence; artificially design and synthesize Q6 double-stranded nucleotides based on the Q6 coding sequence and the flexible linker coding sequence; (2) Based on the Q4 coding sequence and HindⅢ restriction site, Q4 forward and reverse amplification primers were designed, and PCR amplification was performed using Q4 double-stranded nucleotides as a template to obtain a Q4 nucleotide amplification fragment; based on the Q6 coding sequence and HindⅢ restriction site, Q6 forward and reverse amplification primers were designed, and PCR amplification was performed using Q6 double-stranded nucleotides as a template to obtain a Q6 nucleotide amplification fragment; (3) Construction of cell wall-enabling plasmid: pPha-T1-J48054-eGFP was digested with HindⅢ restriction endonuclease, and the Q4 nucleotide amplification fragment and the Q6 nucleotide amplification fragment were ligated to the digested pPha-T1-J48054-eGFP to construct the corresponding cell wall-enabling plasmid pPha-T1-J48054-eGFP-Linker-Q4 and cell wall-enabling plasmid pPha-T1-J48054-eGFP-Linker-Q6.

5. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 4, characterized in that The nucleotide sequence of the sense strand of the Q4 double-stranded nucleotide synthesized in step (1) is as shown in SEQ ID NO:8; GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG, and the antisense strand is the reverse complementary sequence of its sense strand; the nucleotide sequence of the sense strand of the Q6 double-stranded nucleotide synthesized is as shown in SEQ ID NO:11; GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG, and the antisense strand is the reverse complementary sequence of its sense strand.

6. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 4, characterized in that The nucleotide sequence of the Q4 forward amplification primer in step (2) is shown in SEQ ID NO: 12: 5'-ggtggcggcggttccaagcttGGCGCTAACGCCGCTAAGA-3' and the nucleotide sequence of the Q4 reverse amplification primer is shown in SEQ ID NO: 13: 5'-gatagcacgcttctgaagcttTTACCAGAGGTAGTTGATG-3'; the nucleotide sequence of the Q6 forward amplification primer is shown in SEQ ID NO: 14: 5'-ggtggcggcggttccaagcttGGCATCAAGATTGCGAAGA-3' and the nucleotide sequence of the Q6 reverse amplification primer is shown in SEQ ID NO: 15: 5'-gatagcacgcttctgaagcttTTACCAGTAGATCTTCGCG-3'.

7. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 2, characterized in that Step 3 is as follows: (1) Transformation of P. tricornutum: The cell wall-enabling plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 were transformed into competent cells respectively. After incubation, the cells were spread onto LB solid culture medium. When visible colonies were formed, the colonies were picked up and transferred to LB liquid culture medium for shaking culture. The transformed competent cells were collected, and the corresponding cell wall-enabling plasmids pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 were extracted and transformed into P. tricornutum respectively by electroporation. (2) Screening of positive transformants: The transformed P. tricornutum cells were spread on a solid f / 2 plate medium containing bleomycin and placed under a light intensity of 50-70 µmol photons m -2 s -1 , culture under the conditions of temperature of 20-24°C, screen the positive transformation columns, and obtain the genetically engineered algae resistant to aquatic pathogens.

8. Use of the genetically engineered algae resistant to aquatic pathogens according to claim 1 in the preparation of Vibrio alginolyticus inhibitors.

9. Use of the genetically engineered algae resistant to aquatic pathogens according to claim 1 in the preparation of Vibrio parahaemolyticus inhibitors.

Images