A transaminase mutant and use thereof

By mutating specific sites of Aspergillus oatus ω-aminotransferase, its catalytic performance in organic solvents was improved, solving the problems of stereoselectivity and solvent tolerance in the synthesis of sitagliptin intermediates, and realizing efficient and economical biocatalytic preparation of high optical purity sitagliptin intermediates.

CN119570758BActive Publication Date: 2026-03-24ZHEJIANG UNIV OF TECH +3
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202411799940.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-09
Publication Date
2026-03-24
Estimated Expiration
2044-12-09

AI Technical Summary

Technical Problem

Existing technologies for synthesizing sitagliptin and its intermediates suffer from problems such as poor stereoselectivity, expensive catalysts, low tolerance to organic solvents, and low thermal stability, making it difficult to achieve efficient and economical industrial production.

Method used

A mutant ω-aminotransferase is provided, which improves the catalytic activity and thermal stability of ω-aminotransferase derived from Aspergillus oatus by mutating specific amino acid sites, and maintains high catalytic efficiency in organic solvents. It is expressed and purified using a recombinant vector and genetically engineered bacteria, and uses dimethyl sulfoxide as a cosolvent, pyridoxal phosphate as a coenzyme, and isopropylamine as a cosubstrate to carry out biocatalytic reactions.

Benefits of technology

The preparation of a high-optical-purity sitagliptin intermediate was achieved, with a product stereoselectivity of 99% and significantly improved catalytic efficiency, making it suitable for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119570758B_ABST
    Figure CN119570758B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of enzyme engineering, and discloses an amino transferase mutant and application thereof.The present application provides a wild-type amino transferase mutant derived from Aspergillus avenaceus.The amino transferase mutant is obtained by carrying out single-point or multi-point combined mutation on the 20th, 60th, 92nd and 186th positions of the amino acid sequence shown in SEQ ID NO.2, and can directly take the sitagliptin intermediate precursor ketone as a substrate, take isopropylamine as an amino donor, take phosphopyridoxyl as a coenzyme, take dimethyl sulfoxide as a substrate solvent, catalyze the preparation of a sitagliptin intermediate with high optical purity, and the specific enzyme activity reaches 139.3 U / g in a reaction system with a final concentration of 50% DMSO, greatly improves the catalytic efficiency, and the product has high stereoselectivity (the e.e. value of the product reaches 99%), and has a wide industrial application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of enzyme engineering technology, and in particular to an aminotransferase mutant and its applications. Background Technology

[0002] Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor, marketed as Januvia. It was approved by the FDA in October 2016 for the treatment of type 2 diabetes and was developed by Merck and Codexis. Sitagliptin works by inhibiting the activity of the DPP-4 enzyme, reducing the degradation of glucagon-like peptide-1 (GLP-1) and glucose-dependent insulinotropic peptide (GIP), thereby enhancing the hypoglycemic effects of these hormones. Sitagliptin can be used alone or in combination with other hypoglycemic agents such as metformin or thiazolidinediones.

[0003] The synthesis of sitagliptin and its intermediates can be achieved through either entirely chemical methods or a combination of chemical and enzymatic methods. Chemical synthesis involves multiple steps, including key steps such as asymmetric hydrogenation and the Mitsunobu reaction. Enzymatic methods, utilizing enzyme catalysis, offer advantages such as mild reaction conditions, environmental friendliness, high selectivity, and short reaction steps, meeting the requirements of "green chemistry." For the chemo-enzymatic method, the key lies in obtaining an ω-aminotransferase with enhanced activity and increased stability in organic solvents, capable of catalyzing the asymmetric transamination of sitagliptin intermediate precursor ketones to obtain optically pure sitagliptin intermediates.

[0004] For the study of ω-aminotransferases, existing technologies include the following patents:

[0005] (1) Chinese patent CN107384887 discloses an ω-aminotransferase derived from Burkholderia gladioli ZJB-12126 and engineered it. However, the engineered transaminase disclosed in CN107384887 has insufficient activity, requiring 50 g / L of wet cells to achieve a high conversion rate. Furthermore, the final volume concentration of DMSO as a co-solvent in the reaction system is 10-40%, which cannot achieve good enzyme activity in a high volume concentration DMSO system and thus cannot achieve a high conversion rate.

[0006] (2) Chinese patent CN108866021A discloses an ω-aminotransferase derived from Arthrobacter nitroguajacolicus ZJUTB06-99. The modified ω-aminotransferase has solved to some extent the problems of poor stereoselectivity, expensive catalyst and difficult solvent recovery in the process of producing sitagliptin intermediate. However, it still uses dimethyl sulfoxide as a co-solvent, and preferably the final volume concentration of dimethyl sulfoxide is 20%. However, industrial production requires a high substrate concentration, and enzyme proteins that are intolerant to dimethyl sulfoxide will have difficulty playing a good role in industrial production.

[0007] (3) International patent WO2007050485 discloses Merck’s method for synthesizing sitagliptin intermediates, which uses a chiral germanium catalyst to asymmetric hydrogenate enamines to synthesize chiral amines with a yield of 84% and an ee value of 94%. However, this method requires expensive germanium chiral catalysts, and removal and recovery are also difficult.

[0008] (4) International patent WO2005003135 discloses a method for synthesizing chiral amines by inducing catalytic hydrogenation with S-phenylglycine (Merck). This route requires two catalytic hydrogenations. The platinum catalyst used in the first hydrogenation is expensive, and a large amount of PD(OH)2-C catalyst is needed for the second deprotection, which is costly. The ee value is 96%, and further recrystallization is required.

[0009] Based on the above-mentioned existing technologies, the asymmetric synthesis of sitagliptin and its intermediates has problems such as low overall yield (generally less than 50%), low stereoselectivity (product ee value is generally less than 90%), low tolerance to organic solvents (preferably dimethyl sulfoxide final volume concentration of 20%), low thermal stability, expensive metal catalysts, and the inability of biocatalysts to directly use sitagliptin precursor ketones as substrates.

[0010] With the development of directed evolution technology, protein engineering is increasingly being used to modify the substrate specificity of enzymes, screen for novel transaminases with a broad substrate spectrum, and study chiral drugs and their intermediates that can be catalyzed with high efficiency and selectivity. This not only broadens their application scope and enhances their application potential, but also lays the foundation for industrial production. Summary of the Invention

[0011] To address the problems of poor stereoselectivity and expensive catalysts in existing engineered transaminase technologies for synthesizing sitagliptin or its chiral amino intermediates, this invention provides an ω-aminotransferase mutant, its encoding gene, a vector containing the encoding gene, genetically engineered bacteria, and their application in the enzymatic catalytic preparation of sitagliptin intermediates. The ω-aminotransferase mutant provided by this invention can directly use sitagliptin intermediate precursor ketones as substrates, exhibiting higher catalytic activity, better thermal stability, and tolerance to organic solvents. Therefore, this ω-aminotransferase mutant has broader application prospects in the industrial production of sitagliptin.

[0012] The specific technical solution of this invention is as follows:

[0013] In a first aspect, the present invention provides an ω-aminotransferase mutant, which is obtained by performing single-point or multi-point combined mutations on positions 20, 60, 92 and 186 of the amino acid sequence shown in SEQ ID NO.2.

[0014] Preferably, the above-mentioned ω-aminotransferase mutant is obtained by performing any of the following mutations on the amino acid sequence shown in SEQ ID NO.2:

[0015] (1) Arginine at position 20 is mutated into alanine;

[0016] (2) Arginine at position 20 is mutated into alanine, while glycine at position 60 is mutated into serine, alanine at position 92 is mutated into proline, and leucine at position 186 is mutated into phenylalanine.

[0017] More specifically, the amino acid sequence of the above-mentioned (1) ω-aminotransferase mutant can be as shown in SEQ ID No. 4, and the nucleotide sequence can be as shown in SEQ ID No. 3. The amino acid sequence of the above-mentioned (2) ω-aminotransferase mutant can be as shown in SEQ ID No. 6, and the nucleotide sequence can be as shown in SEQ ID No. 5.

[0018] Secondly, the present invention provides the encoding gene of the above-mentioned ω-aminotransferase mutant.

[0019] Thirdly, the present invention provides a recombinant vector containing the above-mentioned coding gene.

[0020] Fourthly, the present invention provides a genetically engineered bacterium that contains the above-mentioned coding gene or the above-mentioned recombinant vector.

[0021] Fifthly, the present invention provides the application of the above-mentioned ω-aminotransferase mutant in the preparation of sitagliptin intermediates.

[0022] As a preferred application of the present invention, the above-mentioned ω-aminotransferase mutant can be used to catalyze the preparation of sitagliptin intermediate precursor ketone. Specifically, one method of the application can be: using wet bacterial cells obtained by fermentation culture of recombinant genetically engineered bacteria containing the ω-aminotransferase mutant encoding gene as a catalyst, or using pure enzyme solution obtained by ultrasonic disruption and extraction of the wet bacterial cells as a catalyst, using sitagliptin intermediate precursor ketone as a substrate, using dimethyl sulfoxide (DMSO) as a cosolvent, pyridoxal phosphate (PLP) as a coenzyme, isopropylamine as a cosubstrate, and triethanolamine buffer solution at pH 8-9 as a reaction medium to form a reaction system, and carrying out the biocatalytic reaction at 40-50℃ and 800-1200rpm.

[0023] Preferably, the amount of wet bacterial cells used is 10-50 g / L; the amount of pure enzyme solution used is 50-100 g / L based on protein content; the final concentration of the substrate is 1-25 g / L; the final volume concentration of dimethyl sulfoxide (DMSO) is 10-50%; the concentration of pyridoxal phosphate (PLP) is 0.25-2 g / L; and the concentration of isopropylamine is 20-50 g / L.

[0024] As a preferred application of the present invention, the above-mentioned ω-aminotransferase mutant can be used to catalyze the preparation of sitagliptin intermediates from prochiral carbonyl compounds. Specifically, one method of the application can be: using wet bacterial cells obtained by fermentation culture of recombinant genetically engineered bacteria containing the ω-aminotransferase mutant encoding gene as a catalyst, or using pure enzyme solution obtained by ultrasonically breaking and extracting the wet bacterial cells as a catalyst, using prochiral carbonyl compounds as substrates, dimethyl sulfoxide (DMSO) as a cosolvent, pyridoxal phosphate (PLP) as a coenzyme, isopropylamine as a cosubstrate, and triethanolamine buffer solution at pH 8-9 as a reaction medium to form a catalytic system, and carrying out the biocatalytic reaction at 40-50°C and 800-1200 rpm. The prochiral carbonyl compounds include, but are not limited to, methyl 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyrate, propyl 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyrate, isopropyl 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyrate, ethyl 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyrate, and methyl 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyrate. Isobutyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyrate benzyl ester, 1-morpholino-4-(2,4,5-trifluorophenyl)-1,3-butanedione, (2Z)-4-oxo-4-[3-(trifluoromethyl)-5,6-dihydro-[1,2,4]triazolo[4,3-a]pyrazin-7-(8H)-yl]-1-(2,4,5-trifluorophenyl)but-2-one.

[0025] Preferably, the amount of wet bacterial cells used is 10–50 g / L; the amount of pure enzyme solution used is 50–100 g / L based on protein content; the final concentration of the substrate is 1–25 g / L; the final volume concentration of dimethyl sulfoxide (DMSO) is 10–50%; the concentration of pyridoxal phosphate (PLP) is 0.25–2 g / L; and the concentration of isopropylamine is 20–50 g / L.

[0026] Compared with the prior art, the present invention has the following technical effects:

[0027] This invention provides a wild-type ω-aminotransferase mutant derived from *Aspergillus avenaceus*. This ω-aminotransferase mutant, as a biocatalyst, can directly synthesize sitagliptin intermediates using sitagliptin intermediate precursor ketones (e.g., 1-piperidin-4-(2,4,5-trifluorophenyl)-1,3-dibutanone) as substrates. The ω-aminotransferase mutant provided by this invention uses sitagliptin intermediate precursor ketones as substrates, isopropylamine as an amino donor, pyridoxal phosphate (PLP) as a coenzyme, and dimethyl sulfoxide (DMSO) as a substrate cosolvent for the biocatalytic preparation of high-optical-purity sitagliptin intermediates. In a reaction system with a final DMSO volume concentration of 50%, the specific enzyme activity reaches 139.3 U / g, significantly improving catalytic efficiency and exhibiting high stereoselectivity (product ee value reaches 99%), demonstrating broad industrial application prospects. Attached Figure Description

[0028] Figure 1 The effect of DMSO dosage on the catalysis of sitagliptin intermediate precursor ketone by transaminase and its dominant mutant; Figure 2 The trend chart shows the half-life at a 10% (v / v) methanol concentration. Detailed Implementation

[0029] This invention provides an ω-aminotransferase mutant, which is obtained by single-point or multi-point combined mutation of the 20th, 60th, 92nd and 186th positions of the amino acid sequence shown in SEQ ID NO.2.

[0030] The wild-type ω-aminotransferase of this invention, i.e., the amino acid sequence shown in SEQ ID No. 2, is derived from *Aspergillus avenaceus*, and can also be isolated from expression transformants that recombinantly express this protein, or synthesized artificially. The identity between two amino acid sequences or two nucleotide sequences can be obtained using algorithms commonly used in the art, preferably calculated using NCBI Blastp and Blastn software with default parameters.

[0031] Due to the degeneracy of nucleotide codons, the polynucleotide sequences encoding the amino acid sequences of SEQ ID No. 4 and SEQ ID No. 6 are not limited to SEQ ID No. 3 and SEQ ID No. 5. Proteins with at least 95% identity to the amino acid sequences shown in SEQ ID No. 4 and SEQ ID No. 6 of this invention, derived from these sequences by substitution, deletion, or addition of one or more amino acid residues, and possessing transaminase activity, are all within the scope of protection of this invention.

[0032] Based on the above-mentioned ω-aminotransferase mutant, those skilled in the art can obtain the encoding gene of the above-mentioned ω-aminotransferase mutant by conventional methods in the art. Therefore, the encoding gene should fall within the scope of protection of this invention.

[0033] Based on the above-mentioned ω-aminotransferase mutant, its encoding gene is loaded onto a recombinant vector and transformed into recipient bacteria to obtain genetically engineered bacteria for expression of the ω-aminotransferase mutant. This is also a conventional method in the field. Therefore, the recombinant vector and the genetically engineered bacteria should fall within the scope of protection of this invention.

[0034] This invention also provides the application of the above-mentioned ω-aminotransferase mutant in the preparation of sitagliptin intermediates.

[0035] The wet bacterial cells described in this invention can be prepared as follows: Recombinant genetically engineered bacteria containing the ω-aminotransferase mutant encoding gene are inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance and cultured at 37°C and 180 rpm for 12 h. Then, at a volume concentration of 2%, the inoculum is inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin resistance and cultured at 37°C and 180 rpm until the bacterial cell OD reaches 100%. 600 When the concentration reaches 0.6-0.8, add IPTG to a final concentration of 0.1 mM, induce culture at 28°C for 12 h, centrifuge at 4°C and 8000 rpm for 10 min, discard the supernatant, collect the precipitate, and obtain the wet bacterial cells.

[0036] The pure enzyme solution described in this invention can be prepared as follows: The wet bacterial cells are resuspended in binding buffer and then sonicated (220W for 20 min). After centrifugation at 12000 rpm for 10 min at 4°C, the supernatant obtained is the crude enzyme solution. The crude enzyme solution is incubated with Ni affinity chromatography resin equilibrated with binding buffer and then washed with rinsing buffer until there are basically no impurities. The target protein is then eluted with elution buffer and collected. After the purity is identified by electrophoresis, the target proteins are combined and dialyzed at 4°C for 48 h with dialysis buffer (dialysis bag molecular cutoff 33 kDa). The collected effluent is the pure enzyme solution.

[0037] The binding buffer described in this invention is a 50mM, pH 8.0 sodium phosphate buffer (containing 300mM NaCl); the rinsing buffer is a 50mM, pH 8.0 sodium phosphate buffer (containing 300mM NaCl and 50mM imidazole); the elution buffer is a 50mM, pH 8.0 sodium phosphate buffer (containing 300mM NaCl and 500mM imidazole); and the dialysis buffer is a 50mM, pH 8.0 sodium phosphate buffer.

[0038] The present invention will be further described below with reference to embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0039] Example 1: Amplification of the wild-type ω-aminotransferase gene WT

[0040] Based on the ω-aminotransferase gene sequence information from *Aspergillus avenaceus* indexed in GenBank, using RNA was extracted from Aspergillus oatus using the SPIN Kit, and DNA was obtained by reverse transcription. This DNA was then used as a template for PCR amplification using primers 1 and 2.

[0041] Primer 1: ATGGCGACCATGGATAAAGT;

[0042] Primer 2: ATCGCTGCCATAATCCACCG.

[0043] PCR reaction system (total volume 50 μL): 10×Pfu DNA Polymerase Buffer 25 μL, 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP and dTTP) 1 μL, cloning primer 1 and primer 2 (50 μM each) 1 μL, genomic DNA 1 μL, Pfu DNA Polymerase 1 μL, ddH2O 20 μL.

[0044] The PCR instrument used was a BioRad. The PCR reaction conditions were as follows: pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 30 s, annealing at 65℃ for 30 s, extension at 72℃ for 1 min, for a total of 30 cycles, and a final extension at 72℃ for 10 min.

[0045] The results showed that the nucleotide sequence amplified by primers 1 and 2 was 969 bp in length, which is the wild-type ω-aminotransferase gene, denoted as WT gene. Its nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence encoding the protein is shown in SEQ ID NO.2. This sequence encodes a complete open reading frame.

[0046] Example 2: Construction of wild-type recombinant expression vector pET28a-WT

[0047] Primers 3 and 4 were designed based on the WT gene sequence in Example 1. Using the recombinant plasmid pET28a-WT as a template, the WT gene sequence was obtained under the action of the high-fidelity polymerase Phanta Max Super-FIDelity DNA Polymerase. DpnI and... The amplified fragment was processed with a buffer, and the WT gene (nucleotide sequence as shown in SEQ ID NO.1, amino acid sequence as shown in SEQ ID NO.2) was ligated to the plasmid vector pET28a (Invitrogen) by one-step cloning to obtain the recombinant expression vector pET28a-WT.

[0048] Primer 3: ctttaagaaggagatatacc ATGGCGACCATGGATAAAGT;

[0049] Primer 4: tggtggtggtggtgctcgag ATCGCTGCCATAATCCACCG.

[0050] Example 3: Construction of wild-type recombinant Escherichia coli BL21 / pET28a-WT

[0051] The recombinant expression vector pET28a-WT constructed in Example 2 was transformed into Escherichia coli BL21(DE3) (Invitrogen) (42℃, 90s), plated on LB plates containing 50 μg / mL kanamycin resistance, and cultured at 37℃ for 12h. Clones were randomly selected, plasmids were extracted and sequenced for identification, and wild-type recombinant Escherichia coli BL21(DE3) / pET28a-WT was obtained.

[0052] Example 4: Induction of Wild-Type Recombinant Escherichia coli BL21 / pET28a-WT The wild-type recombinant Escherichia coli BL21(DE3) / pET28a-WT obtained in Example 3 was inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance and cultured at 37°C and 200 rpm for 12 h. Then, it was inoculated at a 2% (v / v) inoculation rate into fresh LB liquid medium containing 50 μg / mL kanamycin resistance and cultured at 37°C and 150 rpm until the bacterial cell OD reached 100%.600 The concentration of the sample was increased to 0.6–0.8, and IPTG was added to a final concentration of 0.1 mM. After induction culture at 28°C for 12 h, the sample was centrifuged at 4°C and 8000 rpm for 10 min. The supernatant was discarded, and the precipitate was collected to obtain wild-type recombinant Escherichia coli BL21 / pET28a-WT wet cells. These cells can be used directly as a biocatalyst or for protein purification.

[0053] Example 5: Preparation of Wild-Type ω-Aminotransferase-WT Pure Enzyme Solution

[0054] The wet bacterial cells obtained in Example 4 were resuspended in binding buffer and then sonicated (220W for 20 min). The mixture was then centrifuged at 12000 rpm for 10 min at 4°C. The supernatant obtained was the crude enzyme solution. The crude enzyme solution was incubated with Ni affinity chromatography resin equilibrated with binding buffer, and then washed with rinsing buffer until virtually free of contaminating proteins. The target protein was then eluted with elution buffer and collected. After electrophoresis to determine purity, the target proteins were combined and dialyzed at 4°C for 48 h (dialysis bag molecular cutoff 33 kDa) using dialysis buffer. The collected retentate was the pure enzyme solution. The collected retentate was the wild-type ω-aminotransferase-WT pure enzyme solution. The protein content was determined to be 1.5 mg / mL using the Coomassie brilliant blue method. The enzyme solution was diluted with 50 mM, pH 8.0 sodium phosphate buffer to a final concentration of 0.5 mg / mL, aliquoted, and stored at -80°C.

[0055] The binding buffer used in the above method is 50 mM, pH 8.0 sodium phosphate buffer (containing 300 mM NaCl); the washing buffer is 50 mM, pH 8.0 sodium phosphate buffer (containing 300 mM NaCl and 50 mM imidazole); the elution buffer is 50 mM, pH 8.0 sodium phosphate buffer (containing 300 mM NaCl and 500 mM imidazole); and the dialysis buffer is 50 mM, pH 8.0 sodium phosphate buffer.

[0056] Example 6 Construction of ω-aminotransferase mutant library

[0057] Based on the wild-type ω-aminotransferase gene sequence from *Aspergillus avenaceus* (amino acid sequence shown in SEQ ID NO.2, nucleotide sequence shown in SEQ ID NO.1) indexed in GenBank, site-directed mutagenesis primers were designed. Using rapid PCR technology and the recombinant vector pET28a-WT as a template, single mutations were introduced at positions 20, 60, 92, and 186. The primers are as follows:

[0058] R20A Pf: TGCTGGAAGCCAGCGATAACCCG;

[0059] R20A Pr:TTATCGCTGGCTTCCAGCAGTTTTCT.

[0060] G60S Pf: CCTATGATAGCTTTCATGTGTGG;

[0061] G60S Pr:ACATGAAAGCTATCATAGGTCAGATC.

[0062] A92P Pf:TTCCGCTGcCGCTGAGCAGC;

[0063] A92P Pr: CTGCTCAGCGGCAGCGGAAATT.

[0064] L186F Pf:GGGGCGATTTCATTCGCGGCAT;

[0065] L186F Pr:CCGCGAATGAAATCGCCCCACTG.

[0066] PCR reaction system (total reaction volume 50 μL): 1×Phanta max Buffer 25 μL, 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP and dTTP) 1 μL, Phanta Max Super-FIDelity DNA Polymerase 1 μL, upstream and downstream primers (50 μM each) 1 μL, recombinant vector pET28a-WT 1 μL, ddH2O 20 μL.

[0067] PCR reaction conditions: pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 30 s, annealing at 65℃ for 30 s, extension at 72℃ for 4 min, for a total of 30 cycles, and a final extension at 72℃ for 10 min.

[0068] 10 μL of PCR product was transferred into competent cells containing 100 μL of E. coli BL21(DE3). The cells were heat-shocked in a 42°C water bath for 90 seconds, then immediately placed on ice to cool for 3 min. 600 μL of LB liquid medium was added to the tube, and the cells were incubated at 180 rpm for 1 h at 37°C. The cultured bacterial solution was centrifuged at 12000 rpm for 1 min, and 600 μL of supernatant was discarded. The remaining 100 μL of bacterial solution was thoroughly mixed and spread onto LB agar plates containing 50 μg / mL kanamycin resistance. The plates were incubated upside down at 37°C for 14–16 h. Single clones were then picked and sent to Hangzhou Qingke Sequencing Co., Ltd. for sequence detection. The sequencing results were analyzed using software.

[0069] Example 7 Catalyst for enzyme activity assay of ω-aminotransferase mutant: The wild-type recombinant Escherichia coli BL21 / pET28a-WT from Example 3 and the monoclonal strain verified by sequencing from Example 6 were prepared into wet cells according to the method in Example 4 and used as catalysts.

[0070] The final concentration composition of the 10 mL reaction system was as follows: catalyst 50 g / L, triethanolamine buffer at pH 8.5–9.0, substrate 1-piperidin-4-(2,4,5-trifluorophenyl)-1,3-dibutanone (25 g / L), DMSO at a final concentration of 50% (v / v), pyridoxal phosphate 0.5 g / L, and isopropylamine 40 g / L.

[0071] Reaction conditions: temperature 45℃, stirring speed 800 r / min, reaction time 2 h. After the reaction, samples were taken for HPLC analysis to determine the peak area of ​​the product, and the product content was calculated based on the product standard curve.

[0072] Specific enzyme activity is defined as the amount of enzyme required to catalyze the production of 1 μmol of product from the substrate per hour under the above reaction conditions. One unit of enzyme activity is represented by U. The formula for calculating specific enzyme activity is: U / g = n / m*t (n: amount of product, μmol; m: mass of enzyme preparation, g; t: reaction time, h).

[0073] The ee value is defined as the percentage of the total amount of isomer a in an enantiomer mixture that is more abundant than isomer b. The ee value is used to represent the optical purity of a chiral compound. A higher ee value indicates higher optical purity. The formula for calculating the ee value is: ee% = (RS) / (R+S) × 100%

[0074] The HPLC detection conditions were as follows: mobile phase A: 10 mM ammonium acetate; mobile phase B: 100% acetonitrile; mobile phase A: mobile phase B = 1:1 (volume ratio); flow rate: 1 mL / min; detection wavelength: 205 nm; column temperature: 40 ℃. Several excellent mutants were obtained from the detection results, and the enzyme activities of some of the excellent mutants are shown in Table 1.

[0075] Table 1 Results of wild-type transaminase (WT) and its mutants catalyzing the intermediate precursor ketone of sitagliptin.

[0076] Recombinant bacteria mutation site final substrate concentration Enzyme activity (U / g) BL21 / pET28a-WT WT 25g / L 39.8 BL21 / pET28a-MUT1 R20A 25g / L 63.2 BL21 / pET28a-MUT2 R20G 25g / L 8.53 BL21 / pET28a-MUT3 R20A / G60S / A92P / L186F 25g / L 139.3

[0077] The recombinant *E. coli* BL21 / pET28a-MUT1 and recombinant *E. coli* BL21 / pET28a-MUT3 were used to prepare pure enzyme solutions for subsequent catalytic reactions according to the method in Example 5. The amino acid sequence of the ω-aminotransferase mutant obtained from recombinant *E. coli* BL21 / pET28a-MUT1 (denoted as ω-aminotransferase mutant 1) is as shown in SEQ ID No. 4, and the nucleotide sequence is as shown in SEQ ID No. 3. The amino acid sequence of the ω-aminotransferase mutant obtained from recombinant *E. coli* BL21 / pET28a-MUT3 (denoted as ω-aminotransferase mutant 3) is as shown in SEQ ID No. 6, and the nucleotide sequence is as shown in SEQ ID No. 5.

[0078] Example 8: Effect of DMSO Dosage on the Preparation of Sitagliptin Intermediates from Transaminase WT and its Mutants. Wild-type recombinant Escherichia coli BL21 / pET28a-WT pure enzyme solution obtained by the method in Example 5, and recombinant Escherichia coli BL21 / pET28a-MUT1 and BL21 / pET28a-MUT3 screened by the method in Example 7, prepared according to the method in Example 5, were used as biocatalysts. The catalyst dosage was based on protein content, and the amount of DMSO used was calculated as follows: Using sitagliptin intermediate precursor ketone [1-piperidin-4-(2,4,5-trifluorophenyl)-1,3-dibutanone] as a substrate, pyridoxal phosphate as a coenzyme, isopropylamine as a co-substrate, DMSO as a solubilizer, and triethanolamine buffer (pH 8.5–9.0) as the reaction medium, a biocatalytic reaction was carried out to synthesize sitagliptin intermediate (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone. The effect of different amounts of DMSO on the reaction was investigated. A reaction solution without enzyme was used as a blank control, and pure E. coli BL21 / pET28a enzyme solution was used instead of the above-mentioned recombinant E. coli BL21 / pET28a-WT pure enzyme solution as a negative control.

[0079] The final concentration composition of the 10mL reaction system is as follows: 2.5g pure enzyme solution, triethanolamine buffer at pH 8.5-9.0, substrate 5g / L, pyridoxal phosphate 0.5g / L, isopropylamine 40g / L, and different concentrations of DMSO (volume concentrations of 10%, 20%, 30%, 40%, 50%, and 60%).

[0080] Reaction conditions: temperature 45℃, stirring speed 1000 r / min, reaction time 2 h. After the reaction, samples were taken for HPLC analysis, and the specific enzyme activity and ee value were calculated using the method in Example 7. Results are shown below. Figure 1 As shown in Tables 2-4.

[0081] Table 2 Effect of DMSO dosage on the catalytic effect of BL21 / pET28a-WT on the intermediate precursor ketone of sitagliptin.

[0082] DMSO volume concentration % Enzyme activity (U / g) ee% 10 40.3 >50 20 35.3 >50 30 28.8 >50 40 21.4 >50 50 13.3 >50 60 0 0

[0083] Table 3. Effect of DMSO dosage on the BL21 / pET28a-MUT1 catalysis of sitagliptin intermediate precursor ketone

[0084] DMSO volume concentration % Enzyme activity (U / g) ee% 10 90.5 >99 20 79.5 >99 30 61.0 >99 40 37.4 >99 50 17.7 >99 60 3.2 >99

[0085] Table 4. Effect of DMSO dosage on the BL21 / pET28a-MUT3 catalysis of sitagliptin intermediate precursor ketone.

[0086] DMSO volume concentration % Enzyme activity (U / g) ee% 10 136.4 >99 20 121.3 >99 30 98.5 >99 40 55.6 >99 50 27.0 >99 60 5.3 >99

[0087] Example 9: Effect of Different Organic Solvents on the Preparation of Sitagliptin Intermediates from Transaminase WT and its Mutants. The pure enzyme solution of wild-type recombinant Escherichia coli BL21 / pET28a-WT obtained by the method in Example 5 and the pure enzyme solutions of recombinant Escherichia coli BL21 / pET28a-MUT1 and recombinant Escherichia coli BL21 / pET28a-MUT3 screened by the method in Example 7 were used as biocatalysts. The amount of catalyst used was based on protein content. The precursor ketone of the sitagliptin intermediate [1-piperidine-4-(2, Using [4,5-trifluorophenyl)-1,3-dibutanone] as the substrate, pyridoxal phosphate as the coenzyme, isopropylamine as the co-substrate, and various organic solvents (including DMSO, methanol, ethyl acetate, methyl tert-butyl ether, dichlorotoluene, toluene, and isopropyl acetate) as co-solvents, and triethanolamine buffer at pH 8.5–9.0 as the reaction medium, a biocatalytic reaction was carried out to synthesize the sitagliptin intermediate (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone. The effect of different organic solvents on the reaction was investigated. A reaction solution without enzyme addition was used as a blank control, and a purified enzyme solution of *E. coli* BL21 / pET28a was used instead of the above-mentioned purified enzyme solution of recombinant *E. coli* BL21 / pET28a-WT as a negative control.

[0088] The final concentration composition of the 10mL reaction system is as follows: 2.5g pure enzyme solution, triethanolamine buffer (pH 8.5–9.0), substrate (5g / L), pyridoxal phosphate (0.5g / L), isopropylamine (40g / L), and various organic solvents (50% by volume).

[0089] Reaction conditions: temperature 45℃, stirring speed 1000 r / min, reaction time 2 h. After the reaction, samples were taken for HPLC analysis, and the specific enzyme activity and ee value were calculated using the method in Example 7. The results are shown in Tables 5-7.

[0090] Table 5. Effects of different organic solvents on the BL21 / pET28a-WT catalysis of sitagliptin intermediate precursor ketone

[0091]

[0092]

[0093] Table 6. Effects of different organic solvents on the BL21 / pET28a-MUT1 catalysis of sitagliptin intermediate precursor ketone

[0094] organic solvents Enzyme activity (U / g) ee% DMSO 77.2 >99 methanol 97.7 >99 Ethyl acetate 20.7 >99 Methyl tert-butyl ether 20.8 >99 dichlorotoluene 46.5 >99 Toluene 87.1 >99 Isopropyl acetate 31.1 >99

[0095] Table 7. Effects of different organic solvents on the BL21 / pET28a-MUT3 catalysis of sitagliptin intermediate precursor ketone.

[0096] organic solvents Enzyme activity (U / g) ee% DMSO 129.1 >99 methanol 165.2 >99 Ethyl acetate 27.6 >99 Methyl tert-butyl ether 29.1 >99 dichlorotoluene 64.3 >99 Toluene 111.3 >99 Isopropyl acetate 38.3 >99

[0097] Example 10 Determination of enzyme activity half-life

[0098] The reaction system consisted of 10 mL of the following: 2.5 g (based on protein content) of pure enzyme solution prepared according to the method in Example 5 from wild-type recombinant Escherichia coli BL21 / pET28a-WT and recombinant Escherichia coli BL21 / pET28a-MUT3 (R20A / G60S / A92P / L186F) screened by the method in Example 6; 2 g / L of sitagliptin intermediate precursor ketone; triethanolamine buffer at pH 8.5–9.0; 0.5 g / L of pyridoxal phosphate; 40 g / L of isopropylamine; and methanol at different concentrations (10%, 30%, 50%). Before the reaction, the pure enzyme solution was incubated in 10%, 30%, and 50% methanol in a water bath at 45°C for a period of time before the other substances were added. The catalytic reaction was carried out at 45°C with a stirring speed of 1000 r / min for 2 h. Samples were taken and the product concentration was detected using the HPLC method described in Example 7 to determine the enzyme activity half-life. Results are shown below. Figure 2 (Trend chart of half-life at 10% (v / v) methanol concentration) and Table 8.

[0099] Under the same conditions, the reaction solution without added enzyme was used as a blank control, and the pure enzyme solution of Escherichia coli BL21 / pET28a was used instead of the above recombinant Escherichia coli BL21 / pET28a-WT as a negative control.

[0100] Table 8 shows that the recombinant transaminase WT activity decreased to 50% of its initial activity after incubation at 10% methanol for 31.8 h; after incubation at 30% methanol for 3.87 h; and after incubation at 50% methanol for 0.7 h.

[0101] The recombinant transaminase mutant (R20A / G60S / A92P / L186F) showed a decrease in enzyme activity to 50% of its initial activity after incubation at 10% methanol for 98.2 h; after incubation at 30% methanol for 13.3 h; and after incubation at 50% methanol for 3.9 h.

[0102] Table 8 Half-life after incubation at different methanol volume concentrations

[0103]

[0104] Example 11 Application of recombinant transaminase mutant in the preparation of sitagliptin intermediates using a prochiral carbonyl compound as a catalyst. The pure enzyme solution of recombinant Escherichia coli BL21 / pET28a-MUT1(R20A) screened by the method in Example 7 was used as a biocatalyst. The amount of catalyst was based on protein content. The catalytic system consisted of a prochiral carbonyl compound substrate, pyridoxal phosphate as a coenzyme, isopropylamine as a co-substrate, DMSO as a co-solvent, and triethanolamine buffer solution at pH 8.5–9.0 as the reaction medium. The biocatalytic reaction was carried out to synthesize sitagliptin intermediates.

[0105] Substrate 1 is methyl 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyrate, the product is (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyrate; Substrate 2 is ethyl 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyrate, the product is (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyrate; Substrate 3 is methyl 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyrate. (2,4,5-trifluorophenyl)-propyl butyrate yields (R)-3-amino-4-(2,4,5-trifluorophenyl)-propyl butyrate; substrate 4 is 3-carbonyl-4-(2,4,5-trifluorophenyl)-isopropyl butyrate, yielding (R)-3-amino-4-(2,4,5-trifluorophenyl)-isopropyl butyrate; substrate 5 is 3-carbonyl-4-(2,4,5-trifluorophenyl)-propyl butyrate. (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyrate isobutyl ester; substrate 6 is 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyrate benzyl ester, product is (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyrate benzyl ester; substrate 7 is 1-morpholino-4-(2,4,5-trifluorophenyl)-1,3- Butanedione, the product being (R)-3-amino-1-morpholino-4-(2,4,5-trifluorophenyl)-1-butanone; substrate 8 being (2Z)-4-oxo-4-[3-(trifluoromethyl)-5,6-dihydro-[1,2,4]triazolo[4,3-a]pyrazin-7-(8H)-yl]-1-(2,4,5-trifluorophenyl)but-2-one, the product being sitagliptin.

[0106] The final concentration composition of the 10 mL catalytic system was: 2.5 g pure enzyme solution, triethanolamine buffer (pH 8.5–9.0), substrate 25 g / L, pyridoxal phosphate 0.5 g / L, isopropylamine 40 g / L, and DMSO (volume concentration 50%). Reaction conditions: temperature 45℃, stirring speed 1000 r / min, reaction time 2 h. Under the same conditions, a reaction solution without added enzyme solution was used as a blank control, and pure enzyme solution of *E. coli* BL21 / pET28a-WT was used instead of the recombinant *E. coli* BL21 / pET28a-MUT3 as a negative control. After the reaction, samples were taken and the peak area of ​​the product was detected by HPLC as described in Example 6. The substrate conversion rate and ee value were calculated based on the product standard curve. The results are shown in Table 9.

[0107] Table 9 Results of the asymmetric transamination of carbonyl compounds catalyzed by recombinant transaminase mutants (2 h)

[0108]

[0109]

[0110]

[0111] Example 12: Application of recombinant transaminase mutants in the catalytic preparation of sitagliptin intermediates from prochiral carbonyl compounds.

[0112] The recombinant Escherichia coli BL21 / pET28a-MUT1 in Example 11 was replaced with recombinant Escherichia coli BL21 / pET28a-MUT3, and the other operations were the same. The results are shown in Table 10.

[0113] Table 10 Results of the asymmetric transamination of carbonyl compounds catalyzed by recombinant transaminase mutant 3 (2 h)

[0114]

[0115]

[0116] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0117] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A transaminase mutant, characterized in that: It is obtained by mutating the amino acid sequence shown in SEQ ID NO. 2 as follows: The arginine at position 20 is mutated to alanine, and the glycine at position 60 is mutated to serine, the alanine at position 92 is mutated to proline, and the leucine at position 186 is mutated to phenylalanine.

2. A gene encoding the transaminase mutant of claim 1.

3. A recombinant vector, characterized by: The gene of claim 2.

4. A genetically engineered bacterium, characterized by: The gene of claim 2 or the recombinant vector of claim 3.

5. Use of the transaminase mutant of claim 1 in the preparation of sitagliptin intermediates.

6. Use according to claim 5, characterized in that: The method of the use is as follows: wet bacteria obtained by fermenting and culturing a recombinant genetically engineered bacterium containing a gene encoding the transaminase mutant are used as a catalyst, or pure enzyme solution obtained by ultrasonic crushing of the wet bacteria is used as a catalyst, a ketone precursor of a sitagliptin intermediate is used as a substrate, dimethyl sulfoxide is used as a cosolvent, pyridoxal phosphate is used as a coenzyme, isopropylamine is used as a co-substrate, and a pH 8-9 triethanolamine buffer solution is used as a reaction medium to form a reaction system, and a biocatalytic reaction is performed at 40-50℃ and 800-1200 rpm.

7. Use according to claim 6, characterized in that: The wet bacteria are used in an amount of 10-50 g / L, and the pure enzyme solution is used in an amount of 50-100 g / L in terms of protein content; the final concentration of the substrate is 1-25 g / L; the final volume concentration of dimethyl sulfoxide is 10-50%, the concentration of pyridoxal phosphate is 0.25-2 g / L, and the concentration of isopropylamine is 20-50 g / L.

8. Use according to claim 5, characterized in that: The method of the use is as follows: wet bacteria obtained by fermenting and culturing a recombinant genetically engineered bacterium containing a gene encoding the transaminase mutant are used as a catalyst, or pure enzyme solution obtained by ultrasonic crushing of the wet bacteria is used as a catalyst, a ketone precursor of a sitagliptin intermediate is used as a substrate, dimethyl sulfoxide is used as a cosolvent, pyridoxal phosphate is used as a coenzyme, isopropylamine is used as a co-substrate, and a pH 8-9 triethanolamine buffer solution is used as a reaction medium to form a reaction system, and a biocatalytic reaction is performed at 40-50℃ and 800-1200 rpm.

9. Use according to claim 8, characterized in that: The wet bacteria are used in an amount of 10-50 g / L, and the pure enzyme solution is used in an amount of 50-100 g / L in terms of protein content; the final concentration of the substrate is 1-25 g / L; the final volume concentration of dimethyl sulfoxide is 10-50%, the concentration of pyridoxal phosphate is 0.25-2 g / L, and the concentration of isopropylamine is 20-50 g / L.

Citation Information

Patent Citations

  • Transaminase mutant as well as application thereof to preparation of sitagliptin midbody

    CN108866021A

  • Phosphoric acid salt of a dipeptidyl peptidase-iv inhibitor

    WO2005003135A1

  • Combination of a dipeptidyl peptidase-4 inhibitor and an Anti-hypertensive agent for the treatment of diabetes and hypertension

    WO2007050485A2

  • Engineered transaminase polypeptide for preparing sitagliptin

    CN112048485A

  • Omega-transaminase mutant and application thereof

    CN116064457A